Search

By employing a mixed-ligand strategy, two new coordination polymers with the chemical formulae [Co(4-bptzh)(1,3-BDC)] (1) and [Zn(4-bptzp)(1,3-BDC)]n (2) are hydrothermally synthesized using two flexible bis(pyridyl-tetrazole) ligands (4-bptzh = 1,4-bis(5-(4-pyridyl)tetrazolyl)hexane, 4-bptzp = 1,4-bis(5-(4-pyridyl)tetrazolyl)propane) and 1,3-benzenedicarboxylic acid (1,3-H2BDC). Both complexes are characterized by single crystal X-ray diffraction along with the elemental analysis. Furthermore, the inhibitory effect of compounds 1 and 2 against CNE-1 nasopharyngeal cancer cells are evaluated in vitro. Firstly, the antiproliferation activity of compounds 1 and 2 against cancer cells is assessed by the CCK-8 assay. Then, the cancer cell apoptosis is measured with the Annexin V-FITC/PI apoptosis assay by flow cytometry.

In the double-cone ignition scheme, two deuterium–tritium shells in a pair of head-on Au cones are compressed and accelerated spherically [Zhang et al., Philos. Trans. R. Soc. A. 378 (2184), 20200015 (2020)]. The high-speed plasma jets from the cone tips collide and form a stagnating plasma with a higher density during the stagnation stage, preheating the plasma by the Coulomb potential. The preheated plasma is then rapidly heated up further to the ignition temperature by fast electrons generated by a powerful laser pulse of 10 ps. The conditions of the stagnating plasma strongly affect the fast-heating efficiency and consequently the success of ignition. In order to understand dynamical process in the stagnation stage, a special experimental campaign was conducted, where the evolution of the stagnating plasma was diagnosed through the temporal resolved self-emission signals. The spatial-temporal distributions of temperature and density of the colliding plasma were analyzed by the Abel inversion algorithm and the Legendre polynomial fitting. The stagnation period was found to be about 300 ps, the temperature of the core area of the stagnated plasma was between 340 and 390 eV, while the aspect ratio of the colliding plasma was about 0.78.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

By employing a mixed-ligand strategy, two new coordination polymers with the chemical formulae [Co(4-bptzh)(1,3-BDC)] (1) and [Zn(4-bptzp)(1,3-BDC)]n (2) are hydrothermally synthesized using two flexible bis(pyridyl-tetrazole) ligands (4-bptzh = 1,4-bis(5-(4-pyridyl)tetra­zolyl)hexane, 4-bptzp = 1,4-bis(5-(4-pyridyl)tetrazolyl)propane) and 1,3-benzenedicarboxylic acid (1,3-H2BDC). Both complexes are characterized by single crystal X-ray diffraction along with the elemental analysis. Furthermore, the inhibitory effect of compounds 1 and 2 against CNE-1 nasopharyngeal cancer cells are evaluated in vitro. Firstly, the antiproliferation activity of compounds 1 and 2 against cancer cells is assessed by the CCK-8 assay. Then, the cancer cell apoptosis is measured with the Annexin V-FITC/PI apoptosis assay by flow cytometry.

Liddle 综合征是一种罕见的常染色体显性单基因遗传性高血压综合征，如不及时诊治常引发严重并发症，而妊娠期妇女Liddle 综合征的治疗则更具挑战性。该文报道一例既往因高血压急症终止妊娠的Liddle 综合征妇女经基因检测确诊及多学科团队合作帮助其平稳度过第2次妊娠期并最终产下健康女婴一例。.

We developed an angular-resolved scattered-light diagnostic station (ARSDS) to extend the study of laser-plasma instabilities (LPIs) by simultaneously diagnosing their features at different angles in a single shot. The ARSDS angularly samples the scattered light using an array of fibers with flexible setups. The collected light is detected with an imaging spectrometer, a streaked spectrometer, or a fiber-optic spectrometer to provide time-integrated/time-resolved spectral information. The ARSDS was implemented at Shenguang-II Upgrade laser facility for the double-cone ignition campaigns. Preliminary results confirm the importance of an angular-resolved detection due to the angular dependence of LPI processes, such as stimulated Raman scattering.

