Search

BACKGROUND: Both portal vein embolization (PVE) and associating liver partition and portal vein ligation for staged hepatectomy (ALPPS) have merits and demerits when used in patients with unresectable liver cancers due to insufficient volumes in future liver remnant (FLR). METHODS: This study was a single-center, prospective randomized comparative study. Patients with the diagnosis of hepatitis B related hepatocellular carcinoma (HCC) were randomly assigned in a 1:1 ratio to the 2 groups. The primary endpoints were tumor resection and three-year overall survival (OS) rates. RESULTS: Between November 2014 to June 2016, 76 patients with unresectable HBV-related HCC due to inadequate volume of FLR were randomly assigned to ALPPS groups (n=38) and TACE + PVE groups (n=38). Thirty-seven patients (97.4%) in the ALPPS group compared with 25 patients (65.8%) in the TACE + PVE group were able to undergo staged hepatectomy (risk ratio 1.48, 95% CI: 1.17–1.87, P

An outbreak of the so-called Coronavirus disease 2019 (COVID-19), caused by the severe acute respiratory syndrome Coronavirus 2 (SARS-CoV-2), has been spreading rapidly nationwide in China since December 2019. Wuhan, Hubei Province, is the hardest-hit region, with a rise in confirmed cases and its hospitals overwhelmed. On 2nd February, 2020, Wuhan began to build a modular hospital to treat patients caught with mild illness. The mobile modular hospital is mainly composed of medical modules, technical support modules, ward units, living support units and transportation capacity under field conditions, and there are complete equipment and specialized personnel to treat patients. Due to the severity and particularity of SARS-CoV-2, taking granted from lessons learnt from mobile modular hospitals, we use the existing large venues to construct a new fixed modular hospital. As patients need to be treated and tested, it is important to develop a clinical laboratory in the modular hospital and ensure biosafety. The construction of a clinical laboratory in the modular hospital is faced with problems such as time pressure, limited site selection, high level of biosafety, lack of experience and so forth. This paper mainly discusses how to construct the clinical laboratory in the modular hospital quickly and safely and put it into use to provide testing service for patients under various limited conditions.

Laparoscopic Roux-en-Y gastric bypass and laparoscopic sleeve gastrectomy are the most common procedures performed in bariatric surgery and both have been demonstrated to have significant effectiveness in treating morbid obesity. However, comparative analysis of their effectiveness has not been well studied. This comparative analysis was conducted to determine whether Laparoscopic Roux-en-Y gastric bypass and laparoscopic sleeve gastrectomy have the same mid- and long-term outcomes in weight loss, resolution of obesity comorbidities and adverse events (AEs) of treatment.We searched the Cochrane Library, PubMed, Embase and Web of Science databases from the establishment of the database to January 1, 2020 for both randomized control trials and non-randomised interventional studies that studied Laparoscopic Roux-en-Y gastric bypass and laparoscopic sleeve gastrectomy with respect to weight loss outcomes, resolution of obesity comorbidities and AEs of treatment. Standardised mean differences, risk ratios and odds ratio with 95% confidence intervals were calculated to compare the outcomes of the groups. Two reviewers assessed the quality of the trials and extracted the data independently. All statistical analyses were performed using the standard statistical procedures in Review Manager 5.2.We included 20 studies (N = 2917 participants) in this meta-analysis. Our results showed no significant difference in excess weight loss between Laparoscopic Roux-en-Y gastric bypass and laparoscopic sleeve gastrectomy, with pooled Standardised mean differences of -0.16 (95% confidence interval: -0.52 to 0.19; P = 0.36) based on randomized control trials and 0.07 (95% confidence interval: -0.10 to 0.24; P = 0.41) based on non-randomised interventional studies. Further, the pooled results showed no significant differences in midterm and long-term weight loss outcomes between the comparative groups. Similarly, no significant difference was found in type 2 diabetes mellitus resolution. The pooled results indicated that patients receiving laparoscopic sleeve gastrectomy experienced fewer postoperative complication and reoperation rates, with pooled risk ratios of 1.66 (95% confidence interval: 1.33 to 2.07; P 0.00001) and 1.73 (95% confidence interval: 1.14 to 2.62; P = 0.01), respectively. Laparoscopic Roux-en-Y gastric bypass was superior to laparoscopic sleeve gastrectomy in managing dyslipidemia, hypertension and gastroesophageal reflux disease.The present meta-analysis indicated that both Laparoscopic Roux-en-Y gastric bypass and laparoscopic sleeve gastrectomy had the same effectiveness in resulting in excess weight loss and type 2 diabetes mellitus resolution. However, patients who received laparoscopic sleeve gastrectomy experienced fewer postoperative complication and reoperation rates than those who received Laparoscopic Roux-en-Y gastric bypass. Laparoscopic Roux-en-Y gastric bypass was superior in the management of dyslipidemia, hypertension and gastroesophageal reflux disease.

