Search

Cesarean delivery vs vaginal delivery was reported to increase the risks of childhood obesity, pneumonia, anemia, and neurobehavioral disorders, but few studies were able to deal with the confounding biases associated with medical conditions indicating cesareans. This prospective cohort study aims to investigate the associations of non-medically indicated cesarean delivery on maternal request (CDMR) with these child health outcomes.Among 17 748 liveborn infants whose mothers (primiparas) participated in a randomized controlled trial on micronutrient supplementation and pregnancy outcomes during 2006-2009 in 5 rural counties in Hebei Province, China, 6972 singletons born by full-term spontaneous vaginal delivery (SVD) and 3626 by CDMR were extracted for the assessments of obesity (weight-for-height z-score3) and pneumonia (self-reported) at 1.5-5 years in 2011. Some children were further randomly selected from these two groups for the assessments of anemia (hemoglobin110 g/L, 2341 SVD and 2417 CDMR) and neurobehavioral disorders (raw score of Child Behavior Checklist larger than the 90th percentile of the normative sample, 1257 SVD and 1060 CDMR).Compared with SVD, CDMR was associated with increased risks of obesity (adjusted odds ratio (aOR) = 1.41, 95% confidence interval (CI) = 1.14-1.75,Cesarean delivery, independent of cesarean indications, is likely associated with childhood obesity and anemia, indicating a need to keep pregnant women informed, especially those seeking CDMR, a need to explore possible improvement on obstetric service, and even a need for main stakeholders to reach a compromise in making a cesarean decision.ClinicalTrials.gov: NCT00133744 and NCT01404416.

Tumour budding (TB) activity, cell nest size (CNS), and desmoplastic reaction (DR) have been confirmed to be significantly correlated with prognosis in oesophageal squamous cell cancer (ESCC) recently. However, there are limited data on the prognostic significance of combined assessment of cellular dissociation and tumour stroma in ESCC.In all, 265 cases with resected ESCCs diagnosed between January 2018 and August 2019 were retrospectively reviewed. All slides were reviewed for assessing TB, CNS, and DR. The Cellular Dissociation Grading and our Combined CNS and DR (CNS/DR) Grading systems were adopted to re-grade ESCCs.High TB activity, small CNS, and immature DR had a strong association with shorter overall survival (OS) and progression-free survival (PFS) (P 0.001, respectively) in ESCC. Combined assessment of CNS and DR in a 4-tiered grading system displayed a prognostic excellence for survival (P 0.001), and outperformed the Cellular Dissociation Grading for both OS (area under the curve [AUC], 0.728 versus 0.644, P = 0.043) and PFS (AUC, 0.763 versus 0.667, P = 0.018) by receiver operator characteristic curves. Also, Combined CNS/DR Grading showed superiority in recognizing a G4 subgroup with the worst outcome in our cohort, to whom the most urgent attention needs to be called.This is the first study to propose a novel Combined Grading system based on CNS and DR in ESCC, which has been demonstrated to be relatively superior to Cellular Dissociation Grading in predicting prognosis. The findings shed new light on the histopathological grading of ESCC and facilitates identifying biologically aggressive ESCCs.

To compare the clinicopathological characteristics and survival outcomes of children and adult diagnosed with medullary thyroid carcinoma (MTC). MTC patients were extracted from the Surveillance, Epidemiology and End Results (SEER) database from 1998 to 2016, followed by stratification into pediatric (P P = 0.015); (OS: HR 5.63, 95% CI 2.08–15.25, P = 0.001)]. Further stratified analysis indicated that pediatric group might have significant better CSS and OS for patients with more advanced stage. Patients in the pediatric group were more likely to have earlier stage. Moreover, the prognosis of pediatric MTC patients was significantly better than that in adult patients.

Human health has been severely affected by infections resulting from multidrug-resistant (MDR) gram-negative bacteria (GNB). Monobactam antibiotics are known to be effective against such infections. This study aimed to construct a predictive two-dimensional quantitative structure-activity relationship (2D-QSAR) model for the rational design of new monobactams based on the 65 known monobactams against Escherichia coli (Eco) and Klebsiella pneumonia (Kpn) strains using the kernel partial least squares regression (KPLS) algorithm. The total performance of Eco and Kpn KPLS modes was shown as RMSE: 0.681/0.596, R2: 0.946/0.882, Q2: 0.922/0.877, and RMSU: 0.625/0.593. Thirty-four monobactams reported in our lab were chosen as external data to predict their activities against Eco and Kpn using the newly established models, by which the R2 between the experimental and predicted values was 0.878 and 0.871, respectively. The models developed and verified in this study provide a powerful design strategy for novel monobactams that are effective against MDR gram-negative bacterial infections.

