Search

To shield the environmental magnetic noises, magnetically shielded rooms (MSRs) are used for biomagnetic measurements, etc. The sources of environmental noises are far away from the MSR, in such a way that almost uniform magnetic field is applied to the MSR. To evaluate the shielding factor SFo for the uniform magnetic field in a construction site, the magnetic noises are applied by coils. However, SFs depend on the size and position of the coils, so a standardization of the method for accurately evaluating SFo using coils is being discussed in the Japan Electronics and Information Technology Industries Association (JEITA). In JEITA, we have already proposed and verified the method of estimating SFo's by smaller coils placed near MSRs in the low frequency region without eddy current effect. In this paper, the suitable size and position of coils, such that the errors of the SFo's estimated and directly evaluated are within 10%, on various shapes of MSRs are obtained using 3-D linear magnetostatic field analysis. Moreover, to correct SFs when the magnetic noises are applied to MSRs through a reinforced concrete wall, etc., the effect of wall on the applied magnetic field is also obtained from the experiment. Finally, the suitable coil conditions and the correction method are verified by the experiment using an actual double-layered MSR.

This study aimed to investigate how the trunk muscularity is related to sprint running performance. In 23 youth soccer players, the cross-sectional images at the mid level of each of L1-L2, L2-L3, L3-L4, L4-L5, and L5-S1 were obtained using magnetic resonance imaging to determine the cross-sectional areas (CSAs) of rectus abdominis, oblique, psoas major, quadratus lumborum and erector spinae muscles. The times taken to sprint over 20 m were measured, and the mean velocity of running was calculated for each of the 2 distances (V (10 m) and V (20 m)) and for the distance from 10 m to 20 m (V (10-20 m)). The CSA values of the 5 slice levels for all muscles except for the quadratus lumborum and those of the 3 slice levels (L1-L2, L2-L3 and L3-L4) for the quadratus lumborum were averaged and expressed relative to the two-third power of body mass (CSA/BM (2/3)). The CSA/BM (2/3) values of the erector spinae and quadratus lumborum were selected as significant contributors to predict V (10 m) ( R(2)=0.450), V (20 m) ( R(2)=0.504) and V (10-20 m) ( R(2)=0.420). The current results indicate that the muscularity of the erector spinae and quadratus lumborum contributes to achieving a high performance in sprint running over distances of less than 20 m.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

A pressure-based finite volume procedure developed previously for incompressible flows is extended to predict the three-dimensional compressible flow within a centrifugal impeller. In this procedure, the general curvilinear coordinate system is used and the collocated grid arrangement is adopted. Mass-averaging is used to close the instantaneous Navier-Stokes equations. The covariant velocity components are used as the main variables for the momentum equations, making the pressure-velocity coupling easier. The procedure is successfully applied to predict various compressible flows from subsonic to supersonic. With the aid of the k-ɛ turbulence model, the flow details within a centrifugal impeller are obtained using the present procedure. Predicted distributions of the meridional velocity and the static pressure are reasonable. Calculated radial velocities and flow angles are favourably compared with the measurements at the exit of the impeller.

The newly designed scheme for a low-voltage 16 MDRAM/SOI has been successfully realized and the functional DRAM operation has been obtained at very low supply voltage below 1 V. The key process and circuit technologies for low-voltage/high-speed SOI-DRAM will be described here. The extra low voltage DRAM technologies are composed of the modified MESA isolation without parasitic MOS operation, the dual gate SOI-MOSFETs with tied or floating bodies optimized for DRAM specific circuits, the conventional stacked capacitor with increased capacitance by thinner dielectric film, and the other bulk-Si compatible DRAM structure. Moreover, a body bias control technique was applied for body-tied MOSFETs to realize high performance even at low voltage. Integrating the above technologies in the newly designed 0.5-/spl mu/m 16 MDRAM, high-speed DRAM operation of less than 50 ns has been obtained at low supply voltage of 1 V.

