Search

Liver transplantation is the optimal treatment for patients with end-stage liver disease, metabolic liver diseases, and hepatic malignancies that are not amenable to resection. Hepatic ischemia-reperfusion injury (IRI) is the main problem in liver transplantation and liver resection, leading to parenchymal cell injury and organ dysfunction. The damage of liver sinusoidal endothelial cells (LSECs) is a critical event in IRI. LSECs work as an important regulating factor of liver regeneration after partial hepatectomy. This review primarily describes the mechanisms of LSECs injury in IRI and explores the roles of LSECs in liver regeneration, and briefly introduces the protective strategies targeting LSECs damaged in IRI.

Conjugation of the small ubiquitin-like modifier (SUMO) peptide to target proteins is an important post-translational modification. SAP AND MIZ1 DOMAIN-CONTAINING LIGASE1 (MdSIZ1) is an apple (Malus domestica Borkh). SUMO E3 ligase that mediates sumoylation of its targets during plant growth and development under adverse environmental conditions. However, it is unclear how MdSIZ1 senses the various environmental signals and whether sumoylation is regulated at the transcriptional level. In this study, we analyzed the MdSIZ1 promoter and found that it contained an MYB binding site (MBS) motif that was essential for the response of MdSIZ1 to low temperature (LT) and drought. Subsequently, we used yeast one-hybridization screening to demonstrate that a MYB transcription factor, MdMYB2, directly bound to the MBS motif in the MdSIZ1 promoter. Phenotypic characterization of MdMYB2 and MdSIZ1 suggested that the expression of both MdMYB2 and MdSIZ1 substantially improved cold tolerance in plants. MdMYB2 was induced by LT and further activated the expression of MdSIZ1, thereby promoting the sumoylation of MdMYB1, a key regulator of anthocyanin biosynthesis in apple. MdMYB2 promoted anthocyanin accumulation in apple fruits, apple calli, and Arabidopsis (Arabidopsis thaliana) in an MdSIZ1-dependent manner. In addition, the interaction of MdMYB2 and the MdSIZ1 promoter substantially improved plant tolerance to cold stress. Taken together, our findings reveal an important role for transcriptional regulation of sumoylation and provide insights into plant anthocyanin biosynthesis regulation mechanisms and stress response.

The establishment of reliable age in the lake sediment profile mainly depends on the AMS 14C dating technique. However, the presence of the 14C lake reservoir effects (LREs) restricted for using radiocarbon dating in lake sediment, especially in dry and cold areas with a scarce plant cover in the Qinghai-Tibet Plateau. Hence, the discussion of influence factors of LREs is crucial. This paper selected 15 lakes (17 sediment and 3 plant samples) in the Qinghai-Tibet Plateau to examine the distribution characteristics of the modern LREs and their main influencing factors. In our study area, 14 lakes were all affected by the LREs. The minimum 14C year is 5900 a BP towards the deep water area, whereas the maximum 14C year is up to 7185 a BP in the margins of Lake Heihai. The maximum 14C year is up to 7750 a BP, and the minimum 14C year is present-day carbon in the 15 lakes. One further study indicated that the LRE differences in individual lake are mostly owing to the contribution of exogenous carbonate. The results displayed that the LREs tended to increase with the increase of the salinity, moreover, the LREs of saltwater lakes or salt lakes were significantly larger than freshwater lakes due to the possible supply of old total dissolved inorganic carbon with a long residence time in the lakes. Moreover, the contribution of calcite played a significant role on the LREs. Additionally, the LREs differences are affected by the source of organic matter. The lake with groundwater supply shows large LRE due to likely being influenced by crustal and ancient CO2 uprising.

Research has shown that long-chain noncoding RNAs (lncRNAs) are involved in the regulation of a variety of biological processes, including peripheral nerve regeneration, in part by acting as competing endogenous RNAs. c-Jun plays a key role in the repair of peripheral nerve injury. However, the precise underlying mechanism of c-Jun remains unclear. In this study, we performed microarray and bioinformatics analysis of mouse crush-injured sciatic nerves and found that the lncRNA Pvt1 was overexpressed in Schwann cells after peripheral nerve injury. Mechanistic studies revealed that Pvt1 increased c-Jun expression through sponging miRNA-214. We overexpressed Pvt1 in Schwann cells cultured in vitro and found that the proliferation and migration of Schwann cells were enhanced, and overexpression of miRNA-214 counteracted the effects of Pvt1 overexpression on Schwann cell proliferation and migration. We conducted in vivo analyses and injected Schwann cells overexpressing Pvt1 into injured sciatic nerves of mice. Schwann cells overexpressing Pvt1 enhanced the regeneration of injured sciatic nerves following peripheral nerve injury and the locomotor function of mice was improved. Our findings reveal the role of lncRNAs in the repair of peripheral nerve injury and highlight lncRNA Pvt1 as a novel potential treatment target for peripheral nerve injury.

Cesarean delivery vs vaginal delivery was reported to increase the risks of childhood obesity, pneumonia, anemia, and neurobehavioral disorders, but few studies were able to deal with the confounding biases associated with medical conditions indicating cesareans. This prospective cohort study aims to investigate the associations of non-medically indicated cesarean delivery on maternal request (CDMR) with these child health outcomes.Among 17 748 liveborn infants whose mothers (primiparas) participated in a randomized controlled trial on micronutrient supplementation and pregnancy outcomes during 2006-2009 in 5 rural counties in Hebei Province, China, 6972 singletons born by full-term spontaneous vaginal delivery (SVD) and 3626 by CDMR were extracted for the assessments of obesity (weight-for-height z-score3) and pneumonia (self-reported) at 1.5-5 years in 2011. Some children were further randomly selected from these two groups for the assessments of anemia (hemoglobin110 g/L, 2341 SVD and 2417 CDMR) and neurobehavioral disorders (raw score of Child Behavior Checklist larger than the 90th percentile of the normative sample, 1257 SVD and 1060 CDMR).Compared with SVD, CDMR was associated with increased risks of obesity (adjusted odds ratio (aOR) = 1.41, 95% confidence interval (CI) = 1.14-1.75,Cesarean delivery, independent of cesarean indications, is likely associated with childhood obesity and anemia, indicating a need to keep pregnant women informed, especially those seeking CDMR, a need to explore possible improvement on obstetric service, and even a need for main stakeholders to reach a compromise in making a cesarean decision.ClinicalTrials.gov: NCT00133744 and NCT01404416.