Objective:To explore whether and how group cognitive-behavioural therapy (GCBT) plus medication differs from medication alone for the treatment of generalised anxiety disorder (GAD).Methods:Hundred and seventy patients were randomly assigned to the GCBT plus duloxetine (n=89) or duloxetine group (n=81). The primary outcomes were Hamilton Anxiety Scale (HAMA) response and remission rates. The explorative secondary measures included score reductions from baseline in the HAMA total, psychic, and somatic anxiety subscales (HAMA-PA, HAMA-SA), the Hamilton Depression Scale, the Severity Subscale of Clinical Global Impression Scale, Global Assessment of Functioning, and the 12-item Short-Form Health Survey. Assessments were conducted at baseline, 4-week, 8-week, and 3-month follow-up.Results:At 4 weeks, HAMA response (GCBT group 57.0% vs. control group 24.4%,p=0.000, Cohen’sd=0.90) and remission rates (GCBT group 21.5% vs. control group 6.2%,p=0.004;d=0.51), and most secondary outcomes (allpd=0.36−0.77) showed that the combined therapy was superior. At 8 weeks, all the primary and secondary significant differences found at 4 weeks were maintained with smaller effect sizes (pd=0.32−0.48). At 3-month follow-up, the combined therapy was only significantly superior in the HAMA total (pd=0.43) and HAMA-PA score reductions (pd=0.77). Logistic regression showed superiority of the combined therapy for HAMA response rates [odds ratio (OR)=2.12, 95% confidence interval (CI) 1.02−4.42,p=0.04] and remission rates (OR=2.80, 95% CI 1.27−6.16,p=0.01).Conclusions:Compared with duloxetine alone, GCBT plus duloxetine showed significant treatment response for GAD over a shorter period of time, particularly for psychic anxiety symptoms, which may suggest that GCBT was effective in changing cognitive style.

Enzymes are very important for biological processes in a living being, performing similar or multiple tasks in and out of cells, tissues and other organisms at a particular location. The abnormal activity of particular enzyme usually caused serious diseases such as Alzheimer’s disease, Parkinson’s disease, cancers, diabetes, cardiovascular diseases, arthritis etc. Hence, nondestructive and real-time visualization for certain enzyme is very important for understanding the biological issues, as well as the drug administration and drug metabolism. Fluorescent cellular probe-based enzyme detection in vitro and in vivo has become broad interest for human disease diagnostics and therapeutics. This review highlights the recent findings and designs of highly sensitive and selective fluorescent cellular probes targeting enzymes for quantitative analysis and bioimaging.

This study aimed to explore the association of tumor sidedness with the prognosis of patients with colon signet ring cell carcinoma (SRCC). Eligible patients were retrieved from the Surveillance, Epidemiology, and End Results database between 2004 and 2015. Cancer-specific survival (CSS) and overall survival (OS) were compared between patients with left-sided colon SRCC and those with right-sided lesions. A total of 2660 patients were included, among them, 1983 (74.5%) had right-sided colon SRCC. Compared to patients with left-sided colon SRCC, those who had the right-sided colon SRCC showed higher proportion of white race, female, aged ≥ 65 years, receiving total colectomy and ≥ 4 regional lymph node dissection; while had lower proportion of advanced AJCC stage. Besides, right-sided patients exhibited superior 5-year CSS (32.74% vs. 25.89%, P = 0.001) and OS (27.38% vs. 23.02%, P = 0.024) rates compared with left-sided ones. Multivariate analysis revealed that tumor sidedness was an independent prognostic factor. To be specific, patients with right-sided colon SRCC showed better CSS (HR: 0.873; 95% CI 0.777–0.981; P = 0.023) and OS (HR: 0.838; 95% CI 0.753–0.965; P = 0.002). Moreover, subgroup analysis demonstrated superior CSS and OS for right-sided patients in most subgroups. Tumor sidedness was an independent prognostic indicator for colon SRCC. Besides, patients with right-sided colon SRCC have superior prognosis than those with left-sided lesions.

This study aimed to assess the benefit of postoperative adjuvant chemotherapy in stage II–III colorectal signet ring cell carcinoma (SRCC). Qualified postoperative patients were extracted from Surveillance, Epidemiology, and End Results (SEER) database from 2004 until 2015. We collected 1675 patients in the research, and 936 patients were subjected to adjuvant chemotherapy group. The proportions of married status, male, rectal cancer, grade III/IV, AJCC stage III and radiotherapy were higher; While, the rates of white race, ≥ 65 years old and located in cecum–transverse colon were lower in patients of chemotherapy group compared to no chemotherapy group (all P P P = 0.93). However, after adjusting for confounding factors by multivariable Cox regression analysis, receipt of postoperative chemotherapy was still associated with better CSS and OS (CSS: hazard ratio [HR] = 0.719, 95% CI 0.612–0.844, P P

The aim of the present study was to explore the antitumor effects of sinoporphyrin sodium (DVDMS)-mediated photodynamic therapy (PDT) and sonodynamic therapy (SDT) in glioma, and to reveal the underlying mechanisms. The uptake of DVDMS by U-118 MG cells was detected by flow cytometry (FCM). A 630-nm semiconductor laser and 1-MHz ultrasound were used to perform PDT and SDT, respectively. Cell proliferation and apoptosis were evaluated using the Cell Counting Kit-8 assay, FCM and Hoechst 33258 staining, respectively. Western blot analysis was used to detect protein expression and phosphorylation levels. BALB/c nude mice were used to establish a xenograft model of U-118 MG cells. DVDMS was injected intravenously and PDT and SDT were performed 24 h later. An in vivo imaging system was used to evaluate the fluorescence of DVDMS, to measure tumor sizes, and to evaluate the therapeutic effects. The uptake of DVDMS by U-118 MG cells was optimal after 4 h. PDT and SDT following DVDMS injection significantly inhibited the proliferation and increased apoptosis of glioma cells in vitro (P