Runt‑related transcription factor 3 (RUNX3) is a candidate tumor suppressor, and its inactivation may play a crucial role in the carcinogenesis process of numerous cancer types, including esophageal squamous cell carcinoma (ESCC). We previously revealed that RUNX3 inactivation was correlated with lymph node metastasis (LNM) and ESCC recurrence. However, the exact mechanisms of this process are still under investigation. The aim of the present study was to examine the potential roles and underlying molecular mechanisms of RUNX3 in ESCC metastasis and the epithelial‑mesenchymal transition (EMT). According to the results, RUNX3 expression in ESCC tissue was significantly reduced compared with that in adjacent normal tissue (0.50±0.20 vs. 0.83±0.16; P

Background Gene therapy remains a significant challenge due to lots of barriers limiting the genetic manipulation technologies. As for non-viral delivery vectors, they often suffer insufficient performance due to inadequate cellular uptake and gene degradation in endosome or lysosome. The importance of overcoming these conserved intracellular barriers is increasing as the delivery of genetic cargo. Results A surface-functionalized non-viral vector involving the biomimetic mannitol moiety is initiated, which can control the cellular uptake and promote the caveolae-mediated pathway and intracellular trafficking, thus avoiding acidic and enzymatic lysosomal degradation of loaded gene internalized by clathrin-mediated pathway. Different degrees of mannitol moiety are anchored onto the surface of the nanoparticles to form bio-inspired non-viral vectors and CaP-MA-40 exhibits remarkably high stability, negligible toxicity, and significantly enhanced transgene expression both in vitro and in vivo. Conclusions This strategy highlights a paradigmatic approach to construct vectors that need precise intracellular delivery for innovative applications.

Microspheres and injectable hydrogels derived from natural biopolymers have been extensively investigated as drug carriers and cell scaffolds. In this study, we report a preparation of comp...

Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., In this study, we identified five novel mutations in the five families: HBA2:c.245C>T, HBA2:c.54delC, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for the isoelectric point, amino acid conservation, and pathogenicity of the missense mutation.

In the paper, two medical cases, i.e. carpal tunnel syndrome and acute chest soft tissue contusion, are treated and reported with acupuncture kinesitherapy, in which the needles are inserted shallowly and no sensation of deqi is required in the guidance of subcutaneous shallow puncture and “pain point as the acupoint”. The mechanism of needling wei method is summarized.

Background Cell invasion is a hallmark of metastatic cancer, leading to unfavorable clinical outcomes. In this study, we established two highly invasive lung cancer cell models (A549-i8 and H1299-i8) and identified mesoderm-specific transcript (MEST) as a novel invasive regulator of lung cancer. We aim to characterize its biological function and clinical significance in lung cancer metastasis. Methods Transwell invasion assay was performed to establish high-invasive lung cancer cell model. Immunohistochemistry (IHC) was used to detect MEST expression in tumor tissues. Mass spectrometry and bioinformatic analyses were used to identify MEST-regulated proteins and binding partners. Co-immunoprecipitation assay was performed to detect the interaction of MEST and VCP. The biological functions of MEST were investigated in vitro and in vivo. Immunofluorescence staining was conducted to explore the colocalization of MEST and VCP. Results MEST overexpression promoted metastasis of lung cancer cells in vivo and in vitro by activating NF-κB signaling. MEST increased the interaction between VCP and IκBα, which accelerated IκBα degradation and NF-κB activation. Such acceleration was abrogated by VCP silencing, indicating that MEST is an upstream activator of the VCP/IκBα/NF-κB signaling pathway. Furthermore, high expressions of MEST and VCP were associated with poor survival of lung cancer patients. Conclusion Collectively, these results demonstrate that MEST plays an important role in driving invasion and metastasis of lung cancer by interacting with VCP to coordinate the IκBα/NF-κB pathway. Targeting the MEST/VCP/IκBα/NF-κB signaling pathway may be a promising strategy to treat lung cancer.

X-linked sideroblastic anemia with ataxia (XLSA/A) is a rare X-liked inherited disease, which was linked to the ABCB7 gene mutations. So far, five families have been reported worldwide. We present the first Chinese family of XLSA/A with novel ABCB7 gene mutation (c.2024A > G) and make a retrospective literature review. All affected patients were male. Age of symptom onset was

Background:Acupuncture stimulation at GV26 during the acute phase of cerebral ischaemia can effectively reduce brain damage induced by ischaemic injury. However, the time course of the effects of acupuncture stimulation has not yet been thoroughly studied.Objective:To investigate the effects of manual acupuncture (MA) on glutamic acid (Glu) and γ-aminobutyric acid (GABA) expression in the cerebrospinal fluid of rats with middle cerebral artery occlusion (MCAO) and determine whether there is a temporal effect of acupuncture on the treatment of cerebral ischaemia.Methods:We performed thread occlusion of the right middle cerebral artery in rats to establish an animal model of MCAO. Simultaneously, during acupuncture treatment, microdialysis was used to continuously and dynamically observe immediate alterations in amino acid metabolism with acupuncture stimulation after cerebral ischaemia in vivo in this rat model of MCAO.Results:We found that, in comparison with an untreated MCAO group, Glu content was significantly decreased during the first acupuncture stimulation and during the course of the acupuncture treatment in the MCAO+MA group (MCAO vs MCAO+MA: day 1, P=0.032; day 2, P=0.021; day 3, P=0.017). These findings were also seen after the end of treatment when acupuncture was no longer applied (MCAO vs MCAO+MA: day 7, P=0.009). Measurements of GABA content following cerebral ischaemic injury showed that GABA peaks 24 hours after damage, falls thereafter and decreases to baseline levels on day 7. In the MCAO+MA group, GABA content on days 1 to day 2 was lower than in the MCAO group (MCAO+MA vs MCAO: day 1, P=0.003; day 2, P=0.001), although it was higher than in the control group (MCAO+MA vs control: day 1, P=0.024; day 2, P=0.009). GABA content on day 3 and day 7 was higher in the MCAO+MA group than in the MCAO group and the control group (MCAO+MA vs MCAO: day 3, P=0.008; day 7, P=0.013; MCAO+MA vs control: day 3, P=0.002; day 7, P=0.009).Conclusion:Acupuncture stimulation at GV26 can effectively decrease excessive release of Glu induced by ischaemia and maintain the endogenous inhibitory activity of GABA. This phenomenon was seen during the entire course of acupuncture treatment and continued for some time after the end of acupuncture treatment.

