Search

Genetic diversity is essential to the long-term survival of tree species. The information about genetic diversity is required for the conserving of Swietenia macrophylla (L.) Jacq species. The field activity was done by collecting leaf samples at the genetic resource area of Sulawesi BPTH, South Sulawesi, Indonesia. Genetic molecular analysis was conducted at Biotechnology and Tree Breeding Laboratory, Faculty of Forestry, Universitas Hasanuddin, Indonesia. Microsatellite markers investigated the genetic diversity for 100 adult trees and 66 seedling mahogany, and the Analysis of Molecular Variance (AMOVA) was performed for assessing molecular variance within and between the populations using GenAlEx software and DarWin 6.5. The seedling population had more alleles than the tree population. The number of private alleles was also higher in the seedling population. The most significant variation was found among the individuals (97%). Variation among the population and within individuals were 3% and 0%, respectively. The present study results will be useful to identify the promising genotype and develop conservation strategies for the mahogany species in the genetic resources area, South Sulawesi, Indonesia. [ABSTRACT FROM AUTHOR]

Katokkon pepper is a type of pepper that is most interested in people because it has a distinctive taste and aroma, especially in Toraja. The accuracy of the genetic diversity of a plant species is largely determined by the appropriate primer for that plant species. The aim of this study was to determine the suitable annealing temperature for amplification of katokkon pepper DNA using ISSR and RAPD primers. Primers that produce clear polymorphic bands will be used as the basis for further analysis of katokkon genetic diversity. Twelve katokkon peppers were collected from three districts in Sulawesi, i.e., Tana Toraja, Enrekang, and Mamasa. Leaves from each individual were then used as DNA sources. Samples would be analyzed in the ISSR and RAPD primer screening process because this research is the preliminary study for genetic diversity analysis on Katokkon pepper. Selection of primers from ten ISSR primers and five RAPD primers showed that all primers were amplified. Clear and polymorphic bands were formed by primer-1, primer-2, primer-3, primer-4, primer-5, primer-7, primer-9, and primer-10 for ISSR primers. RAPD primers were OPA-05, OPG-06, OPAE-11, OPG-19, and OPK-20. Primers are suitable to be used for determining the genetic diversity of Katokkon in further analyses. [ABSTRACT FROM AUTHOR]

Single nucleotide polymorphism (SNP), being the most common genetic variation, is found to be responsible for traits and complex diseases such as asthma. Polygenic risk scoring (PRS) and machine learning (ML) are the current two common types of genetic risk prediction models. PRS employs statistical association testing to identify alleles with risk. However, it was found not performing well in unraveling the SNP-SNP interactions and attaining low predictive value. In contrast, ML algorithms are more robust in detecting disease associated SNPs, resulting in an improvement in prediction performance. The challenge remains as the high dimensionality nature of SNP tends to cause overfitting problems and impact the classifier performance. This paper introduces a two-stage hybrid feature selection that integrates Mutual Information and Random Forest Recursive Feature Elimination for identifying informative SNPs from 176,287 SNPs in a dataset of 128 asthmatic and non-asthmatic samples. The reduced samples based on the identified informative SNPs are then used with Support Vector Machine to train a classification model. The model from this paper outperforms other ML models with an average accuracy, precision, recall and area under the curve of 98.91%, 98.36%, 99.72% and 0.99 respectively. Additional analysis shows that the genes associated with the top selected SNPs, namely Ring Finger Protein 217 (RNF217) and A-kinase-anchoring protein 6 (AKAP6) are correlated with respiratory diseases. This shows that the proposed method can identify important SNPs that are able to differentiate between asthmatic and non-asthmatic samples. [ABSTRACT FROM AUTHOR]

One among the most significant cereal crops farmed all through the world is maize which is scientifically known as Zea mays L. (2n=20), which is a member of the Poaceae family. Because it has the largest yield potential compared to all other cereals, it is referred to as the "queen of cereals". This is a result of extensive genetic variation. "Evaluation of Heterosis in the Genotypes of Maize (Zea mays L.)" was the title of the current study. It consists of sixteen hybrids made from ten genotypes, of which 8 are lines considered to be females, 2 are testers considered to be males, and one is a check. The study was carried out in a RBD with three replications at the Lovely Professional University's experimental farm in Jalandar, Punjab. In this study, the 11 parameters height of the plant, no. of days to 50% tasselling, no. of days to 50% silking, cob length, cob girth, rows of grains per cob, grains per row, number of corns per plant, number of grains per corn, grain yield per plant, and 100 grain weight were used to evaluate heterosis. The hybrids CML440 x BH19, CM149 x BH19 and BML15 x KMH408710 showed heterobeltosis and conventional heterosis in the traits the grain yield and its handout features. As a result, these hybrids are thought to be promising and may be used further in crop enhancement programmes. [ABSTRACT FROM AUTHOR]

In recent years, considerable progress has been made in genomics and proteomics, resulting in much biological data. To draw inferences from this data, advanced computer analysis techniques are required. Bioinformatics is crucial to interpreting and applying this data in any endeavor. As huge amounts of genomic, proteomic, and other data begin to be collected and integrated, the relevance of this emerging area of study will increase. The detection of variation in Next Generation Sequencing is now a standard and indispensable technique in all areas of the biological sciences. Life-threatening conditions like cancer and other diseases may be caused by DNA mutation sequences (genetic mutations). Thus, it's important to discover these mutations early, classify them, and understand their effects on the DNA sequence. Bioinformatics is mostly concerned with the changes to DNA that will occur in the cells of the next generation. The primary goal of this research is to develop a sophisticated and comprehensive approach for classifying the mutation type and categorizing the influence of known disease-causing genetic variations on an individual's risk of disease using a multi-label multi-class deep learning classification technique. A deep neural network was trained using the TP53 dataset (The TP53 gene is a tumor suppressor gene on chromosome 17) to discover the mutation type and its impact in a unified model, as described. To evaluate the performance of the suggested method, the accuracy, recall, precision, and F1 score evaluation scales were utilized. and the results demonstrate that it can accurately determine the mutation type and its effects with an accuracy of 97.58%, Precision 98%, Recall 95%, and F1 score 96%. [ABSTRACT FROM AUTHOR]

Indonesia is one of the largest consumer countries of food made from soybeans in the world. However, so far, soybean production in Indonesia is still low, so an innovation is needed to produce high soybean production. One effort which can be conducted which prepares superior seed through soybean genetic engineering. The purpose of this research is to analyze gene action based on the F2 leaves morphological characteristics of soybean (Glycine max L. Merill). The study used a randomized block design (RBD) three times with data analysis using the SPSS version 20 application. The research subjects were agromulyo x UM 7.6 with their respective parents, namely agromulyo and UM.7.6. In this study, a data normality test was carried out with a skewness and kurtosis normality test. Data analysis is carried out by calculating the average of each character in each variety. The results of data analysis based on the normality test of skewness and kurtosis data are normally distributed (<0.5) on leaf morphological characters (leaf length, leaf width, and petiol length with additive gene action and duplicative epistasis. The character normally distributed means that the characters is quantitative (influenced by many genes). Estimates of heritability for leaf length and width are moderate criteria (influenced by genetics and the environment), leaf petiole length has high heritability (influenced by genetics). This research produced large soybean seed and resistant to viruses. [ABSTRACT FROM AUTHOR]

Phyllosticta species are primarily plant pathogens that infect a wide variety of hosts and are responsible for a variety of diseases, including leaf and fruit spots. Several of these pathogens cause economically significant diseases. However, several Phyllosticta species have been isolated as endophytes from various hosts. The primary characteristic that distinguishes Phyllosticta species is the production of pycnidia containing aseptate, hyaline conidia that are typically covered in a mucoid layer and bear a single apical appendage. Due to their genetic and morphological diversity, which results in structurally diverse secondary metabolites, this understudied microorganism is attracting attention as an attractive source of new compounds. Phyllosticta sp. are excellent sources of naturally occurring drugs because they produce a variety of bioactive molecules such as alkaloids, flavonoids, phenolics, quinines, steroids, and terpenoids. These compounds were discovered to possess a broad range of biological activities, including antimicrobial, anticancer, antioxidant, and herbicidal properties. The occurrence and morphology of Phyllosticta sp. are highlighted in this review. Additionally, the review discusses the bioactive metabolites isolated from Phyllosticta sp. As a result, it can be concluded that Phyllosticta sp. is a reservoir of bioactive metabolites. As a result, additional research on bioprospecting novel compounds from this potential microorganism should be conducted. [ABSTRACT FROM AUTHOR]