Massively parallel sequencing of forensic STRs simultaneously provides length-based genotypes and core repeat sequences as well as flanking sequence variations. Here, we report primer sequences and concentrations of a next-generation sequencing (NGS)-based in-house panel covering 28 autosomal STR loci (CSF1PO, D1GATA113, D1S1627, D1S1656, D1S1677, D2S441, D2S1776, D3S3053, D5S818, D6S474, D6S1017, D6S1043, D8S1179, D9S2157, D10S1435, D11S4463, D13S317, D14S1434, D16S539, D18S51, D18S853, D20S482, D20S1082, D22S1045, FGA, TH01, TPOX, and vWA) and the sex determinant locus Amelogenin. Preliminary evaluation experiments showed that the panel yielded intralocus- and interlocus-balanced sequencing data with a sensitivity as low as 62.5 pg input DNA. A total of 203 individuals from Yunnan Bai population were sequenced with this panel. Comparative forensic genetic analyses showed that sequence-based matching probability of this 29-plex panel reached 2.37 × 10-29 , which was 23 times lower than the length-based data. Compound stutter sequences of eight STRs were compared with parental alleles. For seven loci, repeat motif insertions or deletions occurred in the longest uninterrupted repeat sequences (LUS). However, LUS and non-LUS stutters co-existed in the locus D6S474 with different sequencing depth ratios. These results supplemented our current knowledge of forensic STR stutters, and provided a sound basis for DNA mixture deconvolution.

The overall survival rate of patients with hepatocellular carcinoma (HCC) has remained unchanged over the last several decades. Therefore, novel drugs and therapies are required for HCC treatment. Isoliquiritigenin (ISL), a natural flavonoid predominantly isolated from the traditional Chinese medicine Glycyrrhizae Radix (Licorice), has a high anticancer potential and broad application value in various cancers. Here, we aimed to investigate the anticancer role of ISL in the HCC cell line Hep3B. Functional analysis revealed that ISL inhibited the proliferation of Hep3B cells by causing G1/S cell cycle arrest in vitro. Meanwhile, the inhibitory effect of ISL on proliferation was also observed in vivo. Further analysis revealed that ISL could suppress the migration and metastasis of Hep3B cells in vitro and in vivo. Mechanistic analysis revealed that ISL inhibited cyclin D1 and up-regulated the proteins P21, P27 that negatively regulate the cell cycle. Furthermore, ISL induced apoptosis while inhibiting cell cycle transition. In addition, phosphatidylinositol 3′-kinase/protein kinase B (PI3K/AKT) signal pathway was suppressed by ISL treatment, and the epithelial marker E-cadherin was up-regulated when the mesenchymal markers Vimentin and N-cadherin were down-regulated. In brief, our findings suggest that ISL could be a promising agent for preventing HCC tumorigenesis and metastasis.

Supplemental Digital Content is available in the text, Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each

// Ling Cao 1 , Yong-Jing Yang 1 , Zhi-Wen Li 2 , Hong-Fen Wu 1 , Zhu-Chun Yang 1 , Shi-Xin Liu 1 , Ping Wang 3 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun 130012, People’s Republic of China 2 Department of Anesthesiology, The First Hospital Affiliated to Jilin University, Changchun 130012, People’s Republic of China 3 Department of Radiotherapy, Cancer Institute and Hospital of Tianjin Medical University, Tianjin 300060, People’s Republic of China Correspondence to: Shi-Xin Liu, email: liushixin1964@sina.com Ping Wang, email: wangping.99999@yahoo.com.cn Keywords: prostatic neoplasms, hypofractionation, radiotherapy, meta-analysis Received: August 08, 2016 Accepted: November 24, 2016 Published: December 01, 2016 ABSTRACT To compare the efficacy and safety of moderate hypofractionated radiotherapy (H-RT) with those of conventional radiotherapy (C-RT) in patients with localized prostate cancer, we conducted extensive literature searches of The Web of Science, Embase, Pubmed and Cochrane Library databases. We identified nine studies with 5969 patients for a meta-analysis. We calculated pooled risk ratios (RRs) and the 95% confidence intervals (CIs) for multiple parameters and performed statistical analysis using RevMan 5.3 software. Our analysis showed that the H-RT group obtained greater improvements in the 5-year biochemical or clinical failure-free survival (RR = 1.04, 95% CI:1.01–1.08; P = 0.01) and 5-year disease-free survival(RR = 1.04, 95% CI: 1.01–1.07, P = 0.02) than the C-RT group. However, the 5-year overall survival rates were comparable in the two groups (RR = 1.02, 95% CI: 0.99–1.04; P = 0.18). Comparison of multiple secondary parameters, including grade 2-4 acute/late gastrointestinal toxicity, grade 2–4 acute/late genitourinary toxicity, biochemical failure, local failure, distant failure and prostate cancer-specific mortality between the H-RT and the C-RT groups showed no statistical differences. This meta-analysis thus indicates that in patients with localized prostate cancer, moderate H-RT exerts a great beneficial effect on the primary parameters than C-RT without enhancing adverse events.