Tumour budding (TB) activity, cell nest size (CNS), and desmoplastic reaction (DR) have been confirmed to be significantly correlated with prognosis in oesophageal squamous cell cancer (ESCC) recently. However, there are limited data on the prognostic significance of combined assessment of cellular dissociation and tumour stroma in ESCC.In all, 265 cases with resected ESCCs diagnosed between January 2018 and August 2019 were retrospectively reviewed. All slides were reviewed for assessing TB, CNS, and DR. The Cellular Dissociation Grading and our Combined CNS and DR (CNS/DR) Grading systems were adopted to re-grade ESCCs.High TB activity, small CNS, and immature DR had a strong association with shorter overall survival (OS) and progression-free survival (PFS) (P 0.001, respectively) in ESCC. Combined assessment of CNS and DR in a 4-tiered grading system displayed a prognostic excellence for survival (P 0.001), and outperformed the Cellular Dissociation Grading for both OS (area under the curve [AUC], 0.728 versus 0.644, P = 0.043) and PFS (AUC, 0.763 versus 0.667, P = 0.018) by receiver operator characteristic curves. Also, Combined CNS/DR Grading showed superiority in recognizing a G4 subgroup with the worst outcome in our cohort, to whom the most urgent attention needs to be called.This is the first study to propose a novel Combined Grading system based on CNS and DR in ESCC, which has been demonstrated to be relatively superior to Cellular Dissociation Grading in predicting prognosis. The findings shed new light on the histopathological grading of ESCC and facilitates identifying biologically aggressive ESCCs.

Human health has been severely affected by infections resulting from multidrug-resistant (MDR) gram-negative bacteria (GNB). Monobactam antibiotics are known to be effective against such infections. This study aimed to construct a predictive two-dimensional quantitative structure-activity relationship (2D-QSAR) model for the rational design of new monobactams based on the 65 known monobactams against Escherichia coli (Eco) and Klebsiella pneumonia (Kpn) strains using the kernel partial least squares regression (KPLS) algorithm. The total performance of Eco and Kpn KPLS modes was shown as RMSE: 0.681/0.596, R2: 0.946/0.882, Q2: 0.922/0.877, and RMSU: 0.625/0.593. Thirty-four monobactams reported in our lab were chosen as external data to predict their activities against Eco and Kpn using the newly established models, by which the R2 between the experimental and predicted values was 0.878 and 0.871, respectively. The models developed and verified in this study provide a powerful design strategy for novel monobactams that are effective against MDR gram-negative bacterial infections.

Proton conductivity of proton exchange membranes (PEMs) strongly relies on microscopic morphology, which can be modulated by engineering the distribution of ionic groups. Herein, poly(arylene ether)s with densely distributed allyl functionalities are polymerized from a tetra-allyl bisphenol A monomer. The subsequent thiol-ene addition with sodium 3-mercapto-1-propanesulfonate yields comb-shaped sulfonated fluorinated poly(arylene ether)s (SFPAEs) with ion exchange capacities (IECs) ranging from 1.29 mmol·g−1 to 1.78 mmol·g−1. These SFPAEs exhibit superior proton conductivity over the whole temperature range, which is attributed to the enhanced hydrophilic/hydrophobic phase separation as evidenced by small angle X-ray scattering characterizations. The SFPAE-4-40 with an IEC of 1.78 mmol·g−1 shows the largest proton conductivity of 93 mS·cm−1 at room temperature under fully hydrated condition, higher than that of Nafion 212. Furthermore, the vanadium redox flow battery (VRFB) assembled with SFPAE-4-40 separator exhibits higher energy efficiency than the VRFB assembled with Nafion 212.

Objective:To explore whether and how group cognitive-behavioural therapy (GCBT) plus medication differs from medication alone for the treatment of generalised anxiety disorder (GAD).Methods:Hundred and seventy patients were randomly assigned to the GCBT plus duloxetine (n=89) or duloxetine group (n=81). The primary outcomes were Hamilton Anxiety Scale (HAMA) response and remission rates. The explorative secondary measures included score reductions from baseline in the HAMA total, psychic, and somatic anxiety subscales (HAMA-PA, HAMA-SA), the Hamilton Depression Scale, the Severity Subscale of Clinical Global Impression Scale, Global Assessment of Functioning, and the 12-item Short-Form Health Survey. Assessments were conducted at baseline, 4-week, 8-week, and 3-month follow-up.Results:At 4 weeks, HAMA response (GCBT group 57.0% vs. control group 24.4%,p=0.000, Cohen’sd=0.90) and remission rates (GCBT group 21.5% vs. control group 6.2%,p=0.004;d=0.51), and most secondary outcomes (allpd=0.36−0.77) showed that the combined therapy was superior. At 8 weeks, all the primary and secondary significant differences found at 4 weeks were maintained with smaller effect sizes (pd=0.32−0.48). At 3-month follow-up, the combined therapy was only significantly superior in the HAMA total (pd=0.43) and HAMA-PA score reductions (pd=0.77). Logistic regression showed superiority of the combined therapy for HAMA response rates [odds ratio (OR)=2.12, 95% confidence interval (CI) 1.02−4.42,p=0.04] and remission rates (OR=2.80, 95% CI 1.27−6.16,p=0.01).Conclusions:Compared with duloxetine alone, GCBT plus duloxetine showed significant treatment response for GAD over a shorter period of time, particularly for psychic anxiety symptoms, which may suggest that GCBT was effective in changing cognitive style.

Enzymes are very important for biological processes in a living being, performing similar or multiple tasks in and out of cells, tissues and other organisms at a particular location. The abnormal activity of particular enzyme usually caused serious diseases such as Alzheimer’s disease, Parkinson’s disease, cancers, diabetes, cardiovascular diseases, arthritis etc. Hence, nondestructive and real-time visualization for certain enzyme is very important for understanding the biological issues, as well as the drug administration and drug metabolism. Fluorescent cellular probe-based enzyme detection in vitro and in vivo has become broad interest for human disease diagnostics and therapeutics. This review highlights the recent findings and designs of highly sensitive and selective fluorescent cellular probes targeting enzymes for quantitative analysis and bioimaging.