Polychlorinated biphenyls (PCBs) are a group of persistent organic pollutants (POPs) widely existing in the environment. Arthrobacter sp. YC-RL1 is a biphenyl-degrading bacterium that shows metabolic versatility towards aromatic compounds. A 2-hydroxy-6-oxo-6-phenylhexa-2, 4-dienoate (HOPDA) hydrolase (BphD) gene involved in the biodegradation of biphenyl was cloned from strain YC-RL1 and heterologously expressed in Escherichia coli BL21 (DE3). The recombinant BphDYC-RL1 was purified and characterized. BphDYC-RL1 showed the highest activity at 45 °C and pH 7. It was stable under a wide range of temperature (20–50 °C). The enzyme had a Km value of 0.14 mM, Kcat of 11.61 s−1, and Vmax of 0.027 U/mg. Temperature dependence catalysis exhibited a biphasic Arrhenius Plot with a transition at 20 °C. BphDYC-RL1 was inactivated by SDS, Tween 20, Tween 80, Trition X-100, DTT, CHAPS, NBS, PMSF, and DEPC, but insensitive to EDTA. Site-directed mutagenesis of the active-site residues revealed that the catalytic triad residues (Ser115, His275, and Asp247) of BphDYC-RL1 were necessary for its activity. The investigation of BphDYC-RL1 not only provides new potential enzyme resource for the biodegradation of biphenyl but also helps deepen our understanding on the catalytic process and mechanism.

Background This study was conducted to investigate the effect of P14 promoter aberrant methylation on the biological function of human lung adenocarcinoma cells. Methods We used nested methylation‐specific PCR (NMSP) to detect the methylation status of the p14ARF promoter region in SPCA1 and BEAS2B cell lines. The experimental groups were treated with 5‐aza‐2′‐deoxycytidine (5‐Aza). Quantitative real‐time PCR, Western blot, flow cytometry, and Cell Counting Kit 8 were used to detect the expression of p14ARF messenger RNA and protein in each group, apoptosis, and cell proliferation inhibition, respectively. Results NMSP detected that the p14 promoter region of SPCA1 cells has abnormal methylation status. After treatment with 5‐Aza, the expression of p14ARF messenger RNA and protein in SPCA1 cells (P 0.05). Conclusion Abnormal methylation of the p14ARF promoter region plays an important role in the development of lung cancer cells. Our results suggest the use of P14 promoter aberrant methylation as a therapeutic target for drug research or to improve the sensitivity of other drugs.

Osteogenesis imperfecta (OI) is a group of heritable fragile bone diseases, and the majority are caused by pathogenic variants in the COL1A1 and COL1A2 genes. We sought to identify the genetic causes and phenotypes of OI in Chinese patients without COL1A1 or COL1A2 mutations.Twenty-three patients who were diagnosed with sporadic OI but did not carry COL1A1/2 mutations were recruited, and their genomic DNA was analyzed using targeted next-generation sequencing of rare OI-related genes. The resulting damaging mutations in the probands and their parents were verified using Sanger sequencing. Moreover, the efficacy of long-term bisphosphonate treatment was evaluated in proband 1.Compound heterozygous variants in the WNT1 and TMEM38B genes were identified in proband 1 and proband 2, respectively. A heterozygous mutation in the P4HB gene was identified in proband 3, and a hemizygous mutation in PLS3 was identified in proband 4. The unaffected parents of the probands (except the father of proband 4) with mutations in the WNT1, TMEM38B, and PLS3 genes were heterozygous carriers of each of the variants, respectively. Notably, proband 3 had the characteristic exophthalmos, flat nasal bridge and flat, wide forehead. None of the patients presented with dentinogenesis imperfecta or hearing loss. Furthermore, bisphosphonates exerted beneficial effects on proband 1, who carried the WNT1 mutations, by increasing bone mineral density Z-score, reshaping the compressed vertebrae and decreasing the fracture risk.We identified novel mutations and expanded the spectrum of phenotypes and genotypes of the extremely rare disorder OI.BMD = bone mineral density; MIM = Mendelian Inheritance in Man; OI = osteogenesis imperfecta; PDI = protein disulfide isomerase.