The present study was conducted to determine the effect of exogenous application of brassinolide (BR) on Leymus chinensis grown under shade, i.e., control (100% natural light), mild shade (70% natural light), and moderate shade (50% natural light). Shade substantially enhanced the plant growth, synthesis of photosynthetic pigments, photosynthetic efficiency, and chlorophyll (Chl) fluorescence attributes of L. chinensis as compared with control. The order of increase was mild shade > moderate shade > natural light except Chl content, where the order of increase was moderate shade > mild shade > natural light. Likewise, application of BR resulted in further exacerbation of plant height, plant fresh and dry mass, but less in case of Chl and carotenoids contents, gas-exchange characteristics, and Chl fluorescence attributes. The results conclude that shade significantly enhanced plant growth through alterations in physiological attributes of L. chinensis, while, application of BR may not further improve the plant growth under shade.

DAMPE satellite has directly measured the cosmic ray proton spectrum from 40 GeV to 100 TeV and revealed a new feature at about 13.6 TeV., The precise measurement of the spectrum of protons, the most abundant component of the cosmic radiation, is necessary to understand the source and acceleration of cosmic rays in the Milky Way. This work reports the measurement of the cosmic ray proton fluxes with kinetic energies from 40 GeV to 100 TeV, with 2 1/2 years of data recorded by the DArk Matter Particle Explorer (DAMPE). This is the first time that an experiment directly measures the cosmic ray protons up to ~100 TeV with high statistics. The measured spectrum confirms the spectral hardening at ~300 GeV found by previous experiments and reveals a softening at ~13.6 TeV, with the spectral index changing from ~2.60 to ~2.85. Our result suggests the existence of a new spectral feature of cosmic rays at energies lower than the so-called knee and sheds new light on the origin of Galactic cosmic rays.

The DArk Matter Particle Explorer (DAMPE), a satellite-based cosmic ray and gamma-ray detector, was launched on December 17, 2015, and began its on-orbit operation on December 24, 2015. In this work we document the on-orbit calibration procedures used by DAMPE and report the calibration results of the Plastic Scintillator strip Detector (PSD), the Silicon-Tungsten tracKer-converter (STK), the BGO imaging calorimeter (BGO), and the Neutron Detector (NUD). The results are obtained using Galactic cosmic rays, bright known GeV gamma-ray sources, and charge injection into the front-end electronics of each sub-detector. The determination of the boundary of the South Atlantic Anomaly (SAA), the measurement of the live time, and the alignments of the detectors are also introduced. The calibration results demonstrate the stability of the detectors in almost two years of the on-orbit operation.

To investigate the changes in cell autophagy and the molecular mechanism of rapamycin affecting the fracture healing.Sprague-Dawley (SD) rats were used to establish the right femoral shaft fracture models, and then underwent immunofluorescence assay to detect the autophagy level in bone tissues. After model establishment, SD rats were divided into two groups, the control group and the rapamycin group (1 mg/kg/d). Respectively, at the 2nd, 4th, and 6th week, rats were randomly selected from each group for X-ray and Micro-computed tomography (Micro-CT) examinations to determine callus growth, immunofluorescence assay to detect the protein expression of light chain 3 II (LC3 II), immunohistochemistry to evaluate the autophagy level through detecting the expression of Beclin1 in rats, Western blotting assay to detect cell apoptosis in tissues, hematoxylin and eosin staining (HE staining) to evaluate the osteoblastic activity through count of osteoblast in bone tissue at the end of fracture, and measure the expression of vascular endothelial growth factors (VEGF).Significant increases were seen in protein expression of cells in bone tissues at the end of fracture. In rapamycin group, callus formation and calcification level in rats were all higher than those in control group; compared with control group, for rats in rapamycin group, cell autophagy was significantly elevated in bone tissues, while cell apoptosis at the end of fracture was reduced with a significant increase in osteoblastic activity. The expression of VEGF in rapamycin group was higher than that in control group.Rapamycin can facilitate fracture healing through inducing cell apoptosis and suppressing cell apoptosis in bone tissues.