// Yong-Jing Yang 1, * , Ling Cao 1, * , Zhi-Wen Li 2 , Ling Zhao 1 , Hong-Fen Wu 1 , Dan Yue 1 , Jin-Lei Yang 1 , Zhi-Rui Zhou 3 , Shi-Xin Liu 1 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun, 130012, People’s Republic of China 2 Department of Anesthesiology, The First Hospital Affiliated to Jilin University, Changchun, 130012, People’s Republic of China 3 Department of Radiation Oncology, Fudan University Shanghai Cancer Center, Shanghai, 200032, People’s Republic of China * These authors contribute equally to this work Correspondence to: Shi-Xin Liu, email: liushixin1964@126.com Zhi-Rui Zhou, email: zzr3711@163.com Keywords: rectal neoplasms, neoadjuvant chemoradiotherapy, oxaliplatin, meta-analysis Received: March 06, 2016 Accepted: June 03, 2016 Published: June 14, 2016 ABSTRACT To measure the safety and efficacy of oxaliplatin (OX) application in neoadjuvant chemoradiotherapy (CRT) for locally advanced rectal cancer (LARC), EMBASE, PubMed, Cochrane Library, and Web of Science were used for a literature search. Cochrane’s risk of bias tool of randomized controlled trials (RCTs) was used for quality evaluation. The statistical analyses were performed using RevMan 5.3. In addition, 95% confidence intervals (CIs) and pooled risk ratios (RRs) were calculated. Seven RCTs were included in our meta-analysis. After adding OX to fluoropyrimidine (FU), a marginal significant improvement in disease-free survival was noted compared with FU alone (RR = 0.89, 95% CI: 0.78–1.00; P = 0.05). Neoadjuvant CRT with OX significantly decreased the distant metastasis rate (RR = 0.79, 95% CI: 0.67–0.94, P = 0.007). However, no improvement in the local recurrence rate (RR = 0.86, 95% CI: 0.68–1.08; P = 0.19) was noted. In addition, neoadjuvant CRT with OX also significantly increased the pathologic complete response (RR = 1.24, 95% CI: 1.02–1.51; P = 0.03). Grade 3–4 acute toxicity and grade 3–4 diarrhea was considerably higher for OX/FU compared with FU alone. In conclusion, the use of OX on the basis of FU/capecitabine in preoperative CRT is feasible. LARC patients are likely to benefit from CRT regimens with OX.

To establish a genetic susceptibility assessment model of lung cancer risk potentially associated with polycyclic aromatic hydrocarbon (PAH) inhalation exposure among non-smokers in China, a total of 143 patients with lung adenocarcinoma and 143 cancer-free individuals were recruited. Sixty-eight genetic polymorphisms in 10 pathways related to PAH metabolism and tumorigenesis were selected and examined. It was observed that 3 genetic polymorphisms, along with 10 additional genetic polymorphisms via gene-gene interactions, significantly influenced lung cancer risk potentially associated with PAH inhalation exposure. Most polymorphisms were associated with PAH metabolism. According to the established genetic susceptibility score (GSS), lung cancer risk increased with a rise in the GSS level, thereby indicating a positive dose-response relationship.

Ethnopharmacological relevance For many years, Guangzhou University of Chinese Medicine has been successfully using the empirical Wenyang Huoxue Jiedu formula (WHJF) to treat coronary heart disease. Modern theories of acute coronary syndrome mainly focus on rupture of thin-cap fibroatheromas (TCFAs), which is closely related to the release of vascular endothelial growth factor and its receptor (VEGF/VEGFR). Aim of study We investigated the effects of WHJF on the formation of TCFA plaques and the potential mechanism (VEGF/VEGFR signaling pathway). Materials and methods For the in vivo experiments, WHJF was administered to ApoE-/- mice, as a model of TCFA plaque formation. Aortic sections of the mice were obtained, and the vulnerability index and new vessel density of plaques were calculated by the Movat staining assay and immunohistochemistry kit, respectively. Protein and mRNA expression levels of VEGF/VEGFR in aortas were assayed by capillary electrophoresis immunoassay and quantitative real-time polymerase chain reaction analyses. In vitro, WHJF serum was produced in rats on the fourth day 2 h after the first administration of different concentrations of WHJF. Proliferation, migration, and lumen formation ability of human umbilical vein endothelial cells (HUVECs) treated with sera from these rats were assayed by the CKK-8 kit, Transwell plates, and Matrigel assay, respectively. Protein and mRNA expression levels of signaling molecules in the VEGF/VEGFR pathways were also examined. Results In vivo, the vulnerability index and new vessel density of plaques in the WHJF group were lower than those values in the blank control group (P 0.05). In vitro, the proliferation, migration, and tube formation of HUVECs in the high-dose WHJF group were reduced compared to the control group (P 0.05). Conclusions WHJF inhibits TCFA formation by influencing the VEGF/VEGFR signaling pathway.

BACKGROUND The aim of this study was to evaluate the effects of topical ropivacaine anesthesia on hemodynamic responses during intubation and extubation of hypertensive patients. MATERIAL AND METHODS One hundred fifty patients with hypertension ASA II-III were scheduled for noncardiac operations. Patients were divided into 3 groups: a control group receiving 5 ml saline, and 2 groups receiving topical anesthesia with 100 mg lidocaine or 37.5 mg ropivacaine. Hemodynamic responses, including blood pressure and heart rate (HR), were recorded at baseline (T0), before intubation (T1), during tracheal intubation (T2), 2 min after intubation (T3), upon eye opening on verbal commands (T4), during tracheal extubation (T5), and 2 min after extubation (T6). Patients were injected with urapidil 5 mg during intubation and extubation if their systolic blood pressure (SBP) was ≥160 mmHg or diastolic blood pressure (DBP) was ³90 mmHg, and esmolol 10 mg when HR was ≥90 bpm. RESULTS During extubation, the total dosages of urapidil and esmolol were significantly higher in the saline than in the lidocaine or ropivacaine groups, and were significantly lower in the ropivacaine than in the lidocaine group. At T2, SBP, SBP, MAP, and HR were lower in the lidocaine and ropivacaine groups than in the saline group, but the differences were not significant. From T4 to T6, SBP, DBP, MAP, and HR were significantly lower in the ropivacaine group than in the other 2 groups (P

