Search

The effect of 20 colicins and cloacin was studied after various precultivations. Nutrient agar supplemented with subinhibitory concentration of EDTA used for precultivation or elevating the growth-temperature of the inoculum from 37 degrees C to 42 degrees C increased the susceptibility of wild-type (smooth) Escherichia coli strains to the inhibitory action of some colicins. There were great differences among the colicins in respect to these effects. In case of rough mutants, their sensitivities did not change or eventually decrease after EDTA or heat pretreatment. The LPS pattern in SDS-PAGE of smooth cells grown in EDTA-containing nutrient medium changed in some degree towards the rough character. In case of precultivation at 42 degrees C this change was less considerable. It is supposed that both factors applied during precultivation have influence on colicin sensitivity by means of the change of receptor activity caused by LPS modification.

Valvano, M.A., 1992. Diphenylamine increases cloacin DF13 sensitivity in avian septicemic strains of Escherichia coli. Vet. Microbiol., 32:149-161. Thirteen avian septicemic isolates of Escherichia coli were examined for the presence of the aerobactin iron transport system. All of the strains possessed a functional aerobactin system and hybridization experiments showed that the aerobactin genes were located on ColV-type plasmids in all cases. The expression of the aerobactin receptor IutA was also studied by determining the bacterial susceptibility to the bacteriocin cloacin DFI 3. Twelve of the 13 isolates were cloacin-resistant but became sensitive to this bacteriocin upon treatment with diphenylamine which caused a reduction in the amount of O-side chain lipopolysaccharide.

We have cloned chromosomal genes mediating the aerobactin iron transport system from the enteroinvasive strain Escherichia coli 978-77. The physical map of the region spanning the siderophore biosynthesis genes and the upstream portion of the receptor gene in strain 978-77-derived clones was identical to the corresponding regions in pColV-K30, while the downstream portion was different. Recombinant plasmids derived from strain 978-77 encoded a 76-kDa outer membrane protein, in contrast to the 74-kDa polypeptide encoded by similar clones derived from pColV-K30. No differences were found in the uptake of ferric aerobactin mediated by either the 76-kDa- or the 74-kDa-encoding plasmids. In contrast, cells containing the 76-kDa-encoding plasmids showed a 16-fold decrease in susceptibility to cloacin compared with cells harboring the 74-kDa-encoding plasmids. Two classes of chimeric aerobactin receptor genes were constructed by exchanging sequences corresponding to the downstream portion from the aerobactin receptor gene of both systems. The pColV-K30-978-77 chimeric gene encoded a 76-kDa outer membrane protein which mediated a low level of cloacin susceptibility, whereas the 978-77-pColV-K30 type encoded a protein of 74 kDa determining a level of cloacin susceptibility identical to that mediated by pColV-K30.

The mechanism by which E colicins recognize and then bind to BtuB receptors in the outer membrane of Escherichia coli cells is a poorly understood first step in the process that results in cell killing. Using N- and C-terminal deletions of the N-terminal 448 residues of colicin E9, we demonstrated that the smallest polypeptide encoded by one of these constructs that retained receptor-binding activity consisted of residues 343-418. The results of the in vivo receptor-binding assay were supported by an alternative competition assay that we developed using a fusion protein consisting of residues 1-497 of colicin E9 fused to the green fluorescent protein as a fluorescent probe of binding to BtuB in E. coli cells. Using this improved assay, we demonstrated competitive inhibition of the binding of the fluorescent fusion protein by the minimal receptor-binding domain of colicin E9 and by vitamin B12. Mutations located in the minimum R domain that abolished or reduced the biological activity of colicin E9 similarly affected the competitive binding of the mutant colicin protein to BtuB. The sequence of the 76-residue R domain in colicin E9 is identical to that found in colicin E3, an RNase type E colicin. Comparative sequence analysis of colicin E3 and cloacin DF13, which is also an RNase-type colicin but uses the IutA receptor to bind to E. coli cells, revealed significant sequence homology throughout the two proteins, with the exception of a region of 92 residues that included the minimum R domain. We constructed two chimeras between cloacin DF13 and colicin E9 in which (i) the DNase domain of colicin E9 was fused onto the T+R domains of cloacin DF13; and (ii) the R domain and DNase domain of colicin E9 were fused onto the T domain of cloacin DF13. The killing activities of these two chimeric colicins against indicator strains expressing BtuB or IutA receptors support the conclusion that the 76 residues of colicin E9 confer receptor specificity. The minimum receptor-binding domain polypeptide inhibited the growth of the vitamin B12-dependent E. coli 113/3 mutant cells, demonstrating that vitamin B12 and colicin E9 binding is mutually exclusive.

The pCloDF13 encoded bacteriocin release protein (BRP) plays a role in the release of the bacteriocin cloacin DF13. The BRP signal peptide is stable after cleavage, and accumulates in the cytoplasmic membrane. A BRP which is correctly targeted by the unstable murecin lipoprotein signal peptide (Lpp-BRP) is not capable of inducing the release of cloacin DF13. To investigate the role of the stable BRP signal peptide in the release of cloacin DF13, the stable BRP signal peptide and the Lpp-BRP were expressed in trans in cells also producing cloacin DF13. Expression and release experiments indicate that the stable signal peptide can complement the Lpp-BRP in the release of cloacin DF 13.