The current study was to explore the effect of melatonin on osteoporosis and relevant mechanisms.We performed micro-CT to detect bone microstructure and ELISA to detect the contents of osteocalcin (OCN) and bone alkaline phosphatase (BAP) in serum. Double fluorescence labeling of calcein and tetracycline and toluidine blue staining were used to determine morphological indexes of bone tissues. Alizarin red staining and Oil Red O staining were performed to recognize bone cells and adipocytes. RT-PCR was performed to determine the expression of osteoblast differentiation related genes.In the current study, data from micro-CT indicated that melatonin significantly increased the bone mass density (BMD), bone volume/tissue volume (BV/TV), trabecular number (Tb.N) and trabecular thickness (Tb.Th), and decreased the Structure Model Index (SMI) and trabecular Separation/Spacing (Tb.Sp) in elderly rats. Melatonin reduced calcium and phosphorus losses in urine and increased BAP and OCN levels in serum in elderly rats and increased bone formation rate (BFR) and bone mineralization rate (MAR) in elderly rats. Melatonin increased the number of osteoblasts in bone marrow and reduced the number of adipocytes in elderly rats. Melatonin also promoted the expression of osteogenic differentiation genes and suppressed the expression of adipogenic differentiation genes.WE suggest that melatonin could alleviate osteoporosis in aged rats' models probably by promoting osteoblast differentiation.

The DArk Matter Particle Explorer (DAMPE), one of the four scientific space science missions within the framework of the Strategic Pioneer Program on Space Science of the Chinese Academy of Sciences, is a general purpose high energy cosmic-ray and gamma-ray observatory, which was successfully launched on December 17th, 2015 from the Jiuquan Satellite Launch Center. The DAMPE scientific objectives include the study of galactic cosmic rays up to $\sim 10$ TeV and hundreds of TeV for electrons/gammas and nuclei respectively, and the search for dark matter signatures in their spectra. In this paper we illustrate the layout of the DAMPE instrument, and discuss the results of beam tests and calibrations performed on ground. Finally we present the expected performance in space and give an overview of the mission key scientific goals., 45 pages, including 29 figures and 6 tables. Published in Astropart. Phys

Four varieties of potted apple were subjected to thermotherapy (37 ± 1 °C) coupled with shoot tip grafting. Using reverse transcription-polymerase chain reaction assays prior to treatment, mixed infections with Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV), Apple mosaic virus (ApMV) and Apple scar skin viroid (ASSVd) were detected in 95.8 % of treated plants. It was found that the sprouts of Dahongrong (DHR) and Qiyuetianxian (QYT) variety buds were inhibited by high temperature, although some buds of these two varieties were able to sprout, the growth was slow. The average survival rate of shoot tips cut after thermotherapy was 41.2 % (61/148). The survival rate of DHR (63.2 %) was highest among the four varieties. Sixty-one surviving apple plants were detected over two periods, indicative of an average elimination rate of 65.6 % (40/61) for new leaves (June) and 37.7 % (23/61) for dormant branches (November). The difference of elimination rate for DHR between the two periods was the most obvious. Detections rates of viruses were also different in the two periods; ASGV in dormant branches were 27.8 % higher than those in new leaves, and ASPV (90.6 %) remained the same over the two periods.