Low-voltage and low-power DRAMs of appropriate capacity are required for portable systems such as portable PCs and Personal Digital Assistants (PDAs). Though a 1.2 V 49 ns bulk-DRAM has been reported, still lower voltage operation is difficult for bulk-DRAMs, due to the back bias effect and large junction capacitance. SOI devices have several advantages over bulk devices, such as small subthreshold swing (S-factor), elimination of the back bias effect, and small junction capacitance. To utilize these advantages, many SOI-DRAM studies and proposals have been made. The basic operation of the SOI-DRAM at 2.3 V has been examined using an experimental 64 kb SOI-DRAM, and a 3 V 50 ns 16 Mb SOI-DRAM has been also reported. Here the authors present a 1 V 46 ns 16 Mb SOI-DRAM which uses a 0.5 /spl mu/m CMOS/SIMOX process. To accelerate low-voltage speed, a body-pulsed sense amplifier (BPS) and body-driven equalizer (BDEQ) are used. The conventional body-control technique uses partially-depleted (PD) transistors. In contrast, fully-depleted (FD) transistors are used to reduce leakage current in the off-state.

This study presents a simple method for designing the blade geometry of a centrifugal compressor impeller. In this method, instead of giving the mean swirl distribution on the meridional surface, the blade angle distribution is specified and the blade shape is derived, making it easier to perform the design. The quasi-three-dimensional potential flow field inside the impeller is obtained using the streamline curvature method, which solves the Euler equation along arbitrary quasi-orthogonals. The viscous effect is incorporated indirectly into the inverse design of the impeller via the simplified three-dimensional boundary layer calculation and the performance prediction. A three-dimensional centrifugal impeller was designed using this inviscid-viscous method and eventually manufactured. The newly designed impeller (B) and another impeller (A) designed previously were tested on a standard apparatus for model impellers. With the aid of three-hole probes and thermocouples, the flow parameters downstream of the exit of the impellers were measured along the axial direction of the impellers. A viscous loss model related to the boundary parameters is developed and used for the performance predictions of the impellers together with other loss models. From both the boundary layer analysis and the performance prediction, it is concluded that impeller B is superior to impeller A, which is in close accordance with the measurements.

Purpose: The aim of this study was to confirm On-Board Imager cone-beam computed tomography (CBCT) using a histogram-matching algorithm as a useful method for proton dose calculation in head and neck radiotherapy. Methods: We studied one head and neck phantom and ten patients with head and neck cancer treated using intensity-modulated radiation therapy (IMRT) and proton beam therapy. We modified Hounsfield unit (HU) values of CBCT (mCBCT) using a histogram-matching algorithm. In order to evaluate the accuracy of the proton dose calculation, we compared dose differences in dosimetric parameters (Dmean) for clinical target volume (CTV), planning target volume (PTV) and left parotid and proton ranges (PR) between the planning CT (reference) and CBCT or mCBCT, and gamma passing rates of CBCT and mCBCT. To minimize the effect of organ deformation, we also performed image registration. Results: For patients, the average differences in Dmean for CTV, PTV, and left parotid between planning CT and CBCT were 1.63 ± 2.34%, 3.30 ± 1.02%, and 5.42 ± 3.06%, respectively. Similarly, the average differences between planning CT and mCBCT were 0.20 ± 0.19%, 0.58 ±0.43%, and 3.53 ±2.40%, respectively. The average differences in PR between planning CT and CBCT or mCBCT of a 50° beam for ten patients were 2.1 ± 2.1 mm and 0.3 ± 0.5 mm, respectively. Similarly, the average differences in PR of a 120° beam were 2.9 ± 2.6 mm and 1.1 ± 0.9 mm, respectively. The average dose and PR differences of mCBCT were smaller than those of CBCT. Additionally, the average gamma passing rates of mCBCT were larger than those of CBCT. Conclusion: We evaluated the accuracy of the proton dose calculation in CBCT and mCBCT with the image registration for ten patients. Our results showed that HU modification using a histogram-matching algorithm could improve the accuracy of the proton dose calculation.