To explore the secular trends of cesarean delivery and cesarean delivery on maternal request(CDMR) among multiparous women who delivered a full-term singleton in Southern China during 1993-2005.The Perinatal Healthcare Surveillance System was established in 21 cities/ counties of 2 Chinese Southern provinces since 1993. A total of 191 058 multiparous women were monitored during 1993-2005. Chi-square tests were performed to assess the linear trends in the prevalence of cesarean delivery and CDMR.During the 13-years period, 56 968 cesarean deliveries and 10 134 CDMRs were identified. The prevalence rates of cesarean delivery during 1993-1995, 1996-2000 and 2001-2005 were 13.1%, 28.3% and 50.4%( χ(2)trend=17 829.0,P0.001 ); the prevalence rates of CDMR were 0.6%, 3.8%, and 12.9%(χ(2)trend=7 729.0,P0.001). The cesarean delivery rate during 2001-2005 were 97.5% for women with previous cesarean section and 40.3% for women without previous cesarean section; the CDMR rate of women without previous cesarean section was 14.4%, accounting for 35.9% of the primary cesarean deliveries.The prevalence rates of cesarean delivery and CDMR among multiparous women in Southern China increased dramatically during 1993-2005; CDMR was a non-negligible component of the primary cesarean deliveries for multiparous women.

To explore the secular trends of cesarean delivery and cesarean delivery on maternal request (CDMR) among primiparous women with singleton pregnancy in Southern and Northern China.The Perinatal Healthcare Surveillance System was established in 26 counties/cities of 3 Chinese provinces since 1993. A total of 1 317 774 primiparous women with singleton pregnancy were monitored through the system during the 1993 - 2010 period. Chi-square tests were performed to assess the linear trends in the prevalence of cesarean delivery and CDMR.During the 18-year period, 496 054 cesarean deliveries and 129 219 CDMRs were identified. The prevalence rates of cesarean delivery and CDMR were 37.6% and 10.0% respectively. CDMR accounted for 26.0% of all cesarean births. The prevalence of cesarean delivery increased from 29.4% during the 1993 - 1995 period to 58.7% during the 2006 - 2010 in Southern urban area, from 18.2% to 58.3% in Southern rural area and from 4.3% to 49.5% in Northern rural area. The prevalence of CDMR increased by 34 folds from 0.6% during the 1993 - 1995 period to 21.3% during the 2006 - 2010 period in Southern urban area, by 40 folds from 0.6% to 24.4% in Southern rural area and by 44 folds from 0.6% to 27.3% in Northern rural area. The proportions of CDMR in all cesarean deliveries significantly increased in all three regions. Women aged over 30 years, overweight and well-educated were more likely to experience a cesarean delivery including CDMR.The Chinese prevalence rates of cesarean delivery and CDMR increased dramatically during the 1993 - 2010 period and ranked the highest in the world by 2010. And CDMR became a non-negligible component in all cesarean sections.

To examine the impact of pregnancy termination before 28 weeks of gestation on the overall prevalence of neural tube defects (NTDs).Data collected during the period of 2004 and 2010 from a birth defects surveillance system in Pingding county and Taigu county of Shanxi province were used. Number of births≥28 weeks of gestation and number of cases with major birth defects among the births were collected. Terminations of pregnancies before 28 weeks of gestation due to prenatal diagnosis were also collected. The total prevalence of neural tube defects, prevalence before 28 weeks of gestation, and prevalence of ≥28 weeks gestation were calculated using the total number of pregnancies of ≥28 weeks of gestation as denominator. The prevalence data were compared to examine the impact of pregnancy termination on the total prevalence. The proportions of pregnancy terminations before 28 weeks of gestation due to prenatal diagnosis of an NTD against the total number of NTD cases were also calculated.During 2004-2010, 52 366 births were recorded, and 485 NTD cases were ascertained. The overall prevalence of NTDs was 92.6 per 10,000 births, with prevalence of28 weeks gestation due to pregnancy terminations as 60.9 per 10,000 births, while the prevalence of ≥28 weeks of gestation was 31.7 per 10,000 births. NTD prevalence of ≥28 weeks gestation was 66.0% lower than the total NTD prevalence. In the last two years, the proportion of NTDs ascertained ≥28 weeks gestation accounted for about 40.0% of the total NTD cases.A birth-defect-surveillance program that covered only pregnancies≥28 weeks of gestation resulted in a severe underestimation of the total birth prevalence of NTDs, especially for anencephaly. We would recommend that the current national birth defects surveillance system should include pregnancy terminations before 28 weeks of gestation and the calculation of total NTD prevalence should also include these cases into the numerator, so as to better estimate true population NTD prevalence, upon which the related public health policy is based.

Maternal exposure to nitrate, nitrite, and N-nitroso compounds from drinking water or diet has been associated with an increased risk of neural tube defects (NTDs) in some studies. Pickled vegetables contain relatively large amounts of nitrite and N-nitroso compounds. We examined the association between maternal periconceptional consumption of pickled vegetables and NTDs in Shanxi Province of northern China.Data were derived from a population based case-control study of major external birth defects in four counties of Shanxi Province. Participants included 519 NTDs cases identified between 2003 and 2007 and 694 healthy controls. Exposure information was collected within 1 week after delivery. Multivariable non-conditional Logistic regression model was used to estimate the adjusted odds ratio (OR) controlling for potential confounding variables.The risk of NTDs was positively associated with the frequency of the consumption of pickled vegetables by the mother. Compared with pickled vegetables consumption at1 meal/week, the adjusted OR for consumption at 1 - 3, 4 - 6, and6 meals/week were 1.3 (95% confidence interval (CI): 1.0, 1.8), 1.9 (1.1, 3.2), and 3.6 (1.9, 6.9), respectively. A protective effect was found for maternal meat consumption at ≥ 1 meal/week (adjusted OR: 0.6, 95%CI: 0.4, 0.7) and egg or milk consumption at ≥ 1 meal/week (adjusted OR: 0.6, 95%CI: 0.4, 0.8).Maternal periconceptional consumption of pickled vegetables may increase the risk for NTDs in Shanxi Province.