Typhonium flagelliforme Lodd. is rodent tuber as an herbal plant with significant potential as a cancer drug raw material. GC-MS analysis revealed that the rodent tuber plant contained bioactive compounds as anticancer agents, including stigmasterol, hexadecanoic acid, oleic acid, and squalene. Rodent tubers are a vegetatively propagated crop resulted in low genetic diversity. Gamma irradiation and somaclonal variation are responsible for changing the genetic variation of rodent tubers in tissue culture. In several mutant clones of rodent tuber Pekalongan accession, high levels of bioactive ingredients were presence as anticancer agents. However, bioactive compounds related to anticancer genes have not yet been studied in mutant clones of the Pekalongan accession. The several mutant clones and wild type of Pekalongan accession plants were examined to identify genes related to anticancer compounds A set of primers was designed specifically from lectin genes as a marker for detecting the presence of anticancer compounds. Results showed that a lectin gene was detected at 500 bp in four mutant clones and in wild-type Pekalongan accessions. A 500-bp genome sequence was obtained from four mutant clones and the wildtype. There were four bp differences observed between PM6 mutant clones and the wildtype on 113, 241, 269, and 279 bases. In PM4, the mutant clone was differed from the wild-type at 323 bp, while the difference between the mutant plants of KP 20-1-2-1-2-6 and the wild type was observed at 322 bp. This study indicates the presence of a lectin gene in both the wild-type and the modified genomes. A single nucleotide base change between the mutant and wild-type plants was also observed. Based on this study, the alteration of the lectin gene in the Pekalongan accession, called as a point mutation was detected. [ABSTRACT FROM AUTHOR]

The goal of the experiment was to determine the genetic diversity of sweet cassava promising clones and to measure the heritability and the closeness of relationship between morphological trait and tuber and starch yield. Place of trial was in Kalipare, Malang, Indonesia in 357 m from sea level with Entisol soil. Experiment was carried out during 2018 with a RCBD, 3 replications. Plants distance was a 100 cm x 80 cm. Twelve promising clones and released variety as check were tested in this trial. The results showed that the genetic variability for fresh tuber yield, starch content, long of tuber, diameter of tuber, tuber number/plant in eight months and plant height in 4 months. Degree of the genotypic correlations was higher than the phenotypic correlations. The fresh tuber yield was positively and significantly correlated with tuber number/plant and tuber long genetically and phenotypically and tuber diameter genetically. The fresh tuber yield was negatively significantly correlated with starch content and plant height in 4 months genetically and phenotypically. Tuber diameter had largest direct effect on fresh tuber yield genetically. High broad sense heritability estimates were recorded in tuber diameter, tuber long, starch content, fresh tuber yield. The tuber yield and starch content of SCPC-3 was high. This promising clone is potential to be released as new variety. [ABSTRACT FROM AUTHOR]

Species producing raw material for pulp and paper that can be grown in the high altitude lands are still limited. One of the potential species for this area is Eucalyptus urophylla. Tree breeding strategy by a progeny test is performed to increase its productivity. The initial selection is implemented at the nursery level by assess the variation of family (mother trees' progeny) (F1). The research aimed to determine the F1 variation by the growth performance of 6 months old F1 seedlings. Samples consisted of progeny from 27 family originated from provenances of East Nusa Tenggara, Indonesia. Indicators of growth performance and determination of rankings are assessed from the seedling's diameter, height, and robustness. The results showed that E. urophylla had high growth performance variation. Based on their growth performance, the best seedlings were from the family of A25, A27, A23, A19, A20 and A21. Genetic diversity among F1 categorized moderate, based on heritability of height (H2=0.37), diameter (H2=0.45) and robustness (H2=0.6). Coefficient of genetic variance (CGV) and coefficient of phenotypic variance (CPV) are more than 20%, and 27 mother trees are divided into 4 clusters. The existence of genetic diversity at the seedling level becomes the material for further testing in the field. [ABSTRACT FROM AUTHOR]

The morphological characteristics among closely related Etlingera species of Achasma group were found overlapping which needs to be confirmed molecularly. Hence, the purposes of this study were to reveal the genetic diversity and relationship of four species, namely E. megalocheilos, E. littoralis, E. coccinea and E. metriocheilos using RAPD markers, also to differentiate the species identity of E. cf. megalocheilos specimens from Sulawesi and Java. The results showed that 13 out of 20 OPA primers were successfully amplifying the DNAs target. Five highly polymorphic primers were selected as recommended markers i.e. OPA09, OPA10, OPA11, OPA18, and OPA20. Diversity analysis showed high genetic richness with Shannon index of 0.417 and the number of polymorphic loci of 98.90%. Clustering and PcoA analyses resulted in three clusters following their species identity. Cluster 1 comprised of three specimens of E. littoralis (similarity value of 44.44% to 61.79%). Cluster 2 comprised of E. coccinea and E. metriocheilos (similarity value of 40.32%). Cluster 3 comprised of E. cf. megalocheilos Sulawesi and E. megalocheilos from Java (similarity value of 34.78%). This study has confirmed that the four Etlingera spp. were genetically distinct, and E. cf. megalocheilos from Sulawesi and Java were possibly the same species but still unclear. Further research using DNA barcodes for a more precise identification is required. [ABSTRACT FROM AUTHOR]

The sweetpotato breeding program is directed not only to have high yields but also to be rich in nutrients, this is needed to increase the competitiveness of sweetpotato products. One of the considerations for determining the parent of a cross is the kinship relationship between the parents which is expected to increase genetic diversity. The Objective of the research to study the kinship relationship of sweetpotato clones based on morphological characteristics. The research was conducted in Wringin Songo Village, Tumpang, Malang Regency. The morphological characteristics of sweetpotato germplasm showed high genetic diversity in stem, leaf, flower and tuber characters. Analysis using UPGMA based on similarity with Euclidean distance using NTSYS 2.02. The clones selected as potential crossbreeds may have high yields and have a fairly large genetic distance. The distant kinship between clones increases the genetic diversity and heterosis value in the offspring. There is a wide diversity in sweetpotato clones based on morphological characters. Based on the dendrogram, the kinship relationship between clones at a genetic distance of 0.25 was divided into five groups/clusters. At this genetic distance, clones that are in one group tend to have similarities. The determination of crossing parents from different groups increases the chances of obtaining F1 offspring with high genetic diversity. [ABSTRACT FROM AUTHOR]

Increasing the genetic variety of a population is very important for the selection process in plant breeding programs. Mutation induction is an alternative method to increase the genetic variability of local sorghum, especially for the character of seed and biomass yield. This study aims to determine the radio-sensitivity of sorghum to applying gamma-ray irradiation in deciding lethal doses, evaluate the emergence of chlorophyll mutations and increase the genetic variation in the M2 generation. The genetic material used was the local sorghum variety Watar Hammu Putih. Seeds were irradiated at a dose of 0–1,000 Gy of gamma rays utilizing a range of 100 Gy. Planting was carried out with a sand chamber. The experimental parameters include survival rate (%), vigor index, and seedling height (cm). After LD50 was determined for sorghum, 100 g of sorghum seeds were irradiated at a dose slightly below that of LD50. Seeds were grown in the field as an M1 population and harvested the panicle individually. A total of 522 panicles were planted in one row per panicle as the M2 generation in two locations (Jakarta and Bogor) and observed their agronomic characters. The radio-sensitivity test result showed that LD50 was found at 433 Gy. Gamma-ray irradiation was carried out at a dosage of 350 Gy for the M1 generation. Chlorophyll mutations appeared in the seedling phase of the M2 population. Two types of chlorophyll mutation were found, namely albino and viridis. The observations on the M2 population showed that gamma-ray irradiation induces an expansion of the range value of all observed agronomic characters. Higher mean values were obtained with a wide range in the panicle length character than the parent at two locations. Some of agronomic characters have a high heritability for the panicle length, chlorophyll content, stem juice % brix, panicle weight and seed yield. Gamma-ray irradiation expanded the genetic diversity of all the agronomic characters of the observed M2 population except plant height, panicle weight and seed yield. [ABSTRACT FROM AUTHOR]