This study aimed to explore the association of tumor sidedness with the prognosis of patients with colon signet ring cell carcinoma (SRCC). Eligible patients were retrieved from the Surveillance, Epidemiology, and End Results database between 2004 and 2015. Cancer-specific survival (CSS) and overall survival (OS) were compared between patients with left-sided colon SRCC and those with right-sided lesions. A total of 2660 patients were included, among them, 1983 (74.5%) had right-sided colon SRCC. Compared to patients with left-sided colon SRCC, those who had the right-sided colon SRCC showed higher proportion of white race, female, aged ≥ 65 years, receiving total colectomy and ≥ 4 regional lymph node dissection; while had lower proportion of advanced AJCC stage. Besides, right-sided patients exhibited superior 5-year CSS (32.74% vs. 25.89%, P = 0.001) and OS (27.38% vs. 23.02%, P = 0.024) rates compared with left-sided ones. Multivariate analysis revealed that tumor sidedness was an independent prognostic factor. To be specific, patients with right-sided colon SRCC showed better CSS (HR: 0.873; 95% CI 0.777–0.981; P = 0.023) and OS (HR: 0.838; 95% CI 0.753–0.965; P = 0.002). Moreover, subgroup analysis demonstrated superior CSS and OS for right-sided patients in most subgroups. Tumor sidedness was an independent prognostic indicator for colon SRCC. Besides, patients with right-sided colon SRCC have superior prognosis than those with left-sided lesions.

The aim of the present study was to explore the antitumor effects of sinoporphyrin sodium (DVDMS)-mediated photodynamic therapy (PDT) and sonodynamic therapy (SDT) in glioma, and to reveal the underlying mechanisms. The uptake of DVDMS by U-118 MG cells was detected by flow cytometry (FCM). A 630-nm semiconductor laser and 1-MHz ultrasound were used to perform PDT and SDT, respectively. Cell proliferation and apoptosis were evaluated using the Cell Counting Kit-8 assay, FCM and Hoechst 33258 staining, respectively. Western blot analysis was used to detect protein expression and phosphorylation levels. BALB/c nude mice were used to establish a xenograft model of U-118 MG cells. DVDMS was injected intravenously and PDT and SDT were performed 24 h later. An in vivo imaging system was used to evaluate the fluorescence of DVDMS, to measure tumor sizes, and to evaluate the therapeutic effects. The uptake of DVDMS by U-118 MG cells was optimal after 4 h. PDT and SDT following DVDMS injection significantly inhibited the proliferation and increased apoptosis of glioma cells in vitro (P

Bimetallic nanomaterials, which exhibit a combination of the properties associated with two different metals, have enabled innovative applications in nanoscience and nanotechnology. Here, we introduce the fabrication of dendritic Au/Ag bimetallic nanostructures for surface-enhanced Raman scattering (SERS) and catalytic applications. The dendritic Au/Ag bimetallic nanostructures were prepared by combining the electrochemical deposition and replacement reaction. The formation of Au nanoparticle shell on the surface of Ag dendrites greatly improves the stability of dendritic nanostructures, followed by a significant SERS enhancement. In addition, these dendritic Au/Ag bimetallic nanostructures are extremely efficient in degrading 4-nitrophenol (4-NP) compared with the initial dendritic Ag nanostructures. These experimental results indicate the great potential of the dendritic Au/Ag bimetallic nanostructures for the development of excellent SERS substrate and highly efficient catalysts.

Massively parallel sequencing of forensic STRs simultaneously provides length-based genotypes and core repeat sequences as well as flanking sequence variations. Here, we report primer sequences and concentrations of a next-generation sequencing (NGS)-based in-house panel covering 28 autosomal STR loci (CSF1PO, D1GATA113, D1S1627, D1S1656, D1S1677, D2S441, D2S1776, D3S3053, D5S818, D6S474, D6S1017, D6S1043, D8S1179, D9S2157, D10S1435, D11S4463, D13S317, D14S1434, D16S539, D18S51, D18S853, D20S482, D20S1082, D22S1045, FGA, TH01, TPOX, and vWA) and the sex determinant locus Amelogenin. Preliminary evaluation experiments showed that the panel yielded intralocus- and interlocus-balanced sequencing data with a sensitivity as low as 62.5 pg input DNA. A total of 203 individuals from Yunnan Bai population were sequenced with this panel. Comparative forensic genetic analyses showed that sequence-based matching probability of this 29-plex panel reached 2.37 × 10-29 , which was 23 times lower than the length-based data. Compound stutter sequences of eight STRs were compared with parental alleles. For seven loci, repeat motif insertions or deletions occurred in the longest uninterrupted repeat sequences (LUS). However, LUS and non-LUS stutters co-existed in the locus D6S474 with different sequencing depth ratios. These results supplemented our current knowledge of forensic STR stutters, and provided a sound basis for DNA mixture deconvolution.

In the study, a tunable dual-band terahertz hybrid metamaterial absorber was designed and explored. The proposed hybrid metamaterial absorber was composed of an Au ring, an Au cross structure and vanadium dioxide (VO2) films incorporated at the four ends of the cross structure. Theoretical simulation results showed that the hybrid metamaterial exhibited dual-frequency resonances. The low-frequency resonance was ascribed to the ring, whereas the high-frequency resonance was ascribed to the cross structure. The resonant frequencies of the hybrid metamaterial absorber could be tuned by changing the effective length of electrically resonant cross structure through triggering the insulator–metal phase transition of the VO2 at the four ends of the cross structure.