The presence of grapevine virus B (GVB) was detected in 188 grapevine samples from China by double antibody sandwich ELISA (DAS-ELISA) and reverse transcription-PCR (RT-PCR). The accuracy of detection by RT-PCR was confirmed by sequencing amplified PCR fragments. Seventeen samples were GVB-positive by DAS-ELISA and five by RT-PCR. The isolate QMW proved to be positive by RT-PCR only, and four isolates (DGWH, DGW, QM, and JFL) could be detected by both methods. Among the five GVB-positive samples detected by RT-PCR, two isolates were originally collected from Henan province and three from Liaoning province. The expected 722 bp DNA fragment, covering partial ORF3 through partial ORF5, was amplified from the five GVB infected samples. Sequence analysis revealed that the molecular variants΄ composition of GVB in the different isolates was complex. Clones of DGWH, DGW, QM, and JFL isolate shared high nucleotide identities, while the identities among the clones of isolate QMW varied. The variants of GVB isolates obtained in this study showed nucleotide identities from 81.1% to 97.9% among themselves, and 79.1% to 98.5% identity with five previously published GVB isolates in NCBI. The alignment of partial ORF3 and the phylogenetic relationships of ORF4 revealed that the molecular variants of Chinese GVB isolates could be clustered into three groups. Only isolate DGW was in the same group with the reported GVB isolates from other countries; the other four GVB isolates in this study were clustered into two groups.

High energy cosmic ray electrons plus positrons (CREs), which lose energy quickly during their propagation, provide an ideal probe of Galactic high-energy processes and may enable the observation of phenomena such as dark-matter particle annihilation or decay. The CRE spectrum has been directly measured up to $\sim 2$ TeV in previous balloon- or space-borne experiments, and indirectly up to $\sim 5$ TeV by ground-based Cherenkov $\gamma$-ray telescope arrays. Evidence for a spectral break in the TeV energy range has been provided by indirect measurements of H.E.S.S., although the results were qualified by sizeable systematic uncertainties. Here we report a direct measurement of CREs in the energy range $25~{\rm GeV}-4.6~{\rm TeV}$ by the DArk Matter Particle Explorer (DAMPE) with unprecedentedly high energy resolution and low background. The majority of the spectrum can be properly fitted by a smoothly broken power-law model rather than a single power-law model. The direct detection of a spectral break at $E \sim0.9$ TeV confirms the evidence found by H.E.S.S., clarifies the behavior of the CRE spectrum at energies above 1 TeV and sheds light on the physical origin of the sub-TeV CREs., Comment: 18 pages, 6 figures, Nature in press, doi:10.1038/nature24475

This study aimed to develop a new vector system to remove selection genes and to introduce two or more genes of interest into plants in order to express them in a coordinated manner. A multigene expression vector was established based on pCamBIA2300 using a selectable marker gene (SMG)-free system based on the combination of the isocaudamer technique and double T-DNA. The vector DT7 containing seven target genes was constructed and introduced into tobacco using Agrobacterium-mediated transformation. Twenty-one of 27 positive transgenic plants contained both T-DNA regions. The co-transformation frequency was 77.8 %. The frequency of unlinked integration of two intact T-DNAs was 22.22 % (6/27). The frequency of removal of SMG from transgenic T1 plants was 19.10 %. These results suggest that this vector system was functional and effective for multigene expression and SMG-free transgenic plant cultivation. At least seven target genes can be co-expressed using this system. Overall, these findings provide a new and highly effective platform for multigene and marker-free transgenic plant production.

The crystal structure and dielectric properties of Pb1−xCax(Yb0.5Nb0.5)1−x(Fe0.5Nb0.5)xO3 (x = 0, 0.2, 0.4, 0.6, 0.8, 1.0) have been investigated in this paper by X-ray diffraction (XRD), dielectric and Raman spectroscopic measurements. The crystal structure of Pb1−xCax(Yb0.5Nb0.5)1−x(Fe0.5Nb0.5)xO3 changes from the orthorhombic to the pseudocubic phase with local non-uniform distribution of B-site cations at room temperature when x = 0.2. With the further increase of x value, the sample exhibits the phase mixture of pseudocubic phase and Ca(Fe1/2Nb1/2)O3 (CFN). The dielectric constant increases with the increase of x value up to x = 0.2 and decreases with the further increase of x value. The sample exhibits typical dielectric relaxor behavior when x = 0.2 and 0.4.

In this report, the band alignment related issues for high-k gate stacks have been discussed and the band engineering has been studied by combinational characterization of in-situ x-ray photoemission spectroscopy (XPS), high resolution transmission electron microscopy (HRTEM) and first-principles calculations based on density functional theory (DFT). The results show that band alignments at metal-gate/high-@k interfaces can be engineered to satisfy the application for CMOS devices through the interface structure-control.