In this article, we presented the rationale and calculation procedures of a propensity score weighting method, with its application in epidemiological studies. The rationale for propensity score weighting method is similar to those for traditional standardization methods. Propensity score is used to estimate the weight for each individual. As the propensity score serves the function of observed covariates, the propensity score weighting can balance the distribution of the observed covariates between the comparison groups. There are two weighting methods according to the target standard populations: the Inverse probability of treatment weighting (IPTW) and the Standardized mortality ratio weighting (SMRW). Results of the example show that the distribution of the covariates tended to be consistent after weighting, and the IPTW and SMRW methods showed similar effect estimates. Propensity score weighting method can effectively balance the distribution of the confounding factors between the compared groups in non-randomized controlled trials.

To understand the distribution of birth weight among premature infants and the associated social factors.The study population consisted of 97 537 women who delivered singleton live birth of 20 to 41 gestational weeks in 4 counties/cities, Jiangsu and Zhejiang provinces, China from 1995 to 2000. Chi-square test was employed to test the difference of proportions between respective groups. One- way ANOVA was used to test the differences regarding the mean of gestational weeks at the first prenatal visit and the mean of prenatal visits between the two groups. Multivariate logistic regression was conducted to examine the factors associated with premature birth.Women aged 35 years had higher (8.8%) premature incidence than those aged less than 24 years (5.6%), 25 - 29 years (4.6%), or 30 - 34 years (4.5%, P0.001). Women with height less than 149 cm had higher (6.8%) premature incidence than those with height taller than 150 cm (5.0%). Women whose BMI were at least 28 and 24 - 28 had higher (5.5%, 5.5%) premature incidences than those whose BMI were 18.5 - 24.0 (5.0%),18.5 (4.6%, P0.001). The incidence of premature birth was 6.0% among women without previous pregnancy, higher than that among those women with 4 times of pregnancies (5.7%), 2 times of pregnancies (4.3%), and 3 times of pregnancies (4.0%). Parous women with at least two deliveries had higher (9.3%) premature incidence than the primiparous women (5.2%) and whose women with only one delivery (4.5%, P0.001). Women who received early prenatal care had lower 4.7% premature incidence than those who did not receive the service (6.1%). The mean times of prenatal visits among women with premature births was 8.53, less than that of those with full term delivery (10.97). Women with less than four times of prenatal visit had higher (18.9%) premature incidence than those with at least five prenatal visits (4.9%). Multivariate logistic regression showed that premature delivery risk was associated with age, height, BMI, gravidity, parity, early prenatal care, the mean of gestational weeks at first prenatal visit and the mean number of prenatal visits etc.Premature delivery risk was associated with factors as age, height, BMI, gravidity, parity, early prenatal care, the mean of gestational weeks at first prenatal visit, the mean number of prenatal visits etc.

To explore the relationship between maternal passive smoking during early pregnancy and the risk of neural tube defects (NTDs).Data was derived from a population-based case-control study on birth defects in Shanxi province. The study subjects included 515 NTDs defects cases (236 cases of anencephaly, 237 spina bifida and 42 encephalocele) ascertained during January 2003 and June 2007 in the study areas and 682 normal controls randomly selected in the same residence during the same period as cases. RESULTS; The risk of NTDs in their offspring was 1.84 (95% CI: 1.39-2.44) for mothers with passive smoking history during peri-conceptional period. There was a marked dose-response relation between maternal passive smoking and the risk of NTDs in offspring. Compared to the women without passive smoking, the NTDs risk in offspring was 1.51 for women with occasional passive smoking and 2.44 for women with passive smoking for almost everyday during the peri-conceptional period.Maternal passive smoking during peri-conceptional period increased the risk of NTDs in offspring.

Dietary factors that could potentially be related to the risk of birth defects are still unknown in Shanxi province, a region with high prevalence of neural tube defects(NTDs) in China. The main aim of this study was to evaluate the association between NTDs and local dietary factors.A population-based case-control study was conducted during 2003-2005 in four selected counties of Shanxi province with 363 NTDs cases ascertained and 523 control babies without any external birth defects.By multivariate logistic regression analysis, we found the NTDs risk was significantly associated with low consumption of meat and legume, high consumption of pickled vegetables, noncentralized supply of drinking water and drinking tea after adjusting for maternal education level and birth defects history. A significant dose response trend was found between the NTDs risk and the lower frequencies of meat and legume consumption and higher frequency of pickled vegetable consumption, with population attributable risks (PAR) of 69.4%, 22.0% and 18.5%, respectively. Mothers who got their drinking water from river or pond during periconceptional period were more likely to have a NTD-affected pregnancy [OR = 3.42, 95% CI: 1.44-8.09, population attributable risk (PAR) = 4.7%] compared with those who utilized tap or well water. Those who drank tea everyday had an elevated risk of having a NTD-affected pregnancy compared with those who didn't (OR = 4.65, 95% CI: 1.41-15.36, PAR = 2.6%).Higher intake of meat and legume protects a woman from having a NTD-affected pregnancy, and consumption of pickled vegetables, drinking water from river or pond and drinking tea everyday increase the risk of having such a pregnancy in the study population.