The overall survival rate of patients with hepatocellular carcinoma (HCC) has remained unchanged over the last several decades. Therefore, novel drugs and therapies are required for HCC treatment. Isoliquiritigenin (ISL), a natural flavonoid predominantly isolated from the traditional Chinese medicine Glycyrrhizae Radix (Licorice), has a high anticancer potential and broad application value in various cancers. Here, we aimed to investigate the anticancer role of ISL in the HCC cell line Hep3B. Functional analysis revealed that ISL inhibited the proliferation of Hep3B cells by causing G1/S cell cycle arrest in vitro. Meanwhile, the inhibitory effect of ISL on proliferation was also observed in vivo. Further analysis revealed that ISL could suppress the migration and metastasis of Hep3B cells in vitro and in vivo. Mechanistic analysis revealed that ISL inhibited cyclin D1 and up-regulated the proteins P21, P27 that negatively regulate the cell cycle. Furthermore, ISL induced apoptosis while inhibiting cell cycle transition. In addition, phosphatidylinositol 3′-kinase/protein kinase B (PI3K/AKT) signal pathway was suppressed by ISL treatment, and the epithelial marker E-cadherin was up-regulated when the mesenchymal markers Vimentin and N-cadherin were down-regulated. In brief, our findings suggest that ISL could be a promising agent for preventing HCC tumorigenesis and metastasis.

Effective monitoring and assessment of geohazard risks to long-haul oil and gas pipelines is essential to reduce pipeline accidents and mitigate the resulting human casualties and economic losses. Oil and gas pipelines are often “accompanied” by telecommunications fiber-optic infrastructure deployed along them for communications purpose; the possibility of repurposing unused (so-called dark) fiber as distributed sensor arrays offers exciting opportunities for the development of pipeline risk monitoring systems. Here, we present a multiparameter approach to monitor pipeline geohazards using distributed fiber-optic sensing—including distributed strain, temperature, and acoustic sensing—deployed on telecommunications dark fiber network. Through a series of field experiments on a pipeline telecommunications cable crossing hilly terrain, we demonstrated the feasibility of using multiple cores of a single telecom cable to obtain multiparametric information on the strain, temperature, and vibration. The recorded strain signatures, temperature variations, and vibration signals can be indicative of various disastrous events during geohazards development, such as ground movement, soil erosion, oil and gas leakage, and rockfall. Additionally, we established a preliminary model that allows the synergistic use of the acquired multiparametric data. Overall, our results suggest that preexisting networks of fiber-optic telecommunications infrastructure accompanying pipelines could be leveraged as sensing resources to monitor geohazard risks to pipelines. Deeper fusion of multidimensional data and multiparametric information will enable intelligent monitoring, identification, and assessment of a wide range of pipeline threats.

Supplemental Digital Content is available in the text, Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each

// Ling Cao 1, * , Yong-Jing Yang 1, * , Jian-Dong Diao 2 , Xu-He Zhang 1 , Yan-Ling Liu 1 , Bo-Yu Wang 1 , Zhi-Wen Li 3 and Shi-Xin Liu 1 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun 130012, People’s Republic of China 2 Department of Oncology, China-Japan Friendship Hospital Affiliated Jilin University, Changchun 130012, People’s Republic of China 3 Department of Anesthesiology, The First Hospital of Jilin University, Changchun, Jilin, 130021, People’s Republic of China * These authors contributed equally to this work Correspondence to: Shi-Xin Liu, email: liushixin1964@sina.com Zhi-Wen Li, email: prince00111@hotmail.com Keywords: zoledronic acid, bone metastasis, dose interval, skeletal-related events, meta-analysis Received: April 21, 2017 Accepted: July 18, 2017 Published: August 03, 2017 ABSTRACT Zoledronic acid is used to treat patients with bone metastasis, but the optimal dosing interval remains controversial. We therefore performed a systematic review and meta-analysis to compare the efficacy and safety of a 12-week interval of zoledronic acid with the standard 4-week interval. Three randomized controlled trials comprising 2650 patients were analyzed. Using a random-effects model, pooled risk ratios (RRs) and 95% confidence intervals (CIs) were calculated. No differences in the occurrence of skeletal-related events (SREs: RR = 0.98; 95% CI = 0.86–1.12; P = 0.80) or grade 3/4 adverse events (RR = 0.91; 95% CI = 0.69–1.20; P = 0.52) were observed between the 12-week and 4-week groups. The 12-week group tended to have lower incidences of osteonecrosis of the jaw [13 (0.98%) vs. 23 (1.73%)] and kidney dysfunction [21 (1.68%) vs. 31 (2.45%)] than the 4-week group, though the difference did not reach statistical significance (RR = 0.58, 95% CI: 0.30–1.12; P = 0.11); (RR = 0.67, 95% CI: 0.39–1.15, P = 0.15). These data show that zoledronic acid administered at 12-week intervals instead of 4-week intervals does not increase the risk of SREs, and may reduce the incidence of osteonecrosis of the jaw and kidney dysfunction. This suggests the 12-week interval with zoledronic acid may be an acceptable treatment option.

In the pipeline construction, the girth welds tend to be the weakness because of defects and microstructural heterogeneities. The importance of suitable assessment of various defects in the weld is not only to prevent the cracks from unstable growth to cause catastrophic accident but also can effectively reduce the weld repair to reduce construction cost. Although many welding defects assessment methods and codes have been applied in this field, there are many differences among them. In this paper, the application of weld defect assessment methods was extensively studied. The key points of ECA applications, such as the pipeline axial stress and toughness, have been introduced. Furthermore, some suggestions were given on the application of girth weld ECA assessment.