To elucidate the initial growth of metal on oxide surface, we studied adsorption of small nickel clusters, Nin (n = 1–5), on MgO(0 0 1) surface using first-principles method based on density-functional theory. It was found that the preferential adsorption site for an isolated Ni atom is directly above the surface oxygen atom. A strong covalent bond with partial ionic character is formed between the Ni adatom and the surface oxygen atom. Various structures were considered for the Nin isomers and 3D structures were found to be energetically more stable than 2D structures for clusters of more than two atoms. For the 2D clusters, metal–metal bonds prevail over metal-substrate bonds with increasing Ni coverage. The calculated work function and ionization energy were found to vary with Ni coverage which is attributed to the change of the surface dipole moment upon metal adsorption, while the evolution of Schottky barrier height at the initial growth stage is dominated by the adatom-induced gap states.

Fermi level evolution and Schottky barrier height (SBH) for Ni/MgO(0 0 1) interfaces have been studied using X-ray photoelectron technique. It was found that upward band bending occurred at the initial Ni growth stage and Ni bulk properties recovered after 6–8 A thickness. The measured Schottky barrier heights are strongly interface structure-dependent, with the variation in the range of 3.1 eV for perfect interface to 1.6 eV for defect-rich interface. First-principles calculations on the evolution of SBH for the initial growth of Ni on perfect MgO(0 0 1) surface are combined with experimental results to investigate the underlying microscopic mechanism. Adatom-induced states (or interfacial bonding states), MIGS and defects states were used to rationalize the evolution of Fermi level and corresponding SBH for various interface structures. This work shows that SBH can be engineered by interface structure control, and is expected to shed light on the effect of interface structures on the formation mechanism of SBH at metal/oxide interface.

The epitaxial ZrO2 on silicon as alternative gate dielectric, including film growth, interface characterization and electronic structure calculations, have been studied using a combination of characterization tools. The films grown by pulsed laser deposition have high-quality microstructure and electrical properties. The atomic structure and band alignment at the ZrO2/Si interfaces have been determined by high-resolution transmission electron microscopy and X-ray photoelectron spectroscopy. Relative stabilities and electronic properties of interface structure have been discussed and compared from the view of experimental and calculated results.

In this paper, given a boundary value problem for a finite elastic body in two-dimensions, a problem of representing the solution by layers of point forces (Fj) and Somigliana dislocations (Bj) is considered in the infinite homogeneous body that contains the original finite body. In the boundary element method (BEM) solution, either the boundary displacement or traction component at each node is specified, but not both. This provides us a degree of freedom to arbitrarily specify the proportion of the densities Fj and Bj to be used in the direct and the indirect BEM formulations. The nature of the BEM solution errors is identified and a unified error estimation measure with a mesh refinement scheme for both formulations is proposed.

Simple analytical formulas for the displacement, traction, and stress intensity factor for a 2-D crack tip singular boundary element are developed using the continuous distribution of dislocation dipoles and Chebyshev polynomials. The known r crack tip opening displacement and the 1/ r stress singularity at the crack tip is mathematically built into the formulas. In the boundary element implementation the crack tip singular element is placed locally at each crack tip on top of the ordinary non-singular crack elements that cover the entire crack surface. Within the constraint of the rectilinear approximation, any curvilinear cracks can be modeled, including center and edge cracks. Although the quarter-point element is accurate and easy to use, it does not provide the analytical formula for the stress intensity factor which is the key feature of the proposed method. The performance of the crack tip singular element is compared against other crack elements that incorporate the crack tip singularity analytically. A numerical result is given for a crack growth problem where repeated update of the crack shape and calculation of the stress intensity factor are required as the crack grows in a curvilinear path.