Banana is one of the crops listed under the multilateral system in Annex I FAO. The Province of Yogyakarta has a banana germplasm garden located in Giwangan, City of Yogyakarta. This banana germplasm is very diverse. Some collections were obtained through donations from abroad and exploration carried out in several places in Indonesia. One of them comes from Yogyakarta province which is not yet known for its morphological characteristics or other advantages. This study aimed to determine the genetic diversity of Yogyakarta's banana germplasm based on its morphological characteristics. Morphological characterization has been carried out since 2016 in the Giwangan banana germplasm garden. Characterization was carried out on 31 local banana accessions from Yogyakarta. Observations were made on 48 banana characters based on the banana descriptor guidelines from the International Plant Genetic Resources Institute (IPGRI). The results of color clustergram visualization analysis showed that based on the genotype, the diversity of Yogyakarta banana accession was grouped into 4 clusters, namely group 1 consisting of 12 banana accessions, group 2 consisting of 11 banana accessions, group 3 consisting of 5 banana accessions and group 4 consisting of 3 banana accessions. The main group determinant characteristics were the appearance of leaf's upper surface character, the presence of male flowers, the presence of hermaphrodite flower which have more dominant visualization colors than others. The color clustergram visualization will make the easiest and most effective character selection by using color contrast between groups. [ABSTRACT FROM AUTHOR]

The availability of high genetic variation in plant populations plays an important role in the success of breeding programs. In cacao, a conventional breeding program through crossing between selected parents has been widely used as the simplest method to improve genetic diversity. Characterizing the variability among F1 hybrids since the early stage of growth is important in the process of assembling high-yielding varieties. This study aimed to determine the combining ability of some agronomic traits in cacao F1 hybrids derived from half-diallel crossing. A total of six F1 populations generated from a cross combination of four parental cacao clones including Sulawesi 1, Sulawesi 2, MCC 01, and MCC2 were used in the present study. The experiment was arranged in a randomized block design (RBD) with four replications. The results showed that some agronomic traits, such as plant height, leaf length, leaf width, and petiole length were significantly affected by additive gene action, while stem diameter was by non-additive gene action. Two parental clones, Sulawesi 1 and MCC 01 exhibited positive general combining ability values for all observed characters. Regardless of specific combining ability, MCC 02 x Sulawesi 1 and MCC 01 x Sulawesi 2 were cross combinations showing the highest values for plant height character. Meanwhile, the other two combinations (MCC 02 x Sulawesi 2 and MCC 01 x Sulawesi 1) had the highest values for stem diameter character. Thus, the F1 hybrids generated from these four cross combinations can be selected as genetic materials to develop new high-yielding varieties. [ABSTRACT FROM AUTHOR]

Nicotine is the main alkaloid compound produced by cultivated tobacco plants. Encoding genes involved in the biosynthetic pathway of nicotine have been studied. Single nucleotide polymorphisms (SNPs) are a class of mutations caused by substitution or insertion-deletion, and the most common and simplest type of genetic variation in organisms including plants. This study aims to identify and analyze the diversity of SNPs in the nicotine-related gene sequences from three different types of tobacco. The analysis resulted in 18 putative SNPs (local), 38 putative SNPs (flue-cured), and 15 putative SNPs (aromatic/semi-aromatic) with an average SNP density of one SNP in every 43 bases (local tobacco), one SNP for every 20 bases (flue-cured), and one SNP for every 51 bases (aromatic/semi-aromatic). Base substitutions are more common in transitions (70%) than that in transversion (30%). The nucleotide diversity of the gene fragments was ranging from 0.010 to 0.019. Each type of tobacco analyzed yielded six combinations of haplotypes with a frequency of 16.7% for local and flue-cured, and three combinations of haplotypes with a frequency of 33.3% for aromatic/semi-aromatic tobacco. Three indel types have also been identified in the gene fragment with approximately one indel every 18 bases. The natural indel and SNP variation associated with nicotine content serves as useful genetic information for breeding purposes. Moreover, the high allele variation caused by the single base substitution in the gene fragments could be used to develop an assisted selection tool based on SNPs markers that are associated with nicotine content. [ABSTRACT FROM AUTHOR]

Keladi Tikus, from the genus Typhonium, has the potential to be developed as herbal medicine. Many people use the plant traditionally for curing piles, stomach aches, and coughs. Recently, it has been used extensively as a cancer adjuvant therapy. Similar phenotypic characteristics among Typhonium challenging to distinguish from others. Thus, analysis of genotypic authentication by assessing and exploiting their genetic diversity is essential for conservation, breeding, and plant utilization for medical purposes. This study aims to reveal genetic diversity and relationships among Typhonium species in Java Island using RAPD markers. Ten accessions of Typhonium flagelliforme were collected from West Java, Central Java, and East Java. Four accessions of Typhonium roxburghii and one accession of Typhonium blumei were included in the analysis. Results showed separating the two species clusters in a dendrogram constructed using UPGMA. The phylogenetic relationship among species in T. flagelliforme seems to connect with their geographical separation. [ABSTRACT FROM AUTHOR]

Carnation is one of the main floricultural crops worldwide. The main breeding targets for ornamentals used to be visual qualities such as appearance, flower color, type, size, and plant form. This study aims to obtain carnation genotypes that have a superior appearance as cut ornamental plants and to find out the magnitude of genetic and phenotypic variability values of morphological characters in 10 carnation genotypes. The experiment was conducted at the Indonesian Ornamental Crops Research Institute Experiment Station, Ministry of Agriculture in Cipanas, Cianjur from January to December 2020. The experiment used a Randomized Block Design. The treatment consisted of 10 carnation genotypes from crosses with three replicates. The results showed that genotypes D 2-4, D 3-7, D 4-4, D 13-6 and D 14-6 have the potential to be cut carnation flowers. Genetic variability of plant height, stem diameter, leaf width, number of nodes, number of shoots, flower diameter, number of buds, number of petals, and petal length show broad criteria, while leaf length, flowering initiation, flowering time, petal width and vase life characters show narrow criteria. The phenotypic variability of all characters shows broad criteria. The leaf length has a moderate heritability value, while the other 13 characters have high heritability estimation values. [ABSTRACT FROM AUTHOR]

The Patchouli plant (Pogostemon cablin Benth.) is one of the plants that produce patchouli oil which is one of Indonesia's leading export commodities. However, patchouli breeding has limitations because patchouli cultivated in Indonesia is non-flowering flora; thus, it is challenging to develop superior varieties due to the low genetic variability. Induction of physical mutations by gamma-ray irradiation can increase genetic variability. This study aims to determine the variation of morphological characters from gamma-ray irradiation of Aceh patchouli that has high productivity. This study used a Randomized Complete Block Design (RCBD) with 1 factor, the different doses of gamma-ray radiation at intervals of 0, 20 + 40 Gy, 60 + 80 Gy, and control patchouli planted in the field. The study's results observed that increasing the dose of gamma-ray irradiation inhibits plant growth. Plant control A1 (0 Gy) showed the best growth parameters such as internode length, plant height, leaf length, leaf width, stem diameter, number of branches, amount of chlorophyll, fresh weight, and dry weight. Irradiation plant A2 (20 + 40 Gy) resulted in various phenotypes, such as the character of leaf tip shape, stem color, and branch surface texture. The results of this study in the form of patchouli fresh weight and dry weight can be used as a recommendation to estimate the productivity of patchouli in the form of patchouli oil yield. [ABSTRACT FROM AUTHOR]

Edamame is a vegetable-typed soybean with a large pod size that is very popular as a snack-type food with a sweeter taste. DNA fingerprinting analysis of edamame lines will produce specific identities that are useful for digital registration and protecting superior edamame genotypes. The objective of this study was to analyse DNA fingerprints of edamame advanced lines using SSR markers to obtain fingerprints and construct barcodes on edamame advanced lines. Eight edamame superior advanced lines and 17 SSR markers were used in this study. The SSR markers used were those that are well distributed across soybean chromosomes and were previously well characterised for genetic diversity analysis purposes. Results showed that the total SSR alleles detected in this study were 149 with the average alleles per marker locus being 8.76, an average of gene diversity of 0.83, and an average Polymorphic Information content (PIC) value of 0.81. The PIC values observed ranged from 0.51 (Satt063) to 0.91 (Satt009). Phylogenetic analysis demonstrated that the eight edamame genotypes analysed were divided into two main clusters and are considered closely related to each other having genetic distance values ranging from 3% to 23%. Out of 17 SSR markers analysed, five markers (Satt030, Satt045, Satt147, Satt431, and Satt463) were informative and were very appropriate to be used as DNA fingerprints and the five markers were then used to construct barcodes for edamame genotypes tested in this study. The barcodes should be useful for protection purposes of the superior edamame genotypes analysed in this study. [ABSTRACT FROM AUTHOR]

Rice is the staple food among the Indonesian population. Plant breeding programs in self-pollinated crops like rice, improve genotypic and phenotypic variance, and also made significant enhancement of economic characteristics. The selection of rice genotypes based on high genetic variability would be an effective method. The experimental materials consisted of 12 Oryza sativa L. cultivars from Central Java. The study aimed to obtain information on rice genetic parameters of 22 agronomical characteristics. The results of the present study showed significant differences among rice genotypes. Especially on 3 qualitative characters and 12 quantitative traits. The presence of a more increased genotypic coefficient of variation than the phenotypic revealed the negligible influence of the environment on the expression of rice characters. High heritability was observed in rice leaf width, panicle length, and the number of grains per panicle. A better insight into genetic diversity and the heritability of rice characters in the breeding process can help improve rice grades. [ABSTRACT FROM AUTHOR]

Garlic (Allium sativum L.) is one of the horticultural crops that is widely used as a seasoning in cuisine around the world. This study aimed to analyze the genetic diversity of Indonesia's local garlic accessions based on nucleotide variations in LECASAI and AsNF-YB3 gene fragments. The DNA from eleven Indonesian garlic local accessions were amplified using two pairs of specific gene markers designed from LECASAI (JX561228.1) and AsNF-YB3 (JX310756.1) gene sequences. The sequence alignment showed that a total of 14 nucleotide variations could be identified in this study as SNPs. As many as 12 SNPs were observed in the LECASAI gene fragment, while as many as two SNPs were observed in the AsNF-YB3 gene fragment. From eleven local garlic accessions used in this study, the highest variations were found in Eban NTT and Maja accessions with a percentage of variation of 33.33%, followed by Lumbu Putih with a percentage of 25%. The specific gene markers used in this study could distinguish the nucleotide variations that occurred between garlic-released varieties such as Lumbu Hijau, Lumbu Kuning, and Lumbu Putih and new accession such as Lumbu Hitam. The phylogenetic analysis showed that eleven local garlic accessions used in this study were separated into two main clusters. The first cluster consisted of eight accessions, while the second cluster consisted of three accessions. The markers used in this study would be promising to distinguish close genetic relationship accessions that could not be identified morphologically, especially to protect intellectual property in the future. [ABSTRACT FROM AUTHOR]

The PIT-1 gene regulates animal metabolism and body size, and its variation has been linked to livestock performance. This study aimed at the polymorphism of the PIT-1 gene and the genetic diversity based on its polymorphism (SNP) in the Indonesian beef cattle population. Sixty-five blood samples of Jabres (Indonesian local beef cattle) were used for molecular analysis. A 784 bp partial sequence of the PIT-1 gene was amplified using a pair of self-designed primers (F = 5'-CCCTGGTTCTTTCCTTTGGC – 3' and R=5' – ACAGGAAGGATAAGCAGAGGG – 3'). Based on the sequence's alignment, there were 5 SNPs found. One SNP (211A/G) is located in intron 2, two SNPs (314A/G and 331A/C) in exon 3, and the other two SNPs (507T/C and 754A/C) in intron 3. The higher genotype/allele frequencies of SNP 211A/G, 314A/G, 331A/C, 507T/C, and 754A/C were GG/G, GG/G, CC/C, TT/T, and AA/A, respectively. All SNPs fitted the Hardy-Weinberg equilibrium for genotype and allelic frequencies. A haplotype combination of SNP 211A/G and 754A/C indicated a high LD, so it could be recommended for further analysis. [ABSTRACT FROM AUTHOR]

Kisar sheep is one of the native sheep breeds that successfully survive and are adaptive in the ecology of Kisar Island, Southwest Maluku, Indonesia. This study aimed to explore the genetic diversity and distance of Kisar sheep from the other sheep based on the MT-ND1 gene. Thirteen samples consisted of ten samples from Kisar Island and three collected from Banten Province used in this study. DNA was collected from hair follicles and extracted using a DNA extraction kit protocol. A pair of specific primers of the MT-ND1 gene has been designed using the primer tool NCBI software that covers the whole MT-ND1 gene (956 bp). This study used 34 sequences of the MT-ND1 gene of various sheep breeds from the NCBI Genbank to build a phylogenetic tree. It was constructed by the MEGA X software version (Neighbor Joining, 1,000× bootstrap, Kimura 2 parameter models). The result showed that Kisar and Thin-tail sheep are different groups. Kisar sheep were closer to the Djallonke breed, Sahelian breed, Awassi breed, and Jialuo breed sheep. In contrast, Djallonke and Sahelian sheep were from West Africa, while Awwasi sheep were from Middle East Asia. Based on this study, we asserted that the Kisar sheep breed is a monophyletic group. [ABSTRACT FROM AUTHOR]

Red Chili (Capsicum annum) is one of the horticultural commodities that has a high economic value. To improve the quality and quantity of production, it is necessary to carry out plant breeding between the Laris variety, which has high productivity, and the SSP variety, which has a long shelf life. The purpose of this study was to characterize the genetic diversity of the F2 chili population from a cross between Laris and SSP using SSR molecular markers. Thirty primers were used on both Laris and SSP, and the result showed that eight of the 30 primers gave polymorphic bands. The eight primers were then tested on 42 of the F2 progeny and were analyzed for a genetic relationship using clustering analysis (UPGMA) phylogenetic trees. At the similarity coefficient of 0.74, there were 5 clusters. Cluster 1 consisted of Laris and 29 F2 progenies. Cluster II consisted of SSP and 8 F2 progenies. Meanwhile, 5 progenies were in separate other clusters. [ABSTRACT FROM AUTHOR]

Common Kingfisher (Alcedo atthis) is one of Alcedinidae bird species that is distributed in Eurasia and North Africa regions. According to IUCN Red List, this species has a conservation status of Least Concern. This study aims to to observe the genetic diversity of the partial Cytochrome oxidase subunit I (COI) gene in Common Kingfisher. A total of twenty-seven (27) COI gene sequences (624 bp) were collected from the GenBank database for data analysis. Four molecular software of BioEdit, MEGA-X, DNAsp and ARLEQUINE were applied in this study to perform the bioinformatic analysis in observed sequences. The study showed that eight (8) mutation sites and seven (7) haplotypes were detected in the COI gene of the Common Kingfisher. The haplotype diversity (Hd) and nucleotide diversity (pi) values in this study were 0.63±0.09 (medium) and 0.002±0.0005 (low), respectively. The Neutrality test of Fu and Tajima were -2.01 and -1.17. A negative value in both tests indicated that the species expansion occurred in the population that affected nucleotide variation. In conclusion, Common Kingfisher in this study can be discriminated into two (2) clades A (Hap.1, Hap.2, Hap.3 and Hap.6) and B (Hap.4, Hap.5 and Hap.7). This finding suggests that the Hap.1 was confirmed as the common haplotype in the Common Kingfisher. [ABSTRACT FROM AUTHOR]

Myxospermous seeds like Plantago ovata release a heteroxylan-enriched mucilage upon hydration. The mucilage is commonly called psyllium, utilised for food, health, and industrial applications. Low genetic diversity has hindered progress in generating P. ovata well-suited cultivars to abiotic and biotic stress conditions while maintaining high mucilage production. Induced mutation has been reported to generate genetic variation, improving rice and beans crops. This study aims to screen a mutant line with high productivity but without displaying pleiotropic phenotype for identifying genes related to mucilage production. A twenty-seed sample from each mutant line (201 lines) was photographed under a dissecting microscope and weighed using an analytical balance before mucilage extraction. The images were analysed using Fiji ImageJ v1.51 to measure area, perimeter diameter, circularity, and roundness. Principal Component Analysis (PCA) helped to summarise nine variables into two principal components (PC1 and PC2), explaining 97% of the variation in the data. Line 970-1 was selected and named raya (ray), meaning 'greater' in Indonesian, as it produced a high mucilage yield with minimal effects of background mutations. [ABSTRACT FROM AUTHOR]

Based on the color pigment, rice has a variety of colors. Red rice is a colored rice with a higher genetic variation than other colored rice. Genetic conservation is an effort to prevent the loss of local red rice genetic resources by providing superior varieties that have more profiTABLE characters for farmers. One of the genetic conservation efforts that must be done is DNA sequencing using barcoding DNA matK gene. This research aims to Barcoding the DNA of local varieties of red rice in South Sumatra based on the matK gene. Methods used in the study include DNA isolation using Tiagen Plant Genomic DNA KIT DP305, electrophoresis resulting from DNA isolation, DNA amplification using matK Xf and matK-MALP primer and DNA sequencing. The result showed that the matK gene in 8 samples of red rice local varieties South Sumatra was successfully amplified by the presence of DNA bands at size between 750 bp – 1000 bp and there was a high similarity with Oryza sativa maturase K gene No. Accession KU923990.1 but there are differences in nucleotide bases between samples local varieties of South Sumatra red rice as indicated by mutation events. [ABSTRACT FROM AUTHOR]

In this paper we discuss the research about genetic algorithm application in fuzzy controller synthesis. Genetic algorithm is artificial intelligence approach and it allows finding fuzzy controller parameters which can provide the extreme value of optimization criterion. The authors describe the work of variation operator which includes into genetic algorithm. This research presents the results of automatic control system modeling simulation, input variables term-sets, rule base, array of fuzzy controller parameters and distribution of squared variances sum for variation of different groups of fuzzy controller parameters. Also article contains statistical analysis by testing statistical hypothesis about significant difference between variation of membership function parameters, rules consequences and rule weights. [ABSTRACT FROM AUTHOR]

The assessment of genetic diversity is a key step in evaluating the adaptation of populations to new environmental conditions, and thus in the selection of new cultivars. The present investigation aimed to assess genetic variability of bread wheat (Triticum aestivum L.) genotypes grown in Algeria. The 17 hexaploid genotypes of bread wheat were assessed using 16 molecular microsatellites of SSR (Simple Sequence Repeat). Among the 16 microsatellite markers tested, only 11 markers were the most polymorphic and reproducible. The Polymorphism Information Content (PIC) values per locus varied from 0.14 to 0.70 with an average of 0.48 and 0.49. Genetic similarity between genotypes varied from 0.27 and 0.92 with an average of 0.60. The highest genetic distance value of 0.92 has been scored between Kauz/Pastor/Fiscal and Wbll1*2/Brambling. The lowest value of 0.27 scored between Cham6 and Pastor/Wbll1. Genetic similarity calculated from molecular data and used to produce a dendrogram. The genotypes involved were divided into two clear groups according to their origin and pedigree. The first cluster included wheat genotypes Ain Abid (local genotypes), Attila/2 Pastor, and 5119 (introduced genotypes). The second group revealed high polymorphism and subdivided into four sub-groups. The high diversity revealed among the wheat accessions grown in Algeria is likely to be used in genetic improvement programmes. [ABSTRACT FROM AUTHOR]

Identification and quantification of the factors that influence genetic diversity is particularly important for the representatives of the genus Quercus L. In this genus, the characterization of the genetic diversity correlations can serve as a basis for predictive models of its distribution. The adaptive and neutral genetic variability of four autochthonous oak species (Quercus petraea (Matt.) Liebl. - sessile oak, Q. pubescens Willd. - pubescent oak, Q. frainetto Ten. - Hungarian oak, Q. cerris L. - Turkey oak) was studied at the Landscape of Outstanding Features (LOF) "Kosmaj" in Serbia. This study aimed to test to which degree the inter- and intraspecific genetic variability of oaks is the result of the genotype influence, local habitat conditions, environmental factors, population management practices, and the historical processes that the analyzed populations have gone through. In total, 247 individuals of the four selected oak species were investigated. Adaptive variability was studied using geometric morphometric methods (landmarks and outlines), and neutral variability using nuclear microsatellites (nSSRs). The results showed that the adaptive variability of oaks at the LOF "Kosmaj" is related to habitat characteristics, environmental conditions, and oak population management practices, while neutral variability analysis showed relatively high genetic diversity levels of all studied oak species. The consistency of the results obtained using adaptive and neutral genetic markers, and the consistency of the obtained results with previously published data on genetic variability of oaks was also observed. The results suggest that the effective conservation of oak genetic resources at the LOF "Kosmaj" requires coordinated efforts of the forestry, environmental and nature protection sectors. An important goal is the determination of priority species, populations and areas for the conservation of oak genetic resources in the form of in situ conservation units and ex situ methods, within a coherent program and in accordance with national policies and the biological capabilities of each species. [ABSTRACT FROM AUTHOR]

The p53 protein engages in numerous biological processes, including Cell development and DNA repairing. Genetic variants of TP53 gene have associated to the development of tumors worldwide. There are more than 200 genetic polymorphisms (SNPs) have been identified, however a well instance at codon 72, Pro72Arg (rs1042522), produced conflicting outcomes in terms of tumor hazard. The goal of this research should be to determine whether the nucleotide sequence variant (SNP) Pro72Arg (rs1042522) in the TP53 gene is linked to an increased hazard of breast carcinoma in women. Method This research contained (95) samples taken from women with an age average (35-45) which separated into (74) samples from women with breast cancer and (21) samples from women in the same age group who did not have breast cancer. The researchers use a method to extract DNA from the blood of all the samples included in the study, the genotyping test include Detection of (rs1042522) Polymorphism by ARMS-PCR and Detection of Exon 7 (codon 249) Polymorphism by RFLP-PCR. Result, The result of this study showed there is a correlation between Breast cancer in women and mutation of P53 gene in location rs1042522, On the other hand the result showed for observation of allele, the wild allele C existence 80% in healthy women and 58% in patients, and mutant allele G existence 20% in healthy women and 42% in patients, and the odd ratio for allele is 3.0640 like that considered a risk factor for disease. Also, the result of the study showed there is a relationship between Breast cancer in woman and mutation of P53 gene in location codon 249, On the other hand the result showed for observation of allele, the wild allele G existence 78% in healthy women and 39% in patients, and mutant allele C existence 22 % in healthy women and 61% in patients, and the odd ration for allele be 14.422 like that considered a risk factor for disease. [ABSTRACT FROM AUTHOR]

For years, the design of extrusion dies has been based on proven geometries, such as spiral mandrel manifolds for blown film extrusion. Common designs are based on patents originating in the 1960s which is why they are very limited by the constraints of conventional manufacturing processes. Considering current capabilities of additive manufacturing technology, there is potential for thermo-rheological optimization of melt-carrying channels of extrusion dies by widening geometrical degrees of freedom. Within a former project an additively manufactured demonstrator extrusion die consisting of a primary and secondary distribution has successfully been built and experimentally approved. However, the design of this geometry is entirely based on geometrical constraints such as cross-sectional area, lead curve length and local curvature. By, e.g., minimizing the melt leading channels' curvature a gentler deflection can be achieved. Nevertheless, the resulting flow behavior cannot be quantified directly and is only a result of a geometrical optimization. The aim of this paper is to introduce an approach on how to completely consider and assess the flow situation during the phase of designing by evolving the previously developed geometrical-based optimization to a CFD-based one taking the actual flow situation inside the die into account. This is done by establishing an automated optimization which first generates a population of numerous variants using parameters integrated into the CAD model. The optimization then automatically evaluates the variants by using a genetic algorithm following biological principles of evolution and by using CFD calculations and quality criteria specifically adapted and developed for this kind of optimization and geometry. Initial concepts show that this optimization setup results in multiple flow optimized designs which can be chosen from to concretize the final design of the extrusion die. [ABSTRACT FROM AUTHOR]

Background: Mobile genetic elements (MGEs) comprise a major portion of the human genome and are essential for genetic diversity. These elements are known to have the capability to induce mutations in the human genome. To date, several MGE insertions have been reported to be associated with cancer. We aim to use genome next-generation sequencing data and appropriate bioinformatics tools to accurately identify the insertion sites of MGEs in the human genome. Results: Herein, we introduce the MeX pipeline for the localization and annotation of MGEs in paired-end sequencing data. It requires the reference genome sequence, MGE sequence assembly and paired-end sequencing reads. We evaluated MeX on high depth (>75×) Illumina HiSeq data produced at the Broad Institute (NA12878) against human genome 38-built (including only chromosome 1, 10 and 11) and Alu elements assembly. We could identify 78 reference and 1 non-reference Alu insertions in the NA12878 sample. Upon annotation, it was found that the non-reference Alu element was in the 3' UTR region of the RNF2 gene. Out of 78 reference insertions, 42 were in the intronic region, 7 in the upstream region, 5 in the downstream region, 1 in the 3' UTR region and the rest were not associated with any gene. MeX showed high performance for the identification and annotation of MGEs in genome samples. Conclusion: This study showed that MeX is a robust and powerful tool for identifying and annotating MGE insertions. It may also serve as a valuable tool to study the phenotypic changes resulting from transpositional events in cancer genomics. [ABSTRACT FROM AUTHOR]

To unlock the potential of a variety, it is important to ensure high varietal qualities of seed material. In primary seed production, the method of prolamin electrophoresis is actively used to maintain the genetic stability of varieties. Analysis of prolamins makes it possible to judge the heterozygosity and genetic stability of future populations and makes it possible to exclude unwanted genotypes from further reproduction. The aim of the research was to evaluate the effectiveness of using the prolamin electrophoresis method to maintain the genetic stability of populations of varieties of West Siberian breeding. The research was carried out from 2014 to 2021. During this period, two varieties of barley and three varieties of oats were analyzed. It has been established that the basis of most of the analyzed varieties is one biotype. The oat cultivar Otrada consists of two biotypes in a 2:1 ratio, the cultivar formula is Avn A10+11 B4 C8. Over 4 years of regular application of the electrophoresis method in the primary seed production of the Otrada variety, the amount of varietal impurities decreased from 22.2% in 2014 to 6.2 and 2.6% in 2018 for biotypes I and II, respectively. Barley varieties Abalak and Kudesnik have an identical component composition of hordeins with the formula HRD A2 B8 F2. The selection of genotypes most adapted to the natural and climatic conditions of the region led to the coincidence of the spectra of hordeins. It has been established that a systematic analysis of the component composition of prolamins leads to a significant decrease in varietal impurities in the cultivar population and ensures its genetic stability. For the effective application of the electrophoresis method, the size of the analyzed sample should be at least 700 families. Information about the reference spectra of variety prolamins makes it possible to control the constancy of their biotype composition, to assess varietal purity during cultivation, and to assess intraspecific genetic diversity and its dynamics over time. [ABSTRACT FROM AUTHOR]

The purpose of this research is to select and validate microsatellite DNA loci to develop a technique for genotyping soybean varieties by fragment analysis with fluorescence detection, which will allow quick and precise identification of varieties for their certification. We conducted a fragment analysis of 27 soybean varieties using 10 microsatellite loci. The polymorphism analysis of these varieties revealed a significant genetic diversity. The level of informativity of the studied system of microsatellite markers was at a sufficiently high level and amounted to 0.55. Application of these markers for fragment analysis by capillary electrophoresis provided unique DNA profiles suitable for soybean variety identification and certification. We revealed intravarietal polymorphism of several soybean varieties, which should be taken into account in the development of molecular-genetic passports. Cluster analysis showed heterogeneity in the studied sample of varieties. [ABSTRACT FROM AUTHOR]

The brushtooth lizardfish (Saurida undosquamis) is an economically important demersal fishery resource yet several important aspects critical for its conservation are poorly studied. In the current study, the genetic variability and structure of ten S. undosquamis populations from the Exclusive Economic Zone of the east coast of Peninsular Malaysia (ECPM), Malaysia,were assessed based on the mitochondrial 16S rRNA gene marker. The final sequence alignment (563 base pairs) of 112 fish samples revealed a total of 11 putative haplotypes among the populations. In general, the results indicate that S. undosquamis from the ECPM was characterized by a moderate haplotype diversity (h=0.682) and a low nucleotide diversity (π=0.0012). These characteristics coupled with historical demography analyses suggest a recent population expansion during the late Pleistocene epoch. Genetic homogeneity within the ECPM (panmixia) was observed, attributed to its dispersal ability, water currents, absence of physical barrier to gene flow and/ or range expansion. This recommends for a single-stock management regime for S. undosquamis in this region. [ABSTRACT FROM AUTHOR]

The human EPHX1 gene resides in chromosome 1q42, consists of 9 exons, and encodes the microsomal epoxide hydrolase (mEH) protein mainly expressed in the liver and therefore plays an important role in biotransformation, such as in antiepileptic and chemotherapy drugs. This study aimed to assess the primer quality and to obtain optimal conditions for an amplification process using polymerase chain reaction (PCR) which could be used to detect the genetic variants of rs1051741 T337C EPHX1 and to analyze such polymorphisms in 6 DNA samples from healthy Javanese subjects in Indonesia. The suitability of the selected primers for the DNA sequence containing target SNPs was confirmed using the Primer3Plus application and analyzed in Primer-BLAST. Optimization of PCR conditions was carried out toward the temperature of denaturation, annealing, and elongation as well as the number of cycles in the amplification process. Meanwhile, the variant analysis was performed through sequencing. The primer pair, 5'-GATAAGTTCCGTTTCACCC-3' forward primer and 5'TGTTCCTGCCTAGCTCTAA-3' reverse primer, proved to be able to amplify the DNA sequence which contained the SNPs of T337C under PCR conditions at 94°C denaturation, 55°C annealing, and 72°C elongation repeated for 32 cycles. The variant analysis of 368 bp amplicon through sequencing found that three of the six samples were heterozygous (CT), and the rest were homozygous mutant allele (CC). Further studies are recommended to correlate such polymorphisms with the need for carbamazepine maintenance dose and the risk of nephrotoxicity due to cisplatin to provide an individualized treatment approach based on the genetic variants among Javanese-Indonesian patients. [ABSTRACT FROM AUTHOR]

Hybridization can be performed to enhance durian cultivars in order to achieve the desired ideotype. The purpose of this study was to determine the genetic diversity of durian hybrids using morphological features. The research was conducted at Aripan Experimental Station of Indonesian Tropical Fruit Research Institute (ITFRI) from January 2019 to May 2021. The plant materials used in this study were the result of intra- and inter-species hybridization, yielding a total of twelve durian hybrids. Fruit weight, fruit stalk length, flesh thickness, pulp unit number per carpel, fruit rind thickness, edible portion, seed number per fruit, and seed weight average were observed quantitatively, while fruit structure, flesh color, taste, and texture were noticed qualitatively. The means, standard deviation, and coefficient of variation of quantitative features were determined, whilst qualitative characters were presented descriptively. The program Numerical Taxonomy and Multivariate System version 2.02 (NTSys) was used to calculate similarity indices and perform cluster analysis. The results indicated that durian hybrids 93(11) outperformed 72A(12) in terms of fruit weight, flesh thickness, edible part, flesh color, and texture. These hybrids may be considered as superior variety possibilities. Twelve hybrids exhibited a high degree of genetic diversity (similarity coefficient of 36%). Durian hybrids were classified into six categories based on a 47% similarity coefficient. [ABSTRACT FROM AUTHOR]

Mangosteen is classified as an apomictic plant due to its limited genetic diversity. The genetic differences between mangosteen can be determined by analyzing polymorphism and monomorphic DNA fragments. The purpose of this study was to identify and characterize mangosteen DNA fragments using RAPD analysis. Seven mangosteen accessions from West Sumatera, Riau, Jambi, and West Java were used in the study. DNA extraction, PCR amplification, DNA fragment separation, cloning, sequencing, and BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi) were used in this study. 69 DNA fragments were extracted and sequenced through RAPD analysis. Homology analysis revealed that 82% of the sequences contained transposons and microsatellites. Two segments homologous to calcium/calmodulin-dependent protein kinase II delta (CAMK2D) and KATAMARI1/MURUS3 were discovered in non-gamboge disease samples. This enzyme is involved in calcium ion regulation, endomembrane organization, and xyloglucan galactosyltransferase, all of which are necessary for the physiological mechanisms of the cell wall. These findings can be used to further our understanding of the mechanisms underlying genetic variation and gamboge disease in mangosteen. [ABSTRACT FROM AUTHOR]

Indonesia is native to a great number of Durio species due to its location as the center of origin for durian, which makes it a biodiverse country. Therefore, before numerous species become extinct, it is critical to conserve and sustainably utilize durian's valuable genetics for the development of superior variants. The fact that commercial durian is the only type available in the modern ages. This demonstrates the importance of intensifying study on wild durian in comparison to Durio zibethinus, particularly the detection of hybrids. Ex-situ conservation efforts have been made by collecting 11 Durio species with a total of more than 130 accessions kept in 12 botanic gardens around Indonesia. The distribution of these Durio species was also examined, as were efforts to identify the fingerprints of various Durio species and their hybrids for future applications. The genetic variation and prevalence of hybrids between D. graveolens x D. zibethinus and D. kutejensis x D. zibethinus were assessed using three primers of Random Amplified Polymorphic DNA (RAPD). DNA banding patterns research revealed that all hybrids shared 2-4 bands with their parents. D. graveolens x D. zibethinus hybrids produced more bands than either parent, but D. kutejensis x D. zibethinus hybrids produced similar but fewer bands than either parent. These profiles corroborated the presence of hybrids in those three species. Additionally, the efforts and results of this study will contribute to reversing biodiversity loss and will serve as a foundation for the future development of commercial durian from wild durian. Ex situ conservation, distribution, fingerprint analysis, RAPD analysis, Durio species, Indonesia. [ABSTRACT FROM AUTHOR]

Duku (Lansium domesticum Corr.) is a tropical fruit crop indigenous to Indonesia and Malaysia. Duku Kalikajar is well-known for its excellent flavor, thin seeds, and enormous fruit size. Due to these characteristics, this cultivar commands the most outstanding premium. Apart from Duku Kalikajar, there are additional duku Variations in the area surrounding the districts of Purbalingga, Banyumas, and Banjarnegara. This study used RAPD markers to determine genetic variants and genetic relationships among 11 duku variations from the Banyumas, Purbalingga, and Banjarnegara districts. DNA was isolated from three regencies using the CTAB method with minor modifications. The variable noticed was the visualization of PCR-amplified bands using RAPD markers. MEGA ver 6.06 with the UPGMA algorithm was used to determine the genetic connection. PIC values of 0.5 to 0.8 were considered helpful to be very informative for the eleven duku variations. A single Variation possessed several distinct bands, including OPA-02 at 400 bp in duku Kalikajar variation 2, OPA-18 at 750 bp in duku Kembaran, OPA-18 at 800 and 900 bp in duku Wanadadi, and OPB-07 at 750 bp in duku Sigaluh. Duku variations were classified into three clusters, two central and one basal. All groups displayed a dispersed grouping pattern, implying a significant interspecies crossing across the local duku variations sampled in the Purbalingga, Banyumas, and Banjarnegara districts. [ABSTRACT FROM AUTHOR]

Blackwater fish are native to Asian waters, the genetic diversity of which is unknown to the rest of the world. Despite the fact that their scientific names are generally the same, the taxonomy of many blackwater fishes remains a mystery due to differences in physical features depending on place of origin. The majority of species are difficult to recognize and discriminate against due to a lack of well-defined characteristics for each species, ambiguous taxonomic categorization, and poorly resolved taxonomy. The 16S rRNA gene was used as the molecular marker for species identification and phylogenetic relationships between Blackwater fish from the North Selangor Peat Swamp Forest (NSPSF) and several species from the NCBI database. A total of 115 blackwater fish samples were collected from the NSPF. Molecular Evolutionary Genetics Analysis X (MEGA-X) was used to check all samples for sequence discrepancies. The Neighbour-Joining (NJ) technique was used to calculate the tree's branch lengths using Tajima Nei model and Kimura 2-parameter model, followed by Maximum Parsimony (MP) method to determine character change using the tree length. The phylogenetic tree analysis using the NJ and MP methods reveals that the NSPSF blackwater fish species are similar to various blackwater fish in the NCBI database, with a genetic distance of 0.15% and 15%, respectively, indicating high variability. The base composition revealed that the 16S rRNA gene is a conserved region, with a value of 44.04%. Therefore, the study demonstrates that 16S rRNA gene is wellsuited for species identification research. The findings of this study can assist understandings on the genetic relationships of several blackwater fish species from North Selangor Peat Swamp Selangor and contribute to species conservation efforts. [ABSTRACT FROM AUTHOR]

The blackwater fishes are frequently difficult to identify and differentiate within species due to the lack of well-defined characters for each species. The aim of this study is to use the cytochrome b (cyt b) gene to evaluate phylogenetic analysis on blackwater fishes in a peat swamp forest. A total of 23 blackwater fish were collected from Raja Musa Peat Swamp Forest in Bestari Jaya, Selangor. From the total number of individuals examined for the cyt b gene, eight species were identified, Helostoma temminkii, Hemibagrus capitulum, Mystus singaringan, Leiocassis poecilopterus, Leiocassis poecilopterus, Clarias meladerma, Clarias sp. and Belontia hasselti, with a range of similarity of 91.47 % to 99.64% in the NCBI (National Center for Biotechnology Information) database. This study also shows that the cyt b gene is still a conserved region and allows for molecular species identification. The genetic variation among blackwater fish species was determined by generating genetic distance with Molecular Evolutionary Genetics Analysis X (MEGA-X). The finding revealed that the nearest species is between Clarias sp and Clarias meladerma (5.2%) due to similar family, and the highest genetic distance (23.9%) was between Helostoma temminkii and Clarias sp due to distinct morphological characteristics. Based on the phylogenetic tree, two distinct clades were formed from the tree, with Myotis sp. acting as the basal of the tree, proving that this species is not a blackwater fish. This study concludes that the cyt b gene is suitable for molecular identification of blackwater fish species. [ABSTRACT FROM AUTHOR]

Genetic improvement through selection requires the estimation of the heritability parameter of the desired trait to estimate the breeding value of parents for the next mating. Heritability values of milk yields were estimated in Saanen goat kept under intensive management in Sukabumi District, West Java. Data of various 30-d partial cumulative milk yields (30-d PCMYs) from 277 records of the female offsprings of 12 Saanen bucks were used to estimate heritability values (h2) by paternal half-sibs method. General linear model (GLM) was fitted by considering each of the 30-d PCMYs (from 30 to 180 days) as independent variables. Whereas dependent variables were considered as fixed variables for the buck, lactation period (1-≥7), calving season (1-3, 4-6, 7-9, and 10-12 months), and kidding years (2004-2014). Averages of the 30-d PCMYs at 30-d, 60-d, 90-d, 120-d, 150-d, and 180-d lactations were consecutively 51±14 lt, 103±30 lt, 152±43 lt, 198±59 lt, 237±70 lt, and 272±82 lt. Estimated heritability values (h2) of the respective 30-d PCMYs were successively h2=0.228±0.103, 0.220±0.182, 0.192±0.183, 0.177±0.183, 0.158±0.184, dan 0.169±0.184. Milk yields of the observed Saanen goats were moderately influenced by the genetic diversity of the bucks. The reason might be a random mating by using the available Saanen bucks and does in mating activity still allowing sufficient genetic diversity of milk production in this population. [ABSTRACT FROM AUTHOR]

The purpose of this study was to identify the genetic diversity of the Gayo buffalo as a genetic resource for local livestock through phenotypic analysis. The method used is a survey method by collecting data on the body size of the Gayo buffalo and collecting data on its qualitative characteristics. The buffalo's body parts measured were shoulder height, body length, chest circumference, and hip width. The samples came from three districts (Aceh Tengah, Bener Meriah, Gayo Lues). Data processing using Excel datasheet. Data analysis was tabulated according to sample locations and different age groups. Characterization of body sizes is carried out by calculating each observed trait's mean value and standard deviation. The results of the study from three districts on the shoulder height parameter for the age group <2.5 years of 113.62±6.84 cm, the age group of 3.5 years of 121.65±10.24 cm, for body length parameters, age group <2.5 years is 114.33±9.14 cm, the age group of 3.5 years is 126.85±13.86 cm, for the chest circumference parameter in the age group <2.5 years is 155.47±36, 93 cm, in the age group of 3.5 years it was 182.08±24.57 cm, for the parameter of hip width in the age group <2.5 years it was 36.83±7.83 cm, and in the age group 3.5 years 48.67±2.52 cm. The results of this study identified that the body size of the Gayo buffalo from the three sub-districts taken as samples had almost the same size and was in average condition. [ABSTRACT FROM AUTHOR]

In the world market, there is a tendency towards an increase in demand for poultry products. Therefore, it is necessary to confirm the need to intensify the production of chicken meat and eggs, as the most popular type of poultry products by consumers. One of the modern ways to increase the efficiency of the breeding process is the use of molecular genetic markers. Heterozygous individuals with genotype AG for myostatin gene up to 29 days of feeding have a comparable live weight with broilers with genotype GG and are even insignificantly inferior to the last 7.07 g of weight, and are inferior to individuals with an unknown genotype of 22.41g. At the last stage of feeding broilers, individuals with with the AG genotype outnumber individuals with the GG genotype by 484.57g (p<0.05). Thus, the heterozygous allelic variant of the AG genotype G2109A for the myostatin gene in broilers of the Ross-308 cross can be considered promising for use in marker-associated breeding to obtain a higher live weight. Heterozygous individuals with genotype AG for myostatin gene up to 29 days of feeding have a comparable live weight with broilers with genotype GG and are even insignificantly inferior to the last 7.07g of weight, and are inferior to individuals with an unknown genotype of 22.41g. At the last stage of feeding broilers, individuals with the AG genotype outnumber individuals with the GG genotype by 484.57g (p<0.05). Thus, the heterozygous allelic variant of the AG genotype G2109A for the myostatin gene in broilers of the Ross-308 cross can be considered promising for use in marker-associated breeding to obtain a higher live weight. Homozygous broiler chickens with genotypes AA and GG on day 12 had a lower (p<0.05) live weight by 19.51g (4.24%) and 18.36g (4.51%), respectively, in comparison with the AG genotype for the insulin gene. On the 29th day of rearing, individuals with the AG genotype already had the lowest live weight, which is 529.85g less (p<0.01) from the GG genotype, 535.83g less (p<0.01) from the AA genotype, and 552.26 g less from broiler chicks with unknown genotype. The largest pre-slaughter live weight was observed in broiler chickens with the genotype for the insulin GG gene, which is 472.66g more (p<0.05) from the AA genotype, 1274.19g more (p<0.001) from the AG genotype and 216.79g more (p<0.05) from individuals with an unknown genotype for the insulin gene. [ABSTRACT FROM AUTHOR]

Sandalwood (Santalum album L) is well known for its enormous economic value. The high value of santalol in its oil is in line with the price and quality grade of the wood products. Prior research on genetic diversity and high oil quality producer trees has provided superior tress to propagate. Our study objectives were to provide clonal propagation of selected superior trees using tissue culture techniques. Four mother trees, named P.6.1, P.6.2, A.III.4.14, and TA.12, were selected to run the test. Shoots from branch-soaked in tap water were utilized in shoots cultures. The study showed that P.6.1 gave the most significant number of shoots produced in the soaking branches technique, while A.III.4.14 produced mean most extended shoots. Best induction response showed by P.6.1 (90%) while in multiplication phase A.III.4.14 produced highest mean average shoots number with 24 shoots and meant most extended shoots with 4.3 cm. Further study on rooting ability, using A.III.4.14 clones, showed its most significant success rate after 3 months after induction. In the acclimatization phase, the media combination of topsoil + sands + fertilizer yeast+ 1 ml L-1 (M1P3) gave the best response to the growth of shoots and roots of sandalwood plantlets. [ABSTRACT FROM AUTHOR]

Pepper is an important and widely distributed crop in West Sumatra. Many varieties of Pepper have been used for spice and medicine. Molecular characterization of these varieties is important for the geographical distribution of genetic diversity. This study characterized 15 local genotypes taken from different locations in West Sumatra using SRAP markers to determine the genetic diversity among genotypes. Total of 16 SRAP primers combinations showed 5 maximum numbers of bands from Me2+Em3. The percentage polymorphism ranged from 40% to a maximum of 100%. The average of Polymorphism information content obtained was 0.117. The Jaccard similarity and UPGMA clustering grouped 15 local genotypes into two groups; cluster one consisted of 13 genotypes and second cluster consisted of two genotypes. The phylogenetic analysis The result of the current study suggested SRAP markers were sufficient for identification of local Pepper genotype and will be valuable information for its improvement. [ABSTRACT FROM AUTHOR]

A high level of rice consumption with specific rice preferences makes it necessary to meet the needs of West Sumatra province in rice. The abundance of genetic diversity, especially the local upland rice from West Sumatera, makes a great opportunity in obtaining local cultivars with the desired characteristics. The study aimed to assess the performance, heritability, and variability of grain characters of 29 local upland rice cultivars of West Sumatera. The evaluation of 29 local upland rice cultivars was conducted at the Experimental Field, Faculty of Agriculture, Andalas University, using a Randomized Complete Block Design with three replications. Results showed the variation in grain size and shape and 100-grain weight among 29 West Sumateran local upland rice cultivars. The upland rice was classified into extra-long and long grain size, slender and medium grain shape, and light and heavy 100-grain weight. Two cultivars possess low amylose content, 17 cultivars with moderate amylose content, and ten cultivars with high amylose content, indicating high amylopectin content dominated most West Sumateran local upland rice cultivars revealed creamy and sticky texture of rice after cooking. The Phenotypic Coefficient Variance (PCV) was higher than the Genotypic Coefficient Variance (GCV) for all characters, indicating the environmental influences on the expression of these characters. High heritability estimates were detected for all characters, indicating selection might be successful for grain size, shape, and 100-grain weight characters. Among 29 West Sumateran local upland rice cultivars, Buyar that performed extra long grain size, medium grain shape, moderate amylose content (23,6%), was higher in 100-grain weight (3.18 g) than Jatiluhur as control variety. [ABSTRACT FROM AUTHOR]