Three methods, O-serotyping, phage typing and susceptibility to bacteriocins, were used to type 357 clinical isolates of Enterobacter cloacae cultured from 219 patients. One hundred and sixty isolates were typed by serology and phage typing. When these two methods were used, primary classification of isolates was based on serology (65.7% typable) and phage typing for further subdivision (94.1% typable). When all the isolates were typed by cloacin susceptibility, 81.5% of them were typable. Maximum discrimination between cultures was achieved when the three methods were used together; no single method was sufficiently discriminatory. There was a close parallel between serotyping and bacteriocin lysis pattern. The latter was easy to perform and the results were achieved within 48 h. By applying this typing system two episodes of cross-infection were identified in a haematology/oncology unit and intensive care unit.

We investigated the role of the tolQ gene in the import of cloacin DF13 across the outer membrane of Escherichia coli strains expressing the IutA receptor. The IutA outer-membrane protein is the receptor for the siderophore ferric aerobactin and also binds cloacin DF13, a bacteriocin produced by strains of Enterobacter aerogenes. In this report we present evidence that tolQ is required for the internalization of cloacin DF13 upon binding to IutA but it is not involved in the transport of ferric aerobactin.

A total of 230 Salmonella strains were screened for enterobactin and aerobactin production, sensitivity to bacteriocins and resistance to antibiotics. All the isolates produced the phenolate siderophore enterobactin. Amongst these, 74 strains, most belonging to S. enteritidis, were sensitive to colicin B. Only 26 isolates, all belonging to S. wien, produced an additional iron chelator, i.e. the siderophore aerobactin, and 22 out of these were sensitive to cloacin DF13. Analysis of iron repressible outer membrane proteins and plasmid profiles in S. wien strains showed that the expression of a 74-kDa iron-repressible outer membrane protein and the presence of large plasmids were associated with multiple antibiotic resistance, aerobactin production and sensitivity to cloacin DF13. The incidence of aerobactin-producing strains among S. wien isolates was higher during years 1974-1985; the epidemiological implications of these results are discussed.

Of 182 wild-type human, aerobactin producer Escherichia coli strains 86.3% were insensitive to cloacin. All randomly chosen 51 strains were relatively cloacin tolerant. Cloacin tolerant strains were not considerably more sensitive to hydrophobic drugs than the cloacin sensitive descendant strains. Pathogenicity of the cloacin sensitive strains was significantly lower (p less than 0.05) in intraperitoneal mice infection than that of the cloacin tolerant ones. Suggesting a new aspect of the uptake mechanism of colicins, cloacin tolerance was very frequently associated with an aspecific insensitivity to a broad spectrum of colicins.

Monoclonal antibodies (MAb) directed against different epitopes on the equimolar complex of cloacin and immunity protein (cloacin DF13) were isolated, characterized, and used to study the uptake of cloacin DF13 by susceptible cells. Four MAbs recognized the amino-terminal part, one MAb recognized the central part, and three MAbs recognized the carboxyl-terminal part of the cloacin molecule. Three MAbs reacted with the immunity protein. Five MAbs inhibited the lethal action of cloacin DF13, but none of the MAbs inhibited the binding of cloacin DF13 to its purified outer membrane receptor protein or the in vitro inactivation of ribosomes. Binding of cloacin DF13 to susceptible cells cultured in broth resulted in a specific, time-dependent dissociation of the complex and a fragmentation of the cloacin molecules. Increasing amounts of immunity protein were detected in the culture medium from about 20 min after the addition of cloacin DF13. Cloacin was fragmented into two carboxyl-terminal fragments with relative molecular masses of 50,000 and 10,000. The larger fragment was detected 5 min after the binding of the bacteriocin complex to the cells. The smaller fragment was detected after 10 min. Both fragments were associated with the cells and could not be detected in the culture supernatant fraction. Cells grown in brain heart infusion were much less susceptible to cloacin DF13 than cells grown in broth, although they possessed a similar number of outer membrane receptor molecules. This decreased susceptibility correlated with a decreased translocation, dissociation, and fragmentation of cloacin DF13.