// Ling Cao 1 , Yong-Jing Yang 1 , Zhi-Wen Li 2 , Hong-Fen Wu 1 , Zhu-Chun Yang 1 , Shi-Xin Liu 1 , Ping Wang 3 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun 130012, People’s Republic of China 2 Department of Anesthesiology, The First Hospital Affiliated to Jilin University, Changchun 130012, People’s Republic of China 3 Department of Radiotherapy, Cancer Institute and Hospital of Tianjin Medical University, Tianjin 300060, People’s Republic of China Correspondence to: Shi-Xin Liu, email: liushixin1964@sina.com Ping Wang, email: wangping.99999@yahoo.com.cn Keywords: prostatic neoplasms, hypofractionation, radiotherapy, meta-analysis Received: August 08, 2016 Accepted: November 24, 2016 Published: December 01, 2016 ABSTRACT To compare the efficacy and safety of moderate hypofractionated radiotherapy (H-RT) with those of conventional radiotherapy (C-RT) in patients with localized prostate cancer, we conducted extensive literature searches of The Web of Science, Embase, Pubmed and Cochrane Library databases. We identified nine studies with 5969 patients for a meta-analysis. We calculated pooled risk ratios (RRs) and the 95% confidence intervals (CIs) for multiple parameters and performed statistical analysis using RevMan 5.3 software. Our analysis showed that the H-RT group obtained greater improvements in the 5-year biochemical or clinical failure-free survival (RR = 1.04, 95% CI:1.01–1.08; P = 0.01) and 5-year disease-free survival(RR = 1.04, 95% CI: 1.01–1.07, P = 0.02) than the C-RT group. However, the 5-year overall survival rates were comparable in the two groups (RR = 1.02, 95% CI: 0.99–1.04; P = 0.18). Comparison of multiple secondary parameters, including grade 2-4 acute/late gastrointestinal toxicity, grade 2–4 acute/late genitourinary toxicity, biochemical failure, local failure, distant failure and prostate cancer-specific mortality between the H-RT and the C-RT groups showed no statistical differences. This meta-analysis thus indicates that in patients with localized prostate cancer, moderate H-RT exerts a great beneficial effect on the primary parameters than C-RT without enhancing adverse events.

Based on the structural characteristics of aztreonam (AZN) and its target PBP3, a series of new monobactam derivatives bearing various substituents on oxime residue were prepared and evaluated for their antibacterial activities against susceptible and resistant Gram-negative bacteria. Among them, compounds 8p and 8r displayed moderate potency with MIC values of 0.125–32 μg/mL against most tested Gram-negative strains, comparable to AZN. Meanwhile, the combination of 8p and 8r with avibactam as a β-lactamases inhibitor, in a ratio of 1:16, showed a promising synergistic effect against both ESBLs- and NDM-1-producing K. pneumoniae, with significantly reduced MIC values up to 8-fold and >256-fold respectively. Furthermore, both of them demonstrated excellent safety profiles both in vitro and in vivo. The results provided powerful information for further structural optimization of monobactam antibiotics to fight β-lactamase-producing resistant Gram-negative bacteria.

Nineteen new quinoline derivatives were prepared via the Mannich reaction and evaluated for their antibacterial activities against both Gram-positive (G+) and Gram-negative (G&minus, ) bacteria, taking compound 1 as the lead. Among the target compounds, quinolone coupled hybrid 5d exerted the potential effect against most of the tested G+ and G&minus, strains with MIC values of 0.125&ndash, 8 &mu, g/mL, much better than those of 1. Molecular-docking assay showed that compound 5d might target both bacterial LptA and Top IV proteins, thereby displaying a broad-spectrum antibacterial effect. This hybridization strategy was an efficient way to promote the antibacterial activity of this kind, and compound 5d was selected for the further investigation, with an advantage of a dual-target mechanism of action.

We grew a series of NaFe1−x V x As (0 ≤ x ≤ 0.03) single crystals and performed the measurements of resistance, magnetic susceptibility, and specific heat to study the superconducting phase diagram by doping V into NaFeAs. Both the structural and the spin-density-wave (SDW) transitions are slightly suppressed by V-doping. While superconducting transition temperature is enhanced to the maximum value of ∼ 15 K when the optimal doping level x = 0.007 and then is suppressed rapidly with further V-doping, displaying a small superconducting dome. Our results suggest that V-impurities should act as strong magnetic scattering centers which cause the sharp suppression of superconductivity in NaFe1−x V x As.

Repetitive use and effective recycling of the materials are vital to overcome the current environmental challenges. In case of polymeric materials, the high curing temperatures significantly limit their application. In this study, a series of polymers with thermal reversibility at room temperature were synthesized. The main chain of the polymer systems was composed of polyethylene glycol diglycidyl ether (PEGDGE) and polypropylene glycol diglycidyl ether (PPGDGE). The polymers were obtained by initial chain-extension of furfurylamine (FA) and subsequent Diels-Alder (DA) reaction with bismaleimide (BMI). Fourier transform infrared spectroscopy analysis revealed that the material exhibited fast curing rate and high conversion rate, with the conversion rate reaching 98 %. DSC and DMA characterization demonstrated that the reverse reaction occurred at about 100℃. The tensile analysis confirmed that the mechanical properties of the developed materials remain largely unchanged after recycling, as compared with the existing materials.

Due to the poor solubility of 20(S)-protopanaxatriol (PPT), its application was seriously limited. To solve the problems, a novel mono [6-(1,3-diamino-2-hydroxy)-propyl-6-deoxy]-β-CD (H1) was designed and synthesized. The two inclusion complexes of H1 and mono [6-(3,3′-oxybis (ethyleneoxy)bis (propylamino))-6-deoxy]-β-CD (H2) with PPT were prepared and characterized by UV, NMR, FT-IR, XRD and SEM. The Job’s method indicates that the stoichiometry of all inclusion complexes were 1:1. The ROESY spectrum demonstrated that the A-ring and B-ring of PPT integrated into the H1 cavity, and the side chain of H1 is shallowly self-included into the CD cavity. Meanwhile, the A-ring of PPT partly penetrate into H2 cavity, while the side chain of H2 is deeply self-included into the CD cavity through the induced-fit interaction. UV–Vis spectral demonstrated that the complex stability constant (KS) of H2 towards PPT was higher than that of H1. The binding ability is discussed according to the size/shape fit concept and hydrogen bond interaction between host and guest. The water solubility of PPT is significantly increased 133 and 532 times after inclusion of H1 and H2, respectively. Therefore, the H1 and H2 can improve the solubility of PPT, broadening the field of application in herbal medicine and health protection foods.