Introduction Congenital insensitivity to pain with anhidrosis (CIPA) is a rare autosomal recessive disorder resulting from NTRK1 mutation. Over 105 NTRK1 mutations have been reported in CIPA patients worldwide. The causative NTRK1 mutations lead to loss of function of the TrkA protein, an important ligand for nerve growth factor (NGF), and therefore induce various clinical phenotypes associated with neuron maturation defects. Materials and methods Three patients from unrelated families with CIPA were subjected to detailed clinical examinations. Blood samples were collected from all the patients and their available family members, as well as 200 healthy volunteers. Sanger sequencing for all the exons and splicing sites of NTRK1 was performed on all samples. The phenotype-genotype relationship and genetic epidemiology of Chinese CIPA patients were also analysed. Results A total of four different NTRK1 mutations [c.851-33T>A, c.44G>A (p.Trp15*), c.287+2dupT, c.1549G>C (p.Gly517Arg)] were identified in these families, and c.1549G>C (p.Gly517Arg) was a novel mutation that had not been reported previously. The ‘mild’ manifestations observed in patients with c.851-33T>A indicated this mutation as a ‘mild’ mutation. After reviewing studies reporting mutations in Chinese CIPA patients, we speculate the mutation c.851-33T>A is one of the founder mutations in the Chinese population. Conclusions Our research expanded the spectrum of the NTRK1 mutations associated with CIPA patients, provided additional clues relating to the phenotype-genotype relationship in CIPA, and summarized the features of the genetic epidemiology of CIPA in the Chinese ethnic group.

BackgroundThe effects of up-regulated CircCHST15 on lung cancer remained unclear. In this study, the role of CircCHST15 in lung cancer was investigated.MethodsDual-luciferase reporter verified the bioinformatics prediction that CircCHST15 targeted miR-155-5p and miR-194-5p. The correlation between CircCHST15 and PD-L1 was analyzed by Pearson analysis. CCK-8 and colony formation was performed to determine the viability and proliferation of lung cancer cells. After the lung cancer (subcutaneous-xenotransplant) model was established in mice, the T cell subtype and related cytokines in mouse tumor tissues were detected by flow cytometry and ELISA. Moreover, the expressions of CircCHST15, miR-155-5p, miR-194-5p, immune-related, and proliferation-related factors of the lung cancer cells or mice tumor tissues were detected by immunohistochemistry, RT-qPCR, or Western blot.ResultsCircCHST15 and PD-L1 were high-expressed in lung cancer, and the two was positively correlated. CircCHST15 targeted miR-155-5p and miR-194-5p, the later further targeted PD-L1. Lung cancer cell viability and proliferation were increased by miR-155-5p and inhibited by miR-194-5p. CircCHST15 located in the cytoplasm promoted tumor growth, down-regulated the expressions of miR-155-5p and miR-194-5p, and up-regulated the expressions of PD-L1, Ki-67, PCNA, CCL17, CCL22, IFN-γ, TNF-β, and IL-10. Also, CircCHST15 decreased the CD8+ cells in mouse blood and tumor, but increased the Tregs in mouse tumor. PD-L1 inhibitor showed an opposite effect to CircCHST15 on mouse tumors.ConclusionCircCHST15 sponged miR-155-5p and miR-194-5p to promote the PD-L1-mediated immune escape of lung cancer cells.

In contrast to commonly used approaches to improve data quality in diffusion weighted imaging, position-orientation adaptive smoothing (POAS) provides an edge-preserving post-processing approach. This study aims to investigate its potential and effects on image quality, diffusion metrics, and fiber tractography of the corticospinal tract in relation to non-post-processed and averaged data. 22 healthy volunteers were included in this study. For each volunteer five clinically applicable diffusion weighted imaging data sets were acquired and post-processed by standard averaging and POAS. POAS post-processing led to significantly higher signal-to-noise-ratios (p < 0.001), lower fractional anisotropy across the whole brain (p < 0.05) and reduced intra-subject variability of diffusion weighted imaging signal intensity and fractional anisotropy (p < 0.001, p = 0.006). Fiber tractography of the corticospinal tract resulted in significantly (p = 0.027, p = 0.014) larger tract volumes while fiber density was the lowest. Similarity across tractography results was highest for POAS post-processed data (p < 0.001). POAS post-processing enhances image quality, decreases the intra-subject variability of signal intensity and fractional anisotropy, increases fiber tract volume of the corticospinal tract, and leads to higher reproducibility of tractography results. Thus, POAS post-processing supports a reliable and more accurate fiber tractography of the corticospinal tract, being mandatory for the clinical use.

Bisphenol A (BPA) is a widespread pollutant threatening the ecosystem and human health. An effective BPA degrader YC-JY1 was isolated and identified as Sphingobium sp. The optimal temperature and pH for the degradation of BPA by strain YC-JY1 were 30 &deg, C and 6.5, respectively. The biodegradation pathway was proposed based on the identification of the metabolites. The addition of cytochrome P450 (CYP) inhibitor 1-aminobenzotriazole significantly decreased the degradation of BPA by Sphingobium sp. YC-JY1. Escherichia coli BL21 (DE3) cells harboring pET28a-bisdAB achieved the ability to degrade BPA. The bisdB gene knockout strain YC-JY1&Delta, bisdB was unable to degrade BPA indicating that P450bisdB was an essential initiator of BPA metabolism in strain YC-JY1. For BPA polluted soil remediation, strain YC-JY1 considerably stimulated biodegradation of BPA associated with the soil microbial community. These results point out that strain YC-JY1 is a promising microbe for BPA removal and possesses great application potential.