PERSPECTIVES AND SUMMARY . . . ... .. ....... . ... .. . .. ....... . . . ....... . . .... .. .. . 195 DIPHTHERIA TOXIN . . ... . ... ... . . . . . . . . . . . .. . ..... . . . . .. ... .. . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .. ... 1 97 Overview. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . 197 Mol ecula r Geneti cs ... . . . .. . . . . ... .. . . . . . .. . . . . . ... . . . ...... . . .. .. . . . . . . .. .. . . .... 197 Structure. . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . 198 En zy mat ic Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... . . . . . .. . . . . . . . . .. . . . . . . . . .... . . . . . ... . 201 Binding and Uptake 202 Kinetics of Intoxication . . . . . . . . . . . . . . . . . . . . . . .. . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . 206 Ricin. Modeccin. and Pseudomonas Exotoxin A. The R at e-Li miting St ep.. . . . . . . . . . . . . 2 1 0 Dose-Dependent Lag Period 21 1 Modeling th e Kin eti c Data . . . . . . . ..... . . . ..... .. . ... .. . . . ..... . . . . ...... . . . ... ... . . . . .. . . .. . . ... 2 1 2 An E nergy R equir ement/or T oxin Tr ans membr an e Transport 213 COLICINS AND CLOACINS .. .. . ...... .. ..... ..... . .. . .. . .. . . . . . . ... .. . . .. .... . . . .. ..... . . . . . .. . . 2 13 Utili zatio n of Ba ct erial R ecepto rMe diat ed Tra nspo rt Sy st ems . . . . . .. .. ... . . . ... . .. . . . . . . 2 13 Binding 214 Str ucture . . ..... . . .. . . . . . . . .. . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . .. . . . . . . . ... . . . . . . . .. . . . . . . . . . . . . . . . . 2 15 Si ngl e-H it Ina cti vati on Ki neti cs .. .. . .. ..... . ........ . .. .... . ...... ..... . . . . . . . . . . 2 1 6 Dos eDep end ent La g P eriod . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . 2 19 Parallels with Bacteriophage DNA Transport.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 1 9 GENERAL MODELS OF TOXIN TRANSMEMBRANE TRANSPORT. FUTURE PERSPECTIVES .. . ... . . . . . . . . . . .. . . . . . .... . .. . .... . . . .. ... .. . " . . . . . . . . . . . . . . . . . . . . . . . . . 220

The in vitro neutralization of the killing activity of cloacin DF13 by incubation with its purified receptor protein was shown to be the result of the formation of a direct and specific equimolar complex of both proteins. The binding of cloacin DF13 to its receptor protein did not result in a fragmentation of the cloacin molecules nor in the expulsion of immunity protein from the bacteriocin. The rate of the cloacin DF13-receptor interaction in vitro was found to be enhanced significantly in the presence of peptidoglycan, but lysozyme-treated peptidoglycan did not affect this interaction. Incubation of the cloacin DF13 as well as its receptor protein with peptidoglycan showed that the receptor protein but not the cloacin DF13 was able to bind to the peptidoglycan.

The 49 nucleotides fragment derived from the 3' end of 16S rRNA by cloacin DF13, is not cleaved by ribonuclease T1 at a guanosine residue tha is present at 27 nucleotides from the 3' terminus (position 115 in 16S rRNA). Analysis of the isolated nucleotide indicates that it is a modified G residue. In vivo labeling with (3H)methionine shows that this G is methylated and co-chromatography with markers reveals that it is N2-methylguanosine.

By oligonucleotide-directed mutagenesis, stop codon mutations were introduced at various sites in the pCloDF13-derived bacteriocin release protein (BRP) structural gene. The expression, lipid modification (incorporation of [3H]palmitate), and processing (in the presence and absence of globomycin) of the various carboxyl-terminal shortened BRPs were analyzed by a special electrophoresis system and immunoblotting with an antiserum raised against a synthetic BRP peptide, and their functioning with respect to release of cloacin DF13, lethality, and apparent host cell lysis were studied in Sup-, supF, and supP strains of Escherichia coli. All mutant BRPs were stably expressed, lipid modified, and processed by signal peptidase II, albeit with different efficiencies. The BRP signal peptide appeared to be extremely stable and accumulated in induced cells. Full induction of the mutant BRPs, including the shortest containing only 4 amino acid residues of the mature polypeptide, resulted in phospholipase A-dependent and Mg2+-suppressible apparent cell lysis. The extent of this lysis varied with the mutant BRP used. Induction of all mutant BRPs also prevented colony formation, which appeared to be phospholipase A independent. One shortened BRP, containing 20 amino acid residues of the mature polypeptide, was still able to bring about the release of cloacin DF13. The results indicated that the 8-amino-acid carboxyl-terminal segment of the BRP contains a strong antigenic determinant and that a small segment between amino acid residues 17 and 21, located in the carboxyl-terminal half of the BRP, is important for release of cloacin DF13. Either the stable signal peptide or the acylated amino-terminal BRP fragments (or both) are involved in host cell lysis and lethality.

Iron-starved cultures of Enterobacter cloacae produced two siderophores, identified as enterochelin and aerobactin. The aerobactin was excreted in larger amounts than was enterochelin, and it was synthesized preferentially in the late logarithmic and stationary growth phases under iron-deficient conditions. Enterochelin was synthesized by cultures in the logarithmic phase of growth and preferentially in medium with 1 microM ferric chloride. Both siderophores appeared to be excreted immediately after their synthesis, since no intracellular aerobactin or enterochelin could be detected. The killing activity of the bacteriocin cloacin DF13 was inhibited by aerobactin. It was shown that aerobactin and cloacin DF13 bound to the same receptor sites located in the outer membrane. The synthesis of these receptor sites was induced by iron limitation. We conclude that the receptor for the uptake of aerobactin also functions as receptor for cloacin DF13.