The interaction between 20(S)-protopanaxatriol (PPT) and bovine serum albumin ( BSA) was studied with fluorescence quenching technique and ultra-violet absorption spectroscopy. The results indicated that PPT led to the intrinsic fluorescence quenching of BSA through a static quenching process .The binding constants of PPT with BSA obtained with fluorescence quenching method were calculated as 0.926 3×10(3) (298 K), 0.618 2×10(3) (308 K), 0.414 4×10(3) L·mol(-1)(318 K), respectively; while the number binding sites n were close to unity. The results showed that the driving force of the interaction between PPT and BSA was hydrogen bond and Van der Waals force. The result of synchronous fluorescence spectra showed that binding of PPT with BSA could induce conformational changes in BSA, that the part of tryptophan became more closely. According to Föster fluorescence resonance energy transfer theory, the binding distance r and energy-transfer efficiency E were respectively 26.2 nm and 0.32.

A sensitive and rapid ultra performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method was developed to determine ruscogenin in rat plasma using midazolam as the internal standard (IS). Sample preparation was accomplished through a liquid-liquid extraction procedure with ethyl acetate to 0.2mL plasma sample. The analyte and IS were separated on an Acquity UPLC BEH C18 column (2.1mm×50mm, 1.7μm) with the mobile phase of acetonitrile and 1% formic acid in water with gradient elution at a flow rate of 0.40mL/min. Ruscogenin and IS were eluted at 1.74 and 1.11min, respectively. The detection was performed on a triple quadrupole tandem mass spectrometer equipped with positive-ion electrospray ionization (ESI) by multiple reactions monitoring (MRM) of the transitions at m/z 431.2→287.0 for ruscogenin and m/z 326.2→291.1 for IS. The linearity of this method was found to be within the concentration range of 2-1000ng/mL with a lower limit of quantification of 2ng/mL. Only 2.0min was needed for an analytical run. The matrix effect was 92.4-107.3% for ruscogenin. The intra- and inter-day precision (RSD%) were less than 11.2% and accuracy (RE%) was within ±9.8%. The recovery ranged from 75.4% to 86.3%. Ruscogenin was sufficiently stable under all relevant analytical conditions. The method was also successfully applied to the pharmacokinetic study of ruscogenin in rats.

To establish a genetic susceptibility assessment model of lung cancer risk potentially associated with polycyclic aromatic hydrocarbon (PAH) inhalation exposure among non-smokers in China, a total of 143 patients with lung adenocarcinoma and 143 cancer-free individuals were recruited. Sixty-eight genetic polymorphisms in 10 pathways related to PAH metabolism and tumorigenesis were selected and examined. It was observed that 3 genetic polymorphisms, along with 10 additional genetic polymorphisms via gene-gene interactions, significantly influenced lung cancer risk potentially associated with PAH inhalation exposure. Most polymorphisms were associated with PAH metabolism. According to the established genetic susceptibility score (GSS), lung cancer risk increased with a rise in the GSS level, thereby indicating a positive dose-response relationship.

Using the analysis techniques of polarizing optical microscope and electron probe, mineral composition, ore texture and structure and the occurrence of Au in the primary ore are studied. The research shows that the main ore minerals in the ore include realgar, pyrite and arsenopyrite etc. Sulfur-stibarsen is the main carrier of Au, and is the major associated mineral of realgar, surrounded mainly by realgar, and partly is the associated mineral of arsenopyrite. The existence of visible gold and microscopic gold in the ore of this mining area can be excluded, and the gold might exist mainly in the form of inclusion gold, which is the so-called “nanoAu”.

BackgroundThis study was designed to investigate the clinicopathological characteristics, treatment and survival of patients with pulmonary large cell neuroendocrine carcinoma (LCNEC).MethodsThe Surveillance, Epidemiology and End Results database was utilized to identify patients diagnosed with pulmonary LCNEC between 2004 and 2013. Kaplan–Meier analysis was conducted to determine the overall survival (OS) and cancer-specific survival (CSS) rate. Univariate survival analysis along with log-rank test, and Cox proportional hazards model were employed to detect independent prognostic factors.ResultsPulmonary LCNEC accounted for 0.58% (2972/510607) of the total number of lung and bronchus carcinoma. And a total of 1,530 eligible cases were identified, with the median follow-up time of 11 months. To be specific, the 3-, 5-year OS and CSS rates were 22.8%, 16.8% and 26.5%, 20.8% respectively. Generally, pulmonary LCNEC was commonly detected in the elderly (72.2%), males (55.9%), the upper lobe (62.0%) and advanced AJCC stage (65.5%). Multivariate analysis revealed that elderly [(≥60 and P= 0.007; (≥80 years) HR:1.530, 95% CI [1.238–1.891],P< 0.001] and advanced AJCC stage [(stage III) HR:2.606, 95% CI [2.083–3.260],P< 0.001; (stage IV) HR:4.881, 95% CI [3.923–6.072],P< 0.001] were independent unfavorable prognostic factors, and that female (HR:0.845, 95% CI [0.754–0.947],P= 0.004)), surgery [(Segmentectomy/wedge resection) HR:0.526, 95% CI [0.413–0.669],P< 0.001; (Lobectomy/Bilobectomy) HR:0.357, 95% CI [0.290–0.440],P< 0.001;(Pneumonectomy) HR:0.491, 95% CI [0.355–0.679],P< 0.001] , chemotherapy (HR:0.442, 95% CI [0.389–0.503],P< 0.001) and radiation (HR:0.837, 95% CI [0.738–0.949],P= 0.005) were independent favorable prognostic factors.ConclusionTo sum up, age at diagnosis, sex, AJCC 8th edition stage, surgery, chemotherapy and radiation were significantly associated with OS of patients with pulmonary LCNEC.