Based on boundary displacement and traction, a non-hypersingular boundary integral formulation is developed for the displacement gradient. At an arbitrary boundary point where the displacement field at least satisfies a Holder condition (uk∈C1, γ with γ>0), the displacement gradient can be calculated by the Cauchy Principal Value (CPV) integration. The hypersingularity involved in conventional formulation is circumvented by applying rigid body translation. The numerical implementation of the present formulation is illustrated, and both direct and indirect approaches are discussed. For two-dimensional problems, the coefficients involved in the direct approach are analytically derived. The stress formulation is also discussed. Finally, numerical examples are presented to validate the present formulation.

A boundary element method for straight multiple center and edge crack problems is developed in this paper. The method is constructed upon the systematic use of the elastic singularity solutions in complex variables. The crack opening is represented by the continuous distribution of dislocation dipoles and the effect of the non-crack boundary by the continuous distributions of point forces and dislocation dipoles. The crack-tip singularity is embedded into the interpolation using orthogonal polynomials (i.e. Chebyshev and Jacobi) and their associated singular weight functions. The proposed analytical integration procedure of the Cauchy-type integrals defined over the crack eliminates the need for the quadrature formulae for numerical integration, streamlines, and enhances the accuracy of the traditional singular integral equation method for crack problems. The stress intensity factors for the fifteen problems analyzed in this paper have been accurate enough to substitute those given in stress intensity factor handbooks. Since non-crack boundary of arbitrary shape can be introduced at will the method is expected to give accurate stress intensity factors for complex real life problems.

The fundamental solutions of elasticity are used to establish a numerical method for elastic and plastic multiple crack problems in two dimensions. The continuous distributions of the point forces, dislocations, and the plastic sources are used systematically to model the crack, non-crack boundary, and the plastic deformation. Use of these singularities are guided strictly by the physical interpretation of the problem. We adopt Muskhelishvili's complex variable formalism that facilitate the analytical evaluation of the integrals representing the continuous distributions of the singularities. The resulting numerical method is concise and accurate enough to be used for elastic and plastic multiple crack problems.

A residual definition of error indicators and estimators is used. A p -and a h -implementation of an adaptive hierarchical boundary element method is presented. The direct version of boundary elements based on the collocation method is reviewed and the way in which the residual boundary function is obtained is presented. The hierarchical definition of the interpolation and its advantages are discussed. Numerical interpolation to compute error estimators and indicators is established and its non-dimensionality is defined.

First-principles calculations based on density-functional theory and generalized gradient approximation were performed to study the interface structures of epitaxial ${\mathrm{NiSi}}_{2}$ and ${\mathrm{CoSi}}_{2}$ on a $\mathrm{Si}(001)$ substrate. A sevenfold-$Z$ model with zigzag Si-dimer rows in the interface layer is proposed. The model is energetically comparable to an established sevenfold-$R$ model and they could coexist in both ${\mathrm{CoSi}}_{2}∕\mathrm{Si}$ and ${\mathrm{NiSi}}_{2}∕\mathrm{Si}$ structures, leading possibly to degradation of the interface quality of the silicide/silicon heterostructure.

We report a method for chemical tuning of band alignments for metal gate/high-$\ensuremath{\kappa}$ oxide interfaces. A heterovalent metal interlayer was included between the metal gate electrode and high-$\ensuremath{\kappa}$ oxide. Based on our first-principles calculations for $\mathrm{Ni}∕\mathrm{Zr}{\mathrm{O}}_{2}(001)$ interfaces, a tunability as wide as $2.8\phantom{\rule{0.3em}{0ex}}\mathrm{eV}$ can be achieved for the effective work function of metal gate on high-$\ensuremath{\kappa}$ oxide which far exceeds the required tuning range. In addition, we found a simple linear relationship between the effective metal work function and the electronegativity of interlayer metal atom for most of the transition metals considered. The localized interfacial dipole was found to dominate the contribution to the formation of Schottky barrier heights at metal/dielectric oxide interfaces.

First-principles calculations for $\mathrm{Zr}{\mathrm{O}}_{2}∕\mathrm{Si}$ interfaces are presented. Various model interfaces satisfying the general bonding rules were considered. The interface formation energies were evaluated as a function of oxygen potential, which shows the possibility of atomic control of the interface structure by altering the chemical environment. The strain mode and interface structure effects on band offset were investigated. The band offsets were found strongly dependent on the strain modes and interface structures. These results suggest that in epitaxial growth of $\mathrm{Zr}{\mathrm{O}}_{2}$ on Si for gate dielectric applications, the chemical environment should be well controlled to get reproducible band offsets.