Both Enterobacter cloacae H478 and Klebsiella edwardsii S15 were shown to harbour a relatively large conjugative plasmid that coded for cloacin DF13-susceptibility and the production and uptake of a hydroxamate iron chelator, most probably aerobactin. Protein-blotting experiments with antiserum raised against the purified cloacin DF13/aerobactin receptor protein from Escherichia coli (Co1V-K30) revealed that the corresponding outer membrane receptor proteins of Ent. cloacae H478 and K. edwardsii S15 had apparent mol wts of 85 000 and 76 000, respectively. E. coli transconjugants harbouring either the plasmid from Ent. cloacae H478 or K. edwardsii S15 expressed a cloacin DF13/aerobactin outer membrane receptor protein with a mol wt of 74 000. The receptor protein encoded by the Ent. cloacae and K. edwardsii plasmids were immunologically more related to each other than to the pCo1V-K30-encoded receptor protein.

A DNA fragment derived from the ColV-K30 plasmid and coding for both sensitivity to cloacin DF13 and Fe3+-aerobactin uptake was cloned into pBR322. The cloned fragment coded for two polypeptides with molecular masses of 74,000 (the cloacin DF13/aerobactin receptor protein) and 50,000 daltons, respectively. When grown with sufficient iron, cells harboring pFS8 (with this fragment) possessed about 10 times as many receptor protein molecules as compared with cells of Escherichia coli (ColV-K30). The synthesis of the receptor protein specified by pFS8, however, was independent of the availability of iron, in contrast to strains harboring the intact ColV-K30 plasmid. Aerobactin was taken up but not synthesized by cells harboring pFS8. No growth occurred when iron-starved cultures of these cells were incubated with Fe3+-aerobactin, suggesting that expression of other ColV-K30-encoded genes is necessary to remove the iron from the Fe3+-aerobactin complex.

The RNA helix destabilizing properties of Escherichia coli initiation factor 3 protein (IF3), and its affinity for an evolutionarily conserved sequence at the 3' end of 16S rRNA, led us to examine the details of the protein-nucleic acid interactions upon IF3 binding to the 49-nucleotide 3'-terminal cloacin DF13 fragment of 16S rRNA by studying the circular dichroism (CD) and proton magnetic resonance spectra of the RNA, the protein, and their complex. In a physiological tris(hydroxymethyl)aminomethane buffer, where the interaction is primarily nonionic and sequence specific, addition of IF3 decreases the RNA 268-nm CD peak hyperbolically by 19% to an end point of about one IF3 per RNA strand. The titration curve is best fit by an association constant of (1.80 +/- 0.05) X 10(7) M-1, within the range estimated by a nuclease mapping study of the same system [Wickstrom, E. (1983) Nucleic Acids Res. 11, 2035-2052]. In a low-salt phosphate buffer without Mg2+, where the interaction is primarily ionic and nonspecific, titration with IF3 decreases the peak CD sigmoidally by 35% to an end point of two IF3 per strand. The titration curve is best fit by an intrinsic association constant of (1.7 +/- 0.7) X 10(6) M-1 for each IF3 and a cooperativity constant of 33 +/- 6. In a physiological phosphate buffer lacking Mg2+, the dispersion of aromatic proton magnetic resonance peaks and upfield-shifted methyl proton resonances indicates a high degree of secondary and tertiary structure in the protein. In an equimolar mixture of IF3 and RNA cloacin fragment, several changes in identifiable IF3 and RNA resonances are observed.(ABSTRACT TRUNCATED AT 250 WORDS)

The pCloDF13 encoded immunity protein gene was subcloned in the expression vector pINIIIA1 and several deletion, insertion and point mutations were constructed in the amino-terminal and carboxyl-terminal regions of the protein. The expression, stability, BRP-dependent export and protective capacity of the native and mutant immunity proteins were studied by SDS-PAGE, immunoblotting and an in vivo activity assay. In the absence of cloacin the unbound, native immunity protein was stable produced by E. coli cells and released after BRP induction. The expression of most of the mutant immunity proteins was strongly reduced and non of the proteins were found to be released. All mutations in the carboxyl-terminal region strongly affected expression of the proteins, probably by causing protein instability and proteolytic degradation. One of these mutant immunity proteins, with an insertion mutation in its carboxyl-terminal region, still caused an intermediate immunity of susceptible cells against extracellularly added cloacin DF13. Mutations in the amino-terminal region of the immunity protein had less effect on its expression and did not affect the protective capacity of the protein.