To compare plasma and red blood cell folate levels among women in their first trimester of pregnancy from rural areas with high or low prevalence of neural tube defects.A cross-sectional study was performed, among women in their first trimester of pregnancy from rural areas with high or low prevalence of neural tube defects in 2003. Non-fasting blood sample were collected and analyzed for plasma and red blood cell folate concentrations for 688 women.The median plasma (10.53 nmol/L) and red blood cell folate (389.2 nmol/L) among women from the high prevalence rural area were lower than those of women from the low prevalence rural area (plasma folate: 30.39 nmol/L, red blood cell level folate: 926.0 nmol/L). Among women from the high prevalence area, about 50% and 43% were respectively, deficient for plasma and red blood cell folate, compared with 6% and 4% respectively, for women from the low prevalence area. The median plasma folate levels among women who took periconceptional folic acid supplements in both high and low prevalence areas were about twice higher than those who did not take the folic acid. The median red blood cell folate level of the folic acid users was 40% higher than those of the non-users. Among those who took folic acid, women in the low prevalence area had 70%-90% higher plasma folate concentration and twice higher red cell folate concentration than women in the high prevalence area.Women from the rural area with a high prevalence of neural tube defects had low plasma and red blood cell folate levels. Periconceptional supplementation with folic acid could substantially improve folate status of reproductive-aged women. However, supplementation with 0.4 mg of folic acid per day might be inadequate for women in the high prevalence rural area.

To investigate the clinical characteristics and GCH I gene mutations in patients with dopa-responsive dystonia (DRD).The clinical features of 3 families with 6 affected members and 8 sporadic cases were analyzed to determine the clinical characteristics, and 2 families with 4 affected members and 2 sporadic cases were screened for mutations of the GCH I gene.Age at onset was (10 +/- 3) years. Onset occurred earlier in female (9 +/- 4) years than in male (12 +/- 1) years. The initial symptom was a gait disorder, dystonia or tremor in most patients and nine patients (64%) presented with diurnal fluctuation. Thirteen patients (93%) were cured and one was improved after administration of low doses of levodopa for 3 months and no long-term side effects of levodopa had occurred. Two independent mutations were found in three patients. Gln161Pro, a new missense mutation, was found in a sporadic case, leading to a relatively severe phenotype. The two patients with mild phenotype in one family were found to have Lys224Arg mutation, as previously described.DRD patients have diverse phenotypes and diurnal fluctuation is an important feature. They have dramatic and sustained response to levodopa. There may be a correlation between genotype and phenotype. The detection of GCH I mutations is helpful in early diagnosis of non-typical cases.

To evaluate the reliability of the birth defects surveillance system in four counties with high prevalence of birth defects (Pingding, Xiyang, Taigu and Zezhou counties) in Shanxi province, China.One township was selected from each county as study site. The health workers chosen from township or village level were trained to visit families on the outcomes of each pregnancy who gave birth during year 2003 in the study site. The number of births and cases collected in the study were compared with that from the surveillance system. The number of births reported by surveillance system in four counties was also compared with the data from the local government. The criteria of evaluation were: 1) number of the missing report of births shouldor = 5%, 2) the number of missing report on major external birth defects cases shouldor = 10%. Researchers from the Peking University were responsible for examining the quality of surveillance in some terminal units of surveillance system.The numbers of births reported in the study and from the surveillance system for four-township were 1043 and 997, respectively. 46 births were missing and the rate of misreporting for births was 4.4%. The numbers of birth defects cases reported in the study and from the surveillance system were 30 and 29, respectively. 1 case of birth defect as missed, and rate of misreporting for birth defects cases was 3.3%. The total number of births reported from surveillance was similar to that in the study in four counties, with a difference of 1.2%. Birth registry data was rather readable and special health workers responsible for surveillance work were present in all the terminal units of the surveillance system.The misreporting of births and cases existed in the birth defects surveillance system of the four counties in Shanxi province, but were lower than the allowable criteria. The surveillance units had better registration, reporting and administration of births and birth defect cases. Hence, the quality of the data from the surveillance system in these four counties was reliable.

To understand the nitrate and nitrite contents of drinking water in Shanxi Province, China.Water samples were collected from Pingding and Taigu counties and Taiyuan City. The nitrate and nitrite contents were determined following the 'Drinking water hygienic standard-2001'.The median nitrate content of drinking water was 3.5 mg/L, and the proportion of samples above national hygienic standard for drinking water was 4.0% in study areas. The median nitrite content of well water samples(5.l mg/L) was higher than that of tape water (2.7 mg/L). The median content of nitrite was 0.004 mg/L for all samples, and the median content of spring water was highest (0.017 mg/L) than that of other sources. Conclusion The contents of nitrate and nitrite in drinking water were similar to that reported form other regions. Maternal nitrate exposure from drinking water may not be among the important risk factors of high prevalence of birth defects in Shanxi Province.

To study the association between reduced folate carrier gene (RFC1 A80G) polymorphism and the risk for child with neural tube defects (NTDs), and to provide epidemiological evidence for the existence of NTDs genetic marker.RFC1 (A80G) genotypes were detected using RFLP-PCR for blood DNA of 104 families with NTDs-affected children and 100 control families with no history of child-affected birth defects. Case-control study and transmission/disequilibrium test(TDT) for the RFC1 genotype of NTDs pedigree were carried out.The G allele frequency of children with NTDs was higher than that of controls when compared to A allele( OR = 1. 64, 95% CI :1.08-2.49). The offspring of the GG genotype were associated with a 2.56-fold increased risk of NTDs when compared to the AA genotype (OR = 2.56, 95% CI: 1.04-6.36) in our study population. There was evidence of association between G allele and the risk of parent having a child with NTDs (OR = 1.56, 95% CI: 1.07-2.28) in the TDT analysis.Our findings indicated that there was potential association between offspring RFC1 GG genotype and the risk of NTDs, and the G allele was a possible susceptible gene marker for an increased NTDs risk in the Chinese population.