Experimental results in a separating shear layer from leading edge of a bluff axisymmetrical cylinder reveal the evolution of K-H unstable waves into vortex pairing and the synchronization of K-H waves with acoustic excitation follows the phenomenon of Devil's staircase, which always occurs in a nonlinear dynamical system of two coupling mechanical vibrators.

A brief introduction of the Rutgers’ FAA center research program on multiple crack problems in airplane fuselage will be presented. We intend to develop a software package focusing on the local stress analysis of the multiply cracked airplane fuselage. The package can be used as a key component in the global-intermediate-local analysis scheme adopted for the real-life stress analysis of complex airplane structures. The boundary condition needed for the local analysis is assumed to have been provided by the global-intermediate analysis; the result of the local analysis is fed back to the global-intermediate analysis.

Quadratic h-hierarchical interpolation functions are defined. Using these functions, mesh refinement can be implemented instead of mesh geometry regeneration. Quadratic interpolation accuracy for unknown variables can be obtained in each sub-element.

Schottky barrier heights (SBHs) at metal gate/LaAlO3 (001) interfaces were studied by using ab initio calculations based on density functional theory. Three kinds of metals, Al, Rh, and Pt, were considered with various interface chemistries on LaAlO3 (001) surface. It was found that the Fermi level of metal gates is not pinned at metal gate/LaAlO3 interfaces. The SBH is largely determined by the interface chemistry. The interface metal up to three layers can ultimately decide the SBH, and the SBH at the metal gate/LaAlO3 interface can be efficiently tuned by including monolayer heterovalent metal at the interface.

The evolution of Schottky barrier heights (SBHs) at Ni∕HfO2∕n-Si stacks was studied by in situ x-ray photoemission. It was found that the n-SBH (or the effective work function) increases with thickness of the Ni overlayer and approaches 2.4eV (or 4.9eV) when metallic behavior of Ni overlayer is recovered. This is in good agreement with results of first-principles calculations. The effective work function of Ni in contact with HfO2 was found different from that in vacuum by 0.3eV. The interface dipole was induced by the weak interaction of Ni thin film and HfO2 dielectric.

The effect of nitrogen incorporation on the electronic structure and thermal stability of HfO2 gate dielectric was investigated by using photoemission study and first-principles calculation. Hafnium oxynitride (HfON) dielectric shows higher thermal stability in comparison to pure HfO2 on Si. Atomic N can passivate O vacancies in the dielectrics during nitridation process, but the N atoms incorporated into interstitial sites cause band gap reduction. Postnitridation annealing is required to activate interstitial N atoms to form stable N–Hf bonds, which will increase the band gap and band offset of as-nitrided dielectric film.

The Schottky-barrier heights for the Ni and ZrO2 interfaces have been determined using the x-ray photoemission method. Depending on the surface treatment of ZrO2, the variation of Schottky-barrier heights at Ni∕ZrO2 interfaces was found as large as 0.76±0.10eV. The p-type Schottky-barrier height for the oxygen-rich (oxygen-deficient) interface was measured to be 2.60eV (3.36eV). First-principles calculations provide a microscopic explanation of such variation, which was attributed to the different interface dipole formed by interfacial Ni–O, Ni–Zr bonds, or oxygen vacancies.

The energy-band alignments for the ZrO2∕Si, ZrO2∕Si0.75Ge0.25, and ZrO2∕Ge interfaces have been studied using x-ray photoemission. The valence-band offsets of ZrO2∕Si, ZrO2∕Si0.75Ge0.25, and ZrO2∕Ge interfaces are determined to be 2.95, 3.13, and 3.36eV, respectively, while the conduction-band offsets are found to be the same value of 1.76±0.03eV for three interfaces. The upward shift of valence-band top accounts for the difference in the energy-band alignment at three interfaces.