Escherichia coli minicells harboring plasmid CloDF13 synthesized at least 25 messenger ribonucleic acid (RNA) species; three of these RNAs, a 2,400-, a 2,200-, and a 100-nucleotide RNA, were synthesized in relatively large amounts. Using insertion and deletion mutants of CloDF13 as well as an RNA blotting technique, we could demonstrate that these three RNAs are transcripts from the CloDF13 DNA region from 0 to 40%. This region contains the cloacin and immunity genes and the genetic information involved in plasmid DNA replication. A transcription map of this region is presented and discussed. The data indicate that the cloacin and immunity genes were coordinately transcribed into messenger RNAs of about 2,400 and 2,200 nucleotides, which differ in length at their 3' terminus. RNA polymerase binding studies and in vitro transcription assays indicated that transcription of these genes initiates at a promoter located around 32% on the CloDF13 map. Furthermore, it is shown that a 100-nucleotide RNA is encoded by the CloDF13 DNA region between 7.7 and 8.8% on the plasmid genome; the synthesis of this RNA proceeds in a direction opposite to the transcription of the cloacin and immunity genes.

The CloDF13 cop-1(Ts) mutant expresses a temperature-dependent plasmid copy number. At 42 degrees C the mutant shows a "runaway" behavior, and cells harboring this plasmid are killed. The cop-1(Ts) mutation is a G-to-A transition that disturbs one of the two methylation sites which are located opposite in the stem-loop structure within a region involved in both the initiation of primer synthesis for DNA replication and the termination of the cloacin operon transcript. We demonstrate that the mutation results in an increased primer (RNA II) synthesis resulting from nonconditional enhanced RNA II promoter activity, which at 42 degrees C causes a decrease in the amount of active replication repressor molecules (RNA I) synthesized from the opposite strand. We found that the absence of Dam methylation abolishes the mutant phenotype and that under this condition the high mutant level of RNA II synthesis is reduced, which is accompanied by a restoration of the regulation by RNA I. The role of methylation in the regulation of plasmid replication is discussed.

One of the chromosomal segments associated with virulence in Shigella flexneri encodes the production of aerobactin and the synthesis of an iron-regulated 76-kilodalton outer membrane protein believed to be the ferric-aerobactin receptor. However, S. flexneri expressing this putative aerobactin receptor, which is slightly larger than that encoded by pColV, is insensitive to the killing action of cloacin DF13, a bacteriocin which binds to other aerobactin receptor proteins and kills the cells. In this paper we show that the conjugal transfer of DNA encoding the iron-regulated 76-kilodalton protein from S. flexneri to Escherichia coli K-12 conferred cloacin DF13 sensitivity on the recipients. However, E. coli K-12 which had also inherited genes specifying Shigella O-antigen biosynthesis remained cloacin insensitive. The data suggest that it is unwise to use cloacin DF13 sensitivity alone to screen transconjugants or clinical isolates for the expression of aerobactin receptor proteins.

Bacterial, cytoplasmic and organellar ribosomes from a wide phylogenetic spectrum of organisms have a characteristic m6(2)Am6(2)A structure near the 3' end of the RNA of the small ribosomal subunit (SSU). We have studied one of the few exceptions to this extremely conserved post-transcriptionally modified sequence, i.e. dimethylation of only one of the two A's in chloroplasts from Euglena gracilis. It was established that only the A closest to the 5' end is dimethylated, the other one being unmodified. The methylation reaction was studied in vitro using ribosomes from a kasugamycin resistant mutant (ksgA) of Escherichia coli and purified methyl-transferase. Using limited amounts of the methyl donor S-adenosylmethionine (SAM) a partial level of methylation (50% of control) was attained. It is shown that in this case the 3' proximal A is dimethylated while the other is not. This suggests that dimethylation takes place in two successive stages. Apparently in E. gracilis chloroplasts the first stage of methylation does not occur.

The effect of the presence or absence of the methylgroups of the m2(6)Am2(6)A sequence near the 3' end of 16S rRNA of Escherichia coli on the interaction of the ribosomal subunits has been studied, using wild-type (methylated) and mutant (unmethylated) ribosomes. Subunit exchange experiments and competitive association experiments show a strong preference of the 50S subunit for association with methylated 30S subunits. The results indicate that the equilibrium constant of the reaction 70S in equilibrium with 30S + 50S is dependent on the methylgroups; mutant 30S.50S couples are less stable than wild-type 30S.50S couples. It is postulated that the methylgroups also stimulate the interaction between 30S subunits and initiation factor IF-3.

Virulent and nonvirulent isolates of avian Escherichia coli were tested for the presence of aerobactin genes by colony hybridization with a specific gene probe constructed from plasmid pABN1 (A. Bindereif and J. B. Neilands, J. Bacteriol. 153:1111-1113, 1983). Positive hybridization with the gene probe was highly correlated with virulence, as measured by the 50% lethal dose of the strains for chicks. Evidence for the expression of aerobactin genes in the virulent strains was obtained by demonstrating their susceptibility to cloacin DF13, which binds to the same receptor that binds aerobactin, and their ability to produce aerobactin, as revealed by cross-feeding the E. coli mutant WO987 (aroB fepA iuc iut+), which is unable to synthesize but capable of taking up aerobactin. We suggest that the production of aerobactin is involved in the virulence of avian septicemic E. coli.