Polyethylenimine (PEI), a kind of cationic non-viral gene delivery vector, is capable of stable and efficient transgene expression for gene delivery. However, low transfection efficiency in vivo along with high toxicity limited the further application of gene therapy in the clinic. To enhance gene transfection performance and reduce cytotoxicity of polyethylenimine, branched polyethylenimine-derived cationic polymers BPEI25 k-man-S/L/M/H with different grafting degree with mannitol moieties were prepared and the transfection efficiency was evaluated. Among them, BPEI25 k-man-L showed the best transfection efficiency, lower toxicity, and significantly enhanced long-term systemic transgene expression for 96 h in vivo even at a single-dose administration. The results of cellular uptake mechanism and western-blot experiments revealed that the mannitol modification of BPEI25 k induced and up-regulated the phosphorylation of caveolin-1 and thus enhanced the caveolae-mediated cellular uptake. This class of gene delivery system highlights a paradigmatic approach for the development of novel and safe non-viral vectors for gene therapy.

To assess toxicities of the air in Chinese medicine clinics polluted by moxa-burning smoke due to moxibustion-derived burning products (MBP).Both acute and chronic toxicity studies were conducted. For the acute toxicity study, five groups of Wistar rats (n = 16/group, male: female = 1∶1) were exposed to five different concentrations (95%, 90%, 85%, 80% and 75%, respectively) of MBP for 2 h. For the chronic toxicity study, another three groups of male rats (n = 21/group) were exposed to MBP in three concentrations (10%, 40% and 70%, respectively) and one control group exposed to clean air 20 min/d for 144 d. Routine examinations were performed and analyzed by analysis of variance and dose-response relationship.In the acute toxicity study, the number of dead rats in the 95%, 90%, 85%, 80% and 75% groups were 16, 13, 7, 6 and 3, respectively, with LD50 of 86.274% after or during the 2 h exposure. In the chronic toxicity study, MBP exposure induced a decline in activity of the rats. Rats in the 10% group showed no signs of toxicity, while those in the 40% MBP group showed toxicity effects on the body weights (P0.05) and lung. Rats in the 70% MBP group also presented with reversible damage in the blood coagulation system (P0.05).Exposure to 10% MBP, which is equivalent to 27.45 mg/m3, was under the critical threshold for male rats' safety. Exposure to MBP above that limit induced lung damage. MBP in clinics need to be reduced to a safe level with enhanced ventilation.

Metastasis is the main factor of treatment failure in cancer patients, but the underlying mechanism remains to be elucidated and effective new treatment strategies are urgently needed. This study aims to explore novel key metastasis-related microRNAs (miRNAs) in esophageal squamous cell carcinoma (ESCC). By comparing miRNA profiles of the highly metastatic ESCC cell sublines, we established through serial in vivo selection with the parental cells, we found that the expression level of miR-515-3p was lower in ESCC tumor tissues than adjacent normal tissues, further decreased in metastatic tumors, and moreover, markedly associated with advanced stage, metastasis and patient survival. The in vitro and in vivo assays suggested that miR-515-3p could increase the expression of the epithelial markers as well as decrease the expression of the mesenchymal markers, and more importantly, suppress invasion and metastasis of ESCC cells. Mechanistically, we revealed that miR-515-3p directly regulated vimentin and matrix metalloproteinase-3 (MMP3) expression by binding to the coding sequence and 3′untranslated region, respectively. In addition, the data from whole-genome methylation sequencing and methylation-specific PCR indicated that the CpG island within miR-515-3p promoter was markedly hypermethylated in ESCC cell lines and ESCC tumor tissues, which may lead to deregulation of miR-515-3p expression in ESCC. Furthermore, our preclinical experiment provides solid evidence that systemic delivery of miR-515-3p oligonucleotide obviously suppressed the metastasis of ESCC cells in nude mice. Taken together, this study demonstrates that miR-515-3p suppresses tumor metastasis and thus represents a promising prognostic biomarker and therapeutic strategy in ESCC.

Aim. Our study is aimed at investigating whether Lipopolysaccharide- (LPS-) treated podocytes could polarize naive CD4+ T cells into different subsets in vitro. Materials and Methods. Podocytes and mouse bone marrow-derived dendritic cells (BMDCs) were first cultured with 25 μg/ml LPS for 6 hours, respectively. Then, naive CD4+ T cells were cocultured with the LPS-treated podocytes or BMDCs at a ratio of 1 : 1 or 1 : 1 : 1. After 48 hours, we collected the suspended cells and supernatant from all groups to measure T helper (Th)17 cells, regulatory T (Treg) cells, and cytokine concentration. Results. We observed the expression of CD80 and major histocompatibility complex class II molecule (MHC II) in podocytes but did not found the upregulation of them after treating podocytes with LPS. LPS-treated podocytes could induce naive CD4+ T cells to Th17 cells and Treg cells with a higher ratio of Th17/Treg than BMDCs. Possible interaction between podocytes and BMDCs may exist in the induction process of Th17 cells and Treg cells. Conclusion. Our study proved that CD80 and MHC II were constitutively expressed in podocytes but not upregulated by LPS. LPS-treated podocytes could polarize naive CD4+ T cells into Th17 and Treg cells and affect the Th17/Treg balance and may incline to cause a Th17 response.

The amoxicillin-UCCs-2/TPP nanoparticles constructed with ureido-modified chitosan derivative UCCs-2 and sodium tripolyphosphate (TPP) played an important role to deliver drug to achieve more efficacious and specific eradication of Helicobacterpylori (H. pylori) in vitro. In this study, the anti-H. pylori effectiveness in vivo and uptake mechanism was investigated in details, including the effect of temperature, pH values and the addition of competitive substrate urea on uptake. Compared with unmodified nanoparticles, a more efficacious and specific anti-H. pylori activities were obtained in vivo by using this biological chitosan derivative UCCs-2. Histological staining and immunological analysis verified that the amoxicillin-UCCs-2/TPP nanoparticles could diminish the proinflammatory cytokines levels and alleviate the inflammatory damages caused by H. pylori infection. The uredio-modified nanoparticles also have favorable gastric retention property, which is beneficial for the oral drug delivery to targeted eradicate H. pylori infection in stomach. These findings suggest that this targeted drug delivery system may serve for specific treatment of H. pylori infection both in vitro and in vivo, which can also be used as promising nanocarriers for other therapeutic reagents to target H. pylori.

Macrophages are involved in angiogenesis, an essential process for organ growth and tissue repair, and could contribute to the pathogenesis of angiogenesis-related diseases such as malignant tumors and diabetic retinopathy. Recently, long noncoding RNAs (lncRNAs) have been proved to be important in cell differentiation, organismal development, and various diseases of pathological angiogenesis. Moreover, it has been indicated that numerous lncRNAs exhibit different functions in macrophage infiltration and polarization and regulate the secretion of inflammatory cytokines released by macrophages. Therefore, the focus of macrophage-related lncRNAs could be considered to be a potential method in therapeutic targeting angiogenesis-related diseases. This review mainly summarizes the roles played by lncRNAs which associated with macrophages in angiogenesis. The possible mechanisms of the regulatory link between lncRNAs and macrophages in various angiogenesis-related diseases were also discussed.

Yang Jia, Zhaohua Xiao, Xin Gongsun, Zhongwei Xin, Bin Shang, Gang Chen, Zhou Wang, Wenpeng Jiang Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China Background: Centrosomal protein 55 (CEP55) is an important prognostic biomarker that plays an essential role in the proliferation, migration and invasion of multiple tumors. We aimed to investigate the prognostic value of CEP55 in pN0 esophageal squamous cell carcinoma (ESCC) and explore its biological function in ESCC cells.Methods: We used immunohistochemistry and Western blot analysis to detect the expression of CEP55 in ESCC. Furthermore, both in vitro and in vivo assays were used to determine the effect of CEP55 on malignant behavior in ESCC cells.Results: As expected, we found that CEP55 was overexpressed in ESCC. Univariate and multivariate analyses demonstrated that patients with CEP55 overexpression had a poor prognosis. Additionally, the abilities of proliferation, migration and invasion of cells, as well as the epithelial–mesenchymal transition markers, were all altered with the changed CEP55 expression levels in ESCC cells. Further study elucidated that CEP55 facilitated ESCC via the PI3K/Akt pathway. Blockade of this pathway markedly attenuated CEP55-mediated proliferation, migration, invasion and epithelial–mesenchymal transition of ESCC cells.Conclusion: Oncogenic CEP55 correlates with a poor prognosis by regulating tumor cell proliferation, migration and invasion via the PI3K/Akt pathway. It can serve as a promising prognostic biomarker and therapeutic target of pN0 ESCC after Ivor-Lewis esophagectomy. Keywords: CEP55, proliferation, migration, invasion, esophageal squamous cell carcinoma, PI3K/Akt pathway

As UHV transmission projects are put into operation, it happens frequently that a number of UHV AC and DC lines share a narrow corridor. Under extreme conditions, all transmission lines in a common corridor are at risk of complete outrage. Once a common outrage occurs in an aisle, it will pose a huge impact on the power grid and a blackout may occur. This paper proposes an approach to the risk assessment of transmission aisle as lifeline engineering that supports dynamic risk assessment and provides technical support for the planning, construction, operation and maintenance of transmission aisle as lifeline engineering.

BACKGROUND Previous studies have elucidated that FOXM1 may predict poor prognosis in patients with multiple solid malignant tumors. In this study we explored the differential expression of FOXM1 in stage IIA esophageal squamous cell carcinoma (ESCC) and investigated its prognostic value. METHODS Immunohistochemistry (IHC) and Western blot were used to detect FOXM1 expression in ESCC. Correlations between FOXM1 expression and clinicopathological variables, and five-year lymphatic metastatic recurrence (LMR) and overall survival (OS) of patients were analyzed. RESULTS FOXM1 was aberrantly expressed in ESCC. Statistical analysis revealed a close relationship between FOXM1 expression and tumor size (P = 0.024), depth of invasion (P = 0.048), and degree of differentiation (P = 0.043). The five-year LMR of patients in the FOXM1 overexpression group was significantly increased compared to the low expression group (P = 0.001). The five-year OS of patients in the FOXM1 overexpression group was significantly reduced compared to the low expression group (P = 0.007). Log-rank tests demonstrated that large tumor size (P = 0.044), poor differentiation degree (P = 0.005), deep invasion (P = 0.000), and FOXM1 overexpression (P = 0.007) may indicate poor prognosis in stage IIA ESCC. Cox multivariate regression analysis revealed that all of these variables were independent predictors of unfavorable outcome (P < 0.05). CONCLUSION FOXM1 could be a predictor of lymphatic metastatic recurrence in stage IIA ESCC after Ivor Lewis esophagectomy.