To study the reduced folate carrier gene (RFC1) A80G polymorphism and other factors influence on children with neural tube defects (NTDs) and provide the epidemiological evidence for finding genetic marker of NTDs.RFC1(A80G) genotypes were detected using polymerase chain reaction-restriction fragment length polymorphism (RFLP-PCR) for blood DNA of 104 trios with NTDs-affected by child, and the 100 control families without child-affected by any birth defects. We performed the analysis of multifactors logistic regression for RFC1 genotypes and other factors in order to investigate the RFC1 genotype of the nuclear families and maternal periconceptional folic acid supplementation influence on NTDs independently. Transmission/disequilibrium test (TDT) for the RFC1 genotype of NTDs and control pedigree were carried out.The RFC1 G allele frequency of children with NTDs (64.42%) was higher than that of the control children (52.53%), and there was the significant difference between them (chi(2)=5.9198, P0.05). We observed that the infants of the GG genotype were associated with a 2.56-fold increased risk of NTDs when compared with the AA genotype (95% CI=1.04-6.36), The risk of mothers who did not take folic acid for having an NTDs-affected infants was 7.69 (95% CI=2.86-21.75). There were significant differences between cases and controls in the other risk factors, such as paternal age (or =30), maternal fever during the early pregnancy, the history of maternal spontaneous abortion. In the logistic regression analysis, of multifactors the three factors, for example, the offspring of the RFC1 GG genotype (OR=2.91, 95% CI=1.35-6.30), maternal periconceptional folic acid supplementation (OR=4.32, 95% CI=1.62-11.55), maternal fever during the early pregnancy, had the statistic significance for the risk of NTDs. There was the evidence of an association between G allele and the risk of the maternal having a child with NTDs (OR=1.56, 95% CI=1.07-2.28) in TDT analysis.Our findings indicate that the RFC1 genotype (GG) is a possible susceptible gene marker for an increased NTDs risk in this Chinese population, and there is a potential influence on the risk of NTDs in maternal periconceptional folic acid supplementation, and maternal fever during the early pregnancy.

To search the interaction between reduced folate carrier gene (RFC1 A80G) polymorphism of children with neural tube defects (NTDs) and maternal periconceptional no supplementation of folic acid. The purpose is to provide the epidemiological evidence for finding genetic marker of NTDs.RFC1 (A80G) genotype was detected using PCR-restricted fragment length polymorphism for the blood DNA of 104 trios with NTDs-affected child, and 100 control families with non-malformed control children. The authors investigated the gene-environment interactions between the offspring RFC1 genotype and maternal periconceptional folic acid supplementation through a case-control study.It was observed that the offspring with the GG genotype were associated with a 2.56-fold increased risk of NTDs when compared to those with the AA genotype (OR = 2.56; 95% CI = 1.04-6.36) in this population under investigation. The risk of mothers who did not take folic acid for having an NTDs-affected infants was 7.69 (95% CI = 2.86-21.75). Among the mothers who did not utilize folic acid supplements, the NTDs risk was 3.30 (95% CI = 1.15-9.65) for offspring with the GG genotype, compared to the reference (AA) genotype. Children who had the GG genotype and whose mothers did not take folic acid had an elevated risk for NTDs (OR = 8.80, 95% CI = 2.86 - 29.82), compared to "offspring with AA or GA genotype" and "maternal folic acid use", the interactive coefficient being 1.45.The above findings indicate that the RFC1 genotype (GG) is a possible susceptible gene marker for an increased NTDs risk in Chinese population, and there is a potential gene-nutrient interaction between offspring RFC1 GG genotype and maternal periconceptional intake of folic acid on the risk of NTDs. However,the sample size of this study was limited, a larger sample of population-based study is required to pursue the initial observation.

To study the prevalence rates of birth defects in high and low risk areas in China.A population-based surveillance system on birth defects was used to obtain the prevalence rates of 24 kinds of major external birth defects fromor = 20 weeks of gestation to 7 days of life in selected areas in Shanxi and Jiangsu provinces.The birth prevalence of birth defects (232.4 per 10,000 births) and neural tube defects (NTDs) (138.7 per 10,000 births) in four counties of Shanxi province were significantly higher than that in Taiyuan city (75.3 and 28.2 per 10,000 births, respectively). There was no significant difference for all selected birth defects between Wuxi city and Xishan counties in low risk areas. There was a 6.1-fold of higher prevalence for NTDs in Taiyuan city compared with that in Wuxi areas (4.6 per 10,000 births). In four counties of Shanxi province, the prevalence rates of anencephaly, spina bifida, hydrocephaly, cleft palate alone and polydactyly were significantly higher than in Wuxi areas. The NTDs prevalence rate in four counties of Shanxi was 30.2 times higher than in Wuxi areas. When compared with previous surveillance data, the NTDs prevalence rate did not present obvious declining trend in high risk areas. The birth prevalence rate had a 31.8% decrease when births were calculated after 28 gestational weeks and compared with those from 20 gestational weeks.NTDs remained to be the most common birth defect seen in Shanxi province. The birth prevalence rate of NTDs in some areas of Shanxi province was among the highest that ever reported in the world in comparison with data from other countries and regions. The current prevalence rate in high risk areas in Shanxi province did not clearly show a declining trend. Programs on surveillance and prenatal diagnosis were proved to have made big impact on the rates of major external birth defects.