Ethnopharmacological relevance For many years, Guangzhou University of Chinese Medicine has been successfully using the empirical Wenyang Huoxue Jiedu formula (WHJF) to treat coronary heart disease. Modern theories of acute coronary syndrome mainly focus on rupture of thin-cap fibroatheromas (TCFAs), which is closely related to the release of vascular endothelial growth factor and its receptor (VEGF/VEGFR). Aim of study We investigated the effects of WHJF on the formation of TCFA plaques and the potential mechanism (VEGF/VEGFR signaling pathway). Materials and methods For the in vivo experiments, WHJF was administered to ApoE-/- mice, as a model of TCFA plaque formation. Aortic sections of the mice were obtained, and the vulnerability index and new vessel density of plaques were calculated by the Movat staining assay and immunohistochemistry kit, respectively. Protein and mRNA expression levels of VEGF/VEGFR in aortas were assayed by capillary electrophoresis immunoassay and quantitative real-time polymerase chain reaction analyses. In vitro, WHJF serum was produced in rats on the fourth day 2 h after the first administration of different concentrations of WHJF. Proliferation, migration, and lumen formation ability of human umbilical vein endothelial cells (HUVECs) treated with sera from these rats were assayed by the CKK-8 kit, Transwell plates, and Matrigel assay, respectively. Protein and mRNA expression levels of signaling molecules in the VEGF/VEGFR pathways were also examined. Results In vivo, the vulnerability index and new vessel density of plaques in the WHJF group were lower than those values in the blank control group (P 0.05). In vitro, the proliferation, migration, and tube formation of HUVECs in the high-dose WHJF group were reduced compared to the control group (P 0.05). Conclusions WHJF inhibits TCFA formation by influencing the VEGF/VEGFR signaling pathway.

MnxZn1-XO Crystal was synthesized by hydrothermal method in this work.The experimental parameters for hydrothermal synyhesis were:Mineralizer concentration 3mol•L-1KOH, the fill factor 35%, temperature 430°C, Zn(OH)2 doped with MnO2 as precursor, and the reaction time 24 hours. The Mn concentration in crystal was determined by X-ray EDS. The atomic percentage of Mn in crystal increases as the concentration of MnO2 in precursor increased. The maximum atomic percentage for Mn is over 2%. The morphology shows characteristics of hexagonal prism of pure ZnO crystal. The exposed faces are hexagonal faces m｛10 0｝, hexagonal cone faces p｛10 1｝, negative polar faces ｛000 ｝and positive polar faces｛0001}. The diameters of the crystals are 50-200μm，the heights are 20-100μm.

A new technique, direct photodegradation of self-assembled monolayers (SAM), to obtain surface energy gradients on Si substrates was demonstrated. The gradient surface, with hydrophobic to hydrophilic gradients, was prepared by two steps: Firstly, a homogeneous fluoroalkylsilane SAM film was deposited by a chemical vapor deposition on a Si substrate. Secondly, a controlled photodegradation technique was directly applied to the homogeneous FAS-SAM surface. The surface energy gradient was then obtained due to the different intensity of photoirradiation in the different positions along the photodegraded path on the SAM surfaces. The resulting surface displayed a gradient of wettability (with the contact angle of water changing from 55° to 18°) over a distance of 4.2 mm. The water droplet was driven by surface energy gradient and spontaneously moved from the hydrophobic to hydrophilic surface. During the moving process, the water droplet accelerated firstly and then decelerated. The peak velocity was about 23.3 mm/s. The velocity is dependent on the gradient of the surface energy.

A surface with surface energy gradient was fabricated by using a controlled photodegradation technique of a fluoroalkylsilane self-assembled monolayer (SAM) using irradiation of vacuum ultraviolet light (wavelength=172 nm). Visualization experiments were carried out to investigate the motion behaviors of water droplets on horizontal gradient surfaces. System free energy conversion was analyzed to understand the mechanics of the droplet self-motion. The results show that the liquid droplets were self-propelled to move from hydrophobic region to hydrophilic region on horizontal gradient surfaces. The motion process of the water droplet experienced an accelerating stage and a decelerating stage. The velocity of 2 mL water droplet reached to a maximum of 23.28 mm/s. In the droplet motion on the horizontal gradient surface, the deformation and spread of the droplet continuously release out the interfacial and gravitational potential energy, which offers the kinetic energy for the droplet motion. However, the released interfacial energy is three orders of magnitude larger than the released gravitational potential energy. Thus, the released interfacial energy is the main source of driven energy for the droplet motion. The theoretical analysis is consistent with the experimental results.

Theoretical calculations suggest that creating superoleophobic surfaces would require a surface energy lower than that of any known materials. In the present work, we demonstrate micronanostructured ZnO-based surfaces displaying apparent contact angles (CA) greater than 150, even with hexadecane (surface tension l = 27.5 mN/m). The specific ZnO microtextures were fabricated by a chemical solution method, and fluoroalkylsilane (FAS) was then used to tune the surface wettability. The combination of ZnO microtextures and FAS modification resulted in a superoleophobicity with CA for hexadecane was 154.6 (161.9 for diethylene glycol (l = 45.2 mN/m). This apparent superoleophobic behavior was induced on intrinsically oleophilic materials mainly by topography (i.e. the specific ZnO microtextures), which form a composite surface of air and solid with oil drop sitting partially on air. Such special wetting state is a metastable Cassie state. The results are expected to promote the study on self-cleaning applications, especially in the condition with oil contaminations.

Superhydrophobic surfaces, which have anti-adhesion and self-cleaning properties, were fabricated on Al substrates. The self-cleaning surface was prepared by two steps: firstly, a chemical solution method was used to create the surface roughness with disorderly veins micronanostructures. Secondly, fluoroalkylsilane was deposited on the rough surface to lower its surface energy. The combination of veins micronanostructures and fluoroalkylsilane modification gave the surface a superhydrophobicity with static water contact angle of 166° and sliding angle of smaller than 1°. Additionally, the surface showed a strong anti-adhesion with water and a satisfied self-cleaning property. Water droplets easily rolled off the surface and picked up dirt and debris with them. The surfaces obviously corresponded to Cassie (not Wenzel) -model. Air entrapped within the veins microstructures greatly increases the air/water interface, effectively preventing the penetration of water into the grooves, and finally exhibiting the self-cleaning property. The results will greatly extend Al substrates for specific functions such as water-repellence, self-cleaning and anti-fouling.

The silver(I) and mercury(II) complexes of 1,5-diselena[5]ferrocenophane (L) have been synthesized. The X-ray crystal structures of L, [AgL2]PF6 and [HgI2L] are reported. The small cavity of the macrocyclic ligand means that the ring must undergo a conformational change to allow coordination, and there is no significant through-space interaction M⋯Fe in any of the complexes. Electrochemical studies showed that no electronic communication between ferrocenylene groups was observed in the silver complex where the through-bond Fe···Fe distances are in the range 13.10 (3)–13.27(3) A.