In mouse atrium, M₂ and M₃ muscarinic receptors (M₂R and M₃R) are involved in biphasic (negative and positive) inotropic actions of muscarinic agonists, and the positive inotropic action is reduced by indomethacin. The aim of our study was to determine the localization of M₂R, M₃R and cyclo-oxygenase (COX) in mouse atrium and to characterize muscarinic receptor-mediated positive inotropy. M₂R immunoreactivity was found only on atrial myocardium, but M₃R immunoreactivity was localized on both the myocardium and endocardial endothelium. COX-1 and COX-2 immunoreactivities were identified in both myocardial and endocardial endothelium. In electrically stimulated left atria, carbachol caused M₂R-mediated negative inotropy followed by M₃R-mediated positive inotropy. Removal of atrial endothelium reduced the positive inotropy without affecting the negative inotropy, suggesting that stimulation of endothelial M₃R mediates the positive inotropy. N-[2-(cyclohexyloxy)-4-nitrophenyl]-methanesulfonamide (NS398, COX-2 inhibitor) decreased the carbachol-induced positive inotropy; however, 5-(4-chlorophenyl)-1-(4-methoxyphenyl)-3-trifluoromethylpyrazole (SC560, COX-1 inhibitor), 1-[[4,5-bis(4-methoxyphenyl)-2-thiazolyl]carbonyl]-4-methylpiperazine (FR122047, COX-1 inhibitor) and L-nitroarginine methylester did not affect the inotropic response. M₃R activation caused positive chronotropy in spontaneously beating right atria when M₂R-mediated negative chronotropy was suppressed and rate of contraction was low,350 beats min⁻¹. Our results indicate that although M₃Rs are located on both myocardial cells and endocardial endothelial cells, only endothelial M₃Rs mediate positive inotropy in response to muscarinic agonists via activation of COX-2 in the mouse atrium. M₃R-mediated positive chronotropy counteracting M₂R-mediated negative chronotropy was also demonstrated.

The effects of trimebutine on Ca2+ release and modulation of Ca2+ sensitivity of contractile elements induced by carbachol (CCh) were investigated using a tension measuring method in beta-escin-treated skinned smooth muscle of the longitudinal muscle layer of guinea pig ileum. Trimebutine (10-100 microM) concentration-dependently inhibited tension development brought about by Ca2+ release from intracellular stores induced by CCh (10 microM), but did not affect those induced by inositol 1,4,5-trisphosphate (IP3, 25 microM) or caffeine (5 mM). The inhibitory effect was reversible. Trimebutine (100 microM) neither altered the Ca2+ sensitivity of the contractile elements nor affected the effects of GTP gamma S (50 microM) and CCh (100 microM) in potentiating Ca2+ sensitivity of the contractile elements after the Ca2+ storage function had been eliminated by A23187. These results suggest that trimebutine inhibits CCh-induced Ca2+ release by acting at some point during the coupling of muscarinic receptors through a G-protein to phospholipase C and thus reducing the accumulation of IP3.

T cell tolerance to superantigen can be mediated by clonal anergy in which Ag-specific mature T cells are physically present but are not able to mount an immune response. We induced T cell unresponsiveness to minor lymphocyte stimulations locus antigen (Mls)-1a in mice transgenic for TCR V beta 8.1 in three different systems: 1) injection of Mls-1a spleen cells, 2) mating with Mls-1a mice, and 3) bone marrow (BM) chimeras in which Mls-1a is present only on nonhematopoietic cells. CD4+8-V beta 8.1+ cells from all these groups did not proliferate in response to irradiated spleen cells from Mls-1a mice. We compared the response of these cells by T cell/stimulator cell conjugate formation, Ca2+ mobilization, and proliferation assays. The mechanisms underlying the unresponsiveness of these T cells appear to differ. CD4+8-V beta 8.1+ cells from Mls-1a spleen cell-injected mice mobilized cytoplasