Genetic diversity of PIT-1 gene in Jabres: The Indonesian beef cattle.

The PIT-1 gene regulates animal metabolism and body size, and its variation has been linked to livestock performance. This study aimed at the polymorphism of the PIT-1 gene and the genetic diversity based on its polymorphism (SNP) in the Indonesian beef cattle population. Sixty-five blood samples of Jabres (Indonesian local beef cattle) were used for molecular analysis. A 784 bp partial sequence of the PIT-1 gene was amplified using a pair of self-designed primers (F = 5'-CCCTGGTTCTTTCCTTTGGC – 3' and R=5' – ACAGGAAGGATAAGCAGAGGG – 3'). Based on the sequence's alignment, there were 5 SNPs found. One SNP (211A/G) is located in intron 2, two SNPs (314A/G and 331A/C) in exon 3, and the other two SNPs (507T/C and 754A/C) in intron 3. The higher genotype/allele frequencies of SNP 211A/G, 314A/G, 331A/C, 507T/C, and 754A/C were GG/G, GG/G, CC/C, TT/T, and AA/A, respectively. All SNPs fitted the Hardy-Weinberg equilibrium for genotype and allelic frequencies. A haplotype combination of SNP 211A/G and 754A/C indicated a high LD, so it could be recommended for further analysis. [ABSTRACT FROM AUTHOR]