The relationship between mature larval mass of oil tea weevil (Curculio chinensis) and fruit volume of its host plant oil tea (Camellia meiocarpa) was fitted with Logistic equation in order to understand the restriction of host fruit size on large larval growth and development of the weevil. The results showed that the larval mass increased with the increasing host fruit volume, which was in good conformity with the Logistic model. The weevil larval growth followed the principle of diminishing marginal utility, and it could be divided into two periods, the fast-growing period (3.216 cm3, one larva per fruit;4.747 cm3, two larvae per fruit ) and the asymptotic growing period (3.216 cm3, one larva per fruit;4.747 cm3, two larvae per fruit). The minimum fruit size threshold was 1500 cm3 for one larva per fruit, and 2.539 cm3 for two larvae per fruit. The temporal pattern that the mature larvae exited from their host fruits was established, the number of larvae escaping from their host fruits decreased daily after the fruit collection, and the larval escaping peak largely appeared from 6:00 to 10:00 AM with 43.9% of total escaping number, and especially from 7:00 to 8:00 AM with 21.1% of total escaping number. The bigger the larvae, the earlier exited from their host fruits. The restriction of fruit size on growth and development of oil tea weevil was observed, and it should be a behavioral adaptation strategy to increase the offspring' s fitness for the parental weevil adults to oviposit on the bigger fruits.

BACKGROUND The aim of this study was to evaluate the effects of topical ropivacaine anesthesia on hemodynamic responses during intubation and extubation of hypertensive patients. MATERIAL AND METHODS One hundred fifty patients with hypertension ASA II-III were scheduled for noncardiac operations. Patients were divided into 3 groups: a control group receiving 5 ml saline, and 2 groups receiving topical anesthesia with 100 mg lidocaine or 37.5 mg ropivacaine. Hemodynamic responses, including blood pressure and heart rate (HR), were recorded at baseline (T0), before intubation (T1), during tracheal intubation (T2), 2 min after intubation (T3), upon eye opening on verbal commands (T4), during tracheal extubation (T5), and 2 min after extubation (T6). Patients were injected with urapidil 5 mg during intubation and extubation if their systolic blood pressure (SBP) was ≥160 mmHg or diastolic blood pressure (DBP) was ³90 mmHg, and esmolol 10 mg when HR was ≥90 bpm. RESULTS During extubation, the total dosages of urapidil and esmolol were significantly higher in the saline than in the lidocaine or ropivacaine groups, and were significantly lower in the ropivacaine than in the lidocaine group. At T2, SBP, SBP, MAP, and HR were lower in the lidocaine and ropivacaine groups than in the saline group, but the differences were not significant. From T4 to T6, SBP, DBP, MAP, and HR were significantly lower in the ropivacaine group than in the other 2 groups (P

In order to evaluate the effect of different doses of penehyclidine hydrochloride (penehyclidine) on heart rate (HR) and HR variability (HRV) in hysteroscopy, 180 patients (American Society of Anesthesiologists grade I-II) were randomized equally to three groups: 0.5 mg penehyclidine and intravenous anesthesia (group I), 1.0 mg penehyclidine and intravenous anesthesia (group II) and saddle anesthesia combined with intravenous anesthesia (control group). HR and HRV, including total power (TP), low-frequency power (LF), high-frequency power (HF) and the LF to HF ratio (LF/HF), were recorded prior and subsequent to the induction of anesthesia (T0 and T1, respectively), following the start of surgery (T2) and following completion of surgery (T3). HR was lower at T2 than at T0 in the control patients, but no differences were observed in groups I and II. The HR at T2 was increased in group II compared with that in group I. TP in group II was significantly higher compared with that in group I at T2. At T1 and at T2, the LF and HF values were lower in group I than those in the controls. Patients in group II also had higher LF and HF at T2 than patients in group I. The HF was higher at T2 than that at T0 in the controls; however, the HF and LF did not change significantly within groups I and II. No significant differences were observed in the LF/HF ratio among the three groups. At a dose of 0.5 mg, penehyclidine stabilized HRV and did not alter the autonomic nervous modulation of HR. A penehyclidine dose of 1.0 mg may be superior to a dose of 0.5 mg in maintaining HR, but is less effective at balancing sympathetic and parasympathetic activity.

By a reflux process, we prepared Ni–NiO nanocomposites that are face-centered cubic (fcc). By tuning the precursor concentration, we controlled the Ni content in the Ni–NiO nanocomposites. We found that both the interface of Ni and NiO crystal lattices and the weight fraction of Ni have significant impacts on their magnetic properties. There is increase of saturation magnetization and decrease of coercivity (HC) with the increase of the Ni weight fraction. Large exchange bias (HE) and enhanced HC are observed at 5 K, which are due to the creation of heterojunctions at the interfaces of ferromagnetic Ni and antiferromagnetic NiO. After optimization, it is observed that the Ni–NiO nanocomposites with an Ni content of 2.6% show an HC and HE of 1068 and 350 Oe, respectively.

The group 6 metal complexes of 1,5-diselena[5]ferrocenophane (L) have been prepared and characterized. The structures of [M(CO)4L] (M = Cr, Mo) show that L adopts the unusual meso-2 conformation. E1/2 of the 1,1′-ferrocenylene group in three complexes is much more positive than that of the “free” ligand L due to the electron donation from L to the M(CO)4 fragment.

Superhydrophobic ZnO films were prepared by a simple low-temperature solution method, where the ZnO morphology was tuned by hydrofluoric acid. The film topography presents two different length scales: micro flower-like-spheres and nano petals. Such hierarchical structures give the film a superhydrophobic behavior with water contact angle (CA) of 151°, turning into a superhydrophilic one (CA < 5°) after 30 min vacuum ultraviolet (VUV) illumination. The transition from superhydrophobicity to superhydrophilicity is more quickly than the past report using UV illumination because VUV gives higher energy upon the ZnO films. The VUV-illuminated film can be recovered to superhydrophobic through being placed in the dark. Such special wettability can be explained based on ZnO as a photoinduced semiconductor and a photocatalyst. This study will greatly extend applications of ZnO nanomaterials to many important fields, such as microfluidic devices.