Colicins are released into the spent medium from colicinogenic cells. The pathway of release has been investigated in this study. The localization in producing cells of colicins A, E3 and of cloacin DF13 has been determined at various times after mitomycin C addition: no transient accumulation in the periplasmic space of colicinogenic E. coli K12 strains was detected by electron microscopy for any of the bacteriocins tested. Furthermore, asynchronous induction in individual cells was detected for each bacteriocin tested. These results strongly suggest that colicins, as well as cloacin DF13, do not transit through the periplasmic space before release from colicinogenic cells.

Escherichia coli translational initiation factor 3 (IF3) may be crosslinked to the 3' end of 16S RNA in 30S ribosomal subunits. In order to determine the sequence to which IF3 may bind in vivo, samples of 5'-32P labelled 3' terminal 49-nucleotide fragment of 16S RNA were incubated 5 min. at 37 degrees in 40 mM Tris-HOAc, pH 7.4, 100 mM NaCl, 1 mM Mg (OAc)2, 1 mM ZnSO4, with or without IF3, then reacted a further 5 min with nuclease S1, RNase T1, or RNase A. Base pairing between the 5' and 3' legs of the fragment occurs in the absence of IF3, but is disrupted by IF3 binding. IF3 appears to protect some residues near the 5' end of the fragment (U1495, A1499, A1500, A1502, and A1503) from nuclease S1, and potentiates S1 attack on others (G1494, G1497, C1501, G1504, G1505, U1506, G1517, G1529, G1530, and C1533). A series of equimolar reactions at increasing dilution imply an association constant range of 1.4-7.0 X 10(7) M-1.

Several overlapping carboxy-terminal and internal deletions were constructed in the cloacin structural gene. The expression, the binding of the cloacin DF13 immunity protein and the release into the culture medium of the mutant cloacin polypeptides were studied by immunoblotting and ELISAs. Minor alterations at the carboxy-terminal end of the cloacin did not affect protein expression, stability or release to a large extent, but larger carboxy-terminal deletions strongly destabilized the protein and no release was observed. The removal of a particular region within the carboxy-terminal portion of cloacin strongly destabilized the polypeptide and made it a target for proteolytic degradation. Binding of immunity protein did not affect stability and release of the mutant polypeptides. By using immunoelectron microscopy, the polypeptides that were not exported were located in the cytoplasm of producing cells. Large aggregates of these mutant polypeptides were not observed in the cytoplasm: the polypeptides were present in a soluble form.

In gram-negative bacteria only few proteins are exported across both the cytoplasmic membrane and the outer membrane which forms an extra barrier for protein excretion. In this review we describe the mechanisms of production and export of two types of plasmid-encoded proteins in Escherichia coli. These proteins are the bacteriocin cloacin DF13 and the K88ab and K99 fimbrial subunits. Specific so-called helper proteins located at different positions in the cell envelope play an essential role in the export of these proteins. The genetic organization, subcellular location and functions of these helper proteins, as well as the effects of mutations and culture conditions on the export of the proteins are described. Models for the export mechanisms are presented and future application possibilities for engineering foreign protein excretion in E. coli with these export systems are discussed.

The production and the mechanism of excretion of cloacin DF13 were investigated in noninduced and mitomycin C-induced cell cultures. A mitomycin C concentration was selected which did not cause lysis of cloacinogenic cells, but at the same time induced a maximal production of cloacin DF13. Native cloacin DF13, possessing killing activity, was first released into the cytoplasm. Shortly thereafter, the bacteriocin was transported through the cytoplasmic membrane and accumulated in the periplasm. Finally, cloacin DF13 was excreted into the culture medium. A small amount of cloacin DF13 remained associated with the cell surface. Producing cells did not become permeable for the cytoplasmic enzyme beta-galactosidase. Apparently the cloacin DF13 leaves the producing cells by an excretion process which is not similar to the mechanism proposed for bacterial secretory proteins. The processes of excretion by producing cells and of uptake by susceptible cells were also not identical because mutant cloacin DF13, which was not transported through the outer membrane into susceptible cells, was excreted like the wild-type cloacin DF13. The composition of the culture medium greatly affected production of cloacin DF13. The presence of sugars known to cause catabolite repression not only inhibited the production but also strongly reduced the excretion of cloacin DF13 into the culture medium.

Mitomycin C treatment of Escherichia coli K-12 cells containing the nonconjugative plasmid CloDF13 resulted in inhibition of host chromosome protein synthesis and a high rate of synthesis of two CloDF13-specified proteins whose molecular weights correspond to cloacin and immunity protein. Five molecules of immunity protein were synthesized for each cloacin DF13 molecule. Mitomycin C-treated cells containing a copy mutant of CloDF13 made three to four times as much of each protein as cells containing wild-type CloDF13. CloDF13 plasmids that contained the transposon Tn1 were isolated. Two did not induce after mitomycin C treatment, failing both to inhibit host cell synthesis and to produce the two new proteins. In minicells, they showed reduced CloDF13-specified protein synthesis and produced three Tn1-specified proteins.