Serine/Arginine-Rich Protein-Specific Kinase-2 (SRSF protein kinase-2, SRPK2) is up-regulated in multiple human tumors. However, the expression, function and clinical significance of SRPK2 in prostate cancer (PCa) has not yet been understood. We therefore aimed to determine the association of SRPK2 with tumor progression and metastasis in PCa patients in our present study. The expression of SRPK2 was detected by some public datasets and validated using a clinical tissue microarray (TMA) by immunohistochemistry. The association of SRPK2 expression with various clinicopathological characteristics of PCa patients was subsequently statistically analyzed based on the The Cancer Genome Atlas (TCGA) dataset and clinical TMA. The effects of SRPK2 on cancer cell proliferation, migration, invasion, cell cycle progression, apoptosis and tumor growth were then respectively investigated using in vitro and in vivo experiments. First, public datasets showed that SRPK2 expression was greater in PCa tissues when compared with non-cancerous tissues. Statistical analysis demonstrated that high expression of SRPK2 was significantly correlated with a higher Gleason Score, advanced pathological stage and the presence of tumor metastasis in the TCGA Dataset (all P < 0.01). Similar correlations between SRPK2 and a higher Gleason Score or advanced pathological stage were also identified in the TMA (P < 0.05). Kaplan-Meier curve analyses showed that the biochemical recurrence (BCR)-free time of PCa patients with SRPK2 high expression was shorter than for those with SRPK2 low expression (P < 0.05). Second, cell function experiments in PCa cell lines revealed that enhanced SRPK2 expression could promote cell proliferation, migration, invasion and cell cycle progression but suppress tumor cell apoptosis in vitro. Xenograft experiments showed that SRPK2 promoted tumor growth in vivo. In conclusion, our data demonstrated that SRPK2 may play an important role in the progression and metastasis of PCa, which suggests that it might be a potential therapeutic target for PCa clinical therapy.

The acidic environment of the stomach is a threat to the curative effect of antimicrobial drugs for the eradication of Helicobacter pylori (H. pylori) in the infected area. The conventional clinical formulations of antibiotics have low specificity to H. pylori, which disrupts the normal balance of intestinal microbiomes. Therefore, oral drug delivery system with better stability at low pH as well as higher specificity to target H. pylori would provide more effective strategy to eradicate H. pylori and reduce the side effect of antibiotics. Based on the construction of UreI-mediated targeted drug delivery system developed by our group, in this work, using urea-modified UCCs-2 as targeting moiety to the UreI channel protein which is specifically expressed on H. pylori, pH-sensitive amoxicillin-loaded AMX-PLGA/UCCs-2 nanoparticles produced by UCCs-2 and PLGA for targeted treatment of H. pylori infection were established. The nanoparticles were prepared by double emulsion-solvent evaporation method. To achieve a promising drug delivery system with favorable pH-sensitive properties, we adopted an orthogonal design to obtain the optimal formulation. The results showed that the optimized AMX-PLGA/UCCs-2 nanoparticles were in a favorable pH sensitive manner and exhibited low cytotoxicity, higher specificity and better anti-H. pylori efficiency than amoxicillin and non-targeting AMX-PLGA/Cs nanoparticle both in vitro and in vivo, which can protect the antimicrobial drugs against acidic environment and deliver them to targeted eradicate H. pylori in the infected location. The cellular uptake mechanism showed that AMX-PLGA/UCCs-2 nanoparticles are an effective UreI-mediated targeted drug delivery system for anti-H. pylori treatment, which can also be used as promising nanocarriers for oral delivery of other therapeutic drugs to targeted treat H. pylori.

Streptochlorin, a small indole alkaloid isolated from marine Streptomyces sp., exhibits a wide range of potent biological activities. An efficient and economic synthetic protocol for streptochlorin has been developed and validated, 4 steps from indole in a total yield of 45%, and further applied for the synthesis of its analogues. Biological testing showed that most of the target compounds exhibited potential antifungal activity in the primary assays, especially compounds 6, 7 and 9c were the most active ones, representing effective activity against the phytopathogenic fungi screened in preliminary test and might be explored for the study of mode of action in the future.

Scope: Colorectal cancer (CRC) is one of the most common cancers worldwide with poor survival and limited therapeutic options, and there is an urgent need to develop novel therapeutic agents with good treatment efficiency and low toxicity. This study aims to examine the anticancer bioactivity of liensinine, a constituent of Nelumbo nucifera Gaertn, in CRC and investigate the action mechanisms involved. Methods and results: Liensinine was found to induce apoptosis and exert a significant inhibitory effect on the proliferation and colony-forming ability of CRC cells in a dose-dependent manner without any observed cytotoxicity on normal colorectal epithelial cells. Mechanistically, our data from quantitative proteomics, western blot analysis and flow cytometry analyses demonstrated that exposure of CRC cells to liensinine caused cell cycle arrest, mitochondrial dysfunction and apoptosis, accompanied by the activation of the JNK signaling pathway. Furthermore, animal experiments showed that liensinine markedly suppressed the growth of CRC tumor xenografts in nude mice by reducing the Ki-67 proliferation index, but did not damage the vital organs of the animals. Conclusion: This study demonstrated for the first time that liensinine, a food-source natural product, could be a novel therapeutic strategy for treating CRC without obvious side effects.

The expression level and clinical significance of NR4A1 are presently unknown in the non-small-cell lung carcinoma (NSCLC). This study aimed to explore the expression, prognostic value, and function of NR4A1 in NSCLC. Methods: Clinicopathological parameters of 167 NSCLC patients who received radical surgery from January 2007 and December 2012 were retrospectively reviewed. The NR4A1 expression in NSCLC tumors and the adjacent matched para-carcinoma specimens were examined, and the association between NR4A1 expression and clinical variables was explored. Cell viability assay, and transwell migration and invasion assays were used to access the function of NR4A1 in NSCLC. Kaplan-Meier analysis and Cox regression were performed to investigate the prognostic significance of NR4A1 for NSCLC. Results: NR4A1 was overexpressed in NSCLC tissues compared with the para-carcinoma specimens. Consistently, Oncomine analysis showed that NR4A1 was overexpressed in NSCLC tissues compared with normal tissues in published datasets (P < 0.001). The elevated NR4A1 expression was associated with carcinoma recurrence (P < 0.05). The 5-year median overall survival (OS) and progression free survival (PFS) were significantly poorer in the NR4A1-overexpression group. Multivariate Cox analysis showed that NR4A1 overexpression was an independent factor for OS (HR, 95%CI: P < 0.05) and PFS (HR, 95%CI: P < 0.05) in NSCLC. Moreover, knockdown of NR4A1 significantly reduced NSCLC cell proliferation, migration, and invasion. Conclusions: NR4A1 exhibits a tumor-promoting effect on NSCLC, and might serve as a promising prognostic biomarker and a therapeutic target for NSCLC.

Transparent and flexible chitosan-based membranes containing antibacterial drugs were prepared through a casting/solvent evaporation method from suspension of chitosan floccule. To enhance mechanical properties, glycerin was incorporated into the floccule suspension to conjugate chitosan as a plasticizer. The mechanism of membrane formation is attributed to inter- and intro-hydrogen bonding between chitosan and glycerol molecules. The results showed that incorporation of glycerol has a significant influence on the properties of the chitosan membranes. With the increase of glycerol content, the tensile strength, swelling rate, water vapor permeability and wettability of membranes were significantly improved. In vitro enzymatic degradation revealed that the chitosan membrane had long-term stability regardless of the glycerol content. To enhance antibacterial properties, tetracycline hydrochloride (TH) and silver sulfadiazine (AgSD), representing the water-soluble and water-insoluble drug models, were integrated into the membranes, respectively. The results of controlled-release efficacy and inhibition zone indicate that the glycerol toughened chitosan membranes containing drugs have a promising future in treatment of bacterial infection as wound dressing.

// Dong Wang 1 , Licheng Du 2 , Zhou Wang 1 , Xiangyan Liu 1 , Yejun Qin 3 , Qiangxiu Wang 3 , Zhe Yang 4 , Zhigang Yao 3 , Mo Shi 1 , Bin Shang 1 , Yang Jia 1 , Huaxia Chen 1 , Liang Qiao 1 , Xueqing Wang 1 , Zhaohua Xiao 1 and Zhenchuan Liu 1 1 Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China 2 Department of General Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China 3 Department of Pathology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China 4 Department of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, China Correspondence to: Zhou Wang, email: wz620226@hotmail.com Keywords: esophageal neoplasms, survival analysis, receptor, fibroblast growth factor, type 1 Received: July 21, 2017 Accepted: August 27, 2017 Published: October 04, 2017 ABSTRACT Purpose : To investigate whether FGFR1 gene amplification is associated with clinicopathologic characteristics and its potential impact on survival in patients with resected esophageal squamous cell carcinoma (ESCC). Methods : Five hundred fifty-six ESCC patients undergoing curative resection of ESCC were retrospectively studied. FGFR1 gene copy number was determined in microarrayed tumor samples using fluorescent in situ hybridization (FISH) analysis. FGFR1 gene amplification status was prespecified as copy number ≥ 6 or FGFR1/CEN 8 ratio ≥ 2.2. FGFR1 expression was evaluated by immunohistochemistry. Overall survival (OS) and disease-free survival (DFS) were analyzed using the Kaplan-Meier method followed by the log rank test. Correlation with survival was examined using multivariate Cox regression. Results : FGFR1 amplification was identified in 67 (12.1%) patients; these patients had significantly shorter OS (50.0 vs 32.0 months; log rank; P

Background Recent research has shown that IFITM3 plays an important role in the tumorigenesis of many malignancies. We investigated the clinicopathological variables and prognostic value of IFITM3 in stage IIA esophageal squamous cell carcinoma (ESCC) patients. Methods Immunohistochemistry and Western blot analysis were used to examine IFITM3 expression in tumor specimens. The relationships between IFITM3 expression and clinicopathological variables, as well as the five-year survival and recurrence status of patients, were analyzed. Results IFITM3 was aberrantly expressed in tumor tissue. Statistical analysis showed a close correlation of IFITM3 expression with T tumor status (P = 0.004). Additionally, IFITM3 overexpression, advanced T status, poor degree of differentiation, and large tumor size were not only associated with poor survival but were high lymphatic metastatic recurrence predictors in ESCC patients (P