The electrophoretic mobility of RNA fragments derived from the 3'-end of 16S rRNA on slabs of polyacrylamide gel in the presence of urea is strongly influenced by dimethylation of the N6-aminogroup of two adjacent adenosines. This is not due to the presence of the methylgroups per se, but must be ascribed to an effect of methylation on long range intramolecular interactions at these denaturing conditions. When it is assumed that the electrophoretic mobilities of the RNA fragments in the polyacrylamide matrix are determined by the conformational state(s) of the fragments, dimethylation of the adenosines leads in the smaller fragments to a less compact average conformation and in the larger fragments to a more compact average conformation. An effort is made to comprehend the effects of adenosine dimethylation in terms of secondary structure based on nucleotide sequence.

The synthesis of the bacteriocin cloacin DF13 and its release into the culture medium were genetically uncoupled by subcloning the gene encoding the bacteriocin release protein (BRP) from pCloDF13. The gene was cloned under the control of the IPTG-inducible lpp-lac promoter-operator system on the expression vector pINIIIA1, giving pJL1. A 4 kb DNA fragment of pJL1, containing the tandem lpp-lac promoter, the BRP gene and lacI (BRP cassette), was cloned into the pCloDF13 derivative plasmid pJN67, which encodes cloacin DF13 but not the release protein. Furthermore, the pCloDF13 immunity protein gene was subcloned downstream of the temperature-inducible P L promoter of the expression vector pPLc236, together with the BRP cassette. Growth, induction and excretion experiments with Escherichia coli cells harbouring the constructed plasmids revealed that: i) the BRP is the only pCloDF13-derived gene product responsible for the observed growth inhibition and apparent lysis of strongly induced cells. This growth inhibition and lysis can be prevented by Mg2+ ions added to the culture medium, and involves induction of phospholipase A activity. (ii) The expression of the BRP gene can be regulated by varying the IPTG concentration. (iii) A separately controlled and moderate induced BRP synthesis can be used to bring about the release of large amounts of cloacin DF13 under conditions that allow a strong induction of the bacteriocin and which do not result in lysis of cells. (iiii) Preliminary results indicated that the BRP can stimulate the release of immunity protein in the absence of cloacin or cloacin fragments.

INTRODUCTION 125 COLICIN E2 AND E3 AND CLOACIN DF!3 !26 Mode of Action 126 General Structure 127 Immunity System 127 Functional and Structural Domains 128 COLICINS A, E! la, Ib, and K 129 Mode of Action 129 Structural Features 131 Immunity System 132 COLICIN L 1 33 COLICIN IV,[ 133 TO THE TARGET 134 Role of Receptors 134 Possible Role 0/ Proteases 134 Colicin Uptake 1 35 PESTICIN A 1 122 ....... . . . . . . . . 136 STAPHYLOCOCCIN 1580 137 BUTYRICIN 7423 ... . . . . . ........ . . . . . . . . . . ...... . . . . . . .... 138 PYOCIN Rl 138 PYOCIN AI'41 139 MEGACIN A-216 140 CONCLUDING REMARKS 140

The bacteriocins colicin E2, colicin E3 and cloacin DF13 are bactericidal proteins which are excreted by producing cells as a complex of two polypeptides, present in equimolar amounts. The high-molecular weight component is responsible for the biochemical lesion induced by these bacteriocins. The low-molecular weight component, the so-called immunity protein, was shown to act as inhibitor of the high-molecular weight component. Colicin E2, freed from immunity protein, causes endonucleolytic degradation of DNA. Colicin E3 and cloacin DF13, freed from immunity protein, induce ribosome inactivation by endoribonucleolytic cleavage of 16S rRNA. A possible role of the immunity protein in the killing activity of the bacteriocins is not quite clear. Probably it keeps the high-molecular weight component in the right configuration for penetration of the cell wall layers. Studies on structure-function relationships have shown that cloacin DF13 has a domain-type structure. Various properties have been located in the hydrophilic C-terminal part of the molecule.

Aerobactin, a dihydroxamate siderophore produced by many strains of enteric bacteria, stimulated the growth of Neisseria gonorrhoeae FA19 and F62 in iron-limiting medium. However, gonococci did not produce detectable amounts of aerobactin in the Escherichia coli LG1522 aerobactin bioassay. We probed gonococcal genomic DNA with the cloned E. coli aerobactin biosynthesis (iucABCD), aerobactin receptor (iutA), and hydroxamate utilization (fhuCDB) genes. Hybridization was detected with fhuB sequences but not with the other genes under conditions which will detect 70% or greater homology. Similar results were obtained with 21 additional strains of gonococci by colony filter hybridization. A library of DNA from N. gonorrhoeae FA19 was constructed in the phasmid vector lambda SE4, and a clone was isolated that complemented the fhuB mutation in derivatives of E. coli BU736 and BN3307. These results suggest that fhuB is a conserved gene and may play a fundamental role in iron acquisition by N. gonorrhoeae.

The nucleotide sequence of the Clo DF13 DNA region comprising the immunity gene has been determined. We also elucidated the aminoacid sequence of the 40 N-terminal and 7 C-terminal aminoacids of the purified immunity protein. From analysis of the data obtained we were able to locate the immunity gene between 11.7 and 14.5% on the Clo DF13 map, and to determine the complete aminoacid sequence of the immunity protein. It was observed that the Clo DF13 immunity gene encodes an 85 aminoacid protein and is transcribed in the same direction as the cloacin gene. These experimental data support our model, presented elsewhere, which implicates that the cloacin and immunity genes of Clo DF13 are coordinately transcribed from the cloacin promoter. We also present DNA sequence data indicating that an extra ribosome binding site precedes the immunity gene on the polycistronic mRNA. This ribosome binding site might explain the fact that in cloacinogenic cells more immunity protein than cloacin is synthesized. The comparison of the complete aminoacid sequence of the Clo DF13 immunity protein, with the aminoacid sequence data of the purified, comparable Col E3 immunity protein revealed that both proteins have extensive homologies in primary and secondary structure, although they are exchangeable only to a low extent in vivo and in vitro. It was also observed that a lysine residue was modified in immunity protein isolated from excreted bacteriocin complexes.

A fast method for isolation of a 3′-terminal fragment of Streptomyces aureofaciens 16S RNA was developed. The procedure involves reaction of 70S ribosomes with cloacin DF13 and subsequent fractionation of the reaction mixture by polyacrylamide gel electrophoresis. The cloacin fragment was eluted from the gel and used directly for 3′-end labeling with cytidine-3′,5′-[5′-32P]bisphosphate. The labeled RNA fragment was sequenced by the enzymatic method. It consists of 50 nucleotides and has the sequence 5′-GUCGUAACAAGGUAACCGUACCGGAAGGUGCGGUUGGAUCACCUCCUUUCOH. The differences from the E. coli and Bacillus sequences and their possible influence on the rate and specificity of polypeptide synthesis are discussed.

The pCloDF13-encoded bacteriocin release protein (BRP; Mr 2,871) is essential for the translocation of cloacin DF13 across the cell envelope of producing Escherichia coli cells. Overproduction of this BRP provokes lysis (quasilysis) of cells. Construction and analysis of a hybrid BRP-beta-lactamase protein (BRP-Bla) demonstrated that the BRP contains a lipid modified cysteine residue at its amino terminus and is mainly located in the outer membrane. The significance of lipid modification for the localization and functioning of the BRP was investigated. Site-directed mutagenesis was used to substitute the cysteine residue for a glycine residue in the lipobox of the BRP and the BRP-Bla protein. The mutated BRP was unable to bring about the release of cloacin DF13 and could not provide the lysis (quasilysis) of host cells. However, the mutated BRP strongly inhibited the colony-forming ability of the cells, indicating that induction of the mutated protein still affected cell viability. In contrast to the wild-type BRP-Bla protein, the mutated BRP-Bla protein was mainly located in the cytoplasmic membrane, indicating that the mutation prevented the proper localization of the protein. The results indicated that lipid modification of the BRP is required for its localization and release of cloacin DF13, but not for its lethality to host cells.

Excretion of cloacin DF13 was studied in Escherichia coli cells harboring different CloDF13 insertion and deletion mutant plasmids. Insertions of a transposon at position 9.8 or 11.5% of the CloDF13 plasmid blocked the expression of gene H and strongly reduced the specific excretion of cloacin DF13 into the culture medium, but had no effect on the production of cloacin DF13. Insertions in or deletions of regions of the CloDF13 DNA upstream the cloacin operon did not affect the excretion or production of the bacteriocin. Introduction of a CloDF13 plasmid that encodes for the gene H product in cells harboring a CloDF13 plasmid with an insertion in gene H stimulated the excretion of cloacin DF13 significantly in mitomycin C-induced and in noninduced cultures. Cloacin DF13 in cloacinogenic cells that did not produce the gene H protein was found to be about 90% located in the cytoplasm. In cells that did produce the gene H product, about 30% of the cloacin DF13 molecules were found in the cytoplasm, about 18% were found in the periplasm, about 2% were in the membranes, and about 50% were located in the culture supernatant. Cyclic AMP stimulated the production but not the excretion of cloacin DF13 in cells cultivated in the presence of glucose.

The sequence and the position of post-transcriptionally modified residues of the 3' -terminal end of Bacillus stearothermophilus 16S ribosomal RNA have been determined from the fragment that is cleaved off by bacteriocin treatment. The fragment contains 52 nucleotides, as compared to the 49 nucleotides of the corresponding fragment from E. coli ribosomes, The additional nucleotides are present in the sequence UCU very next to the 3' -terminus as was published earlier (1). The remainder of the sequence is identical to the one of E. coli except at six positions, due to the UV melting properties of the colicin fragment from B. stearothermophilus in comparison to the same fragment of E. coli show that the RNA from the thermophile has a more stable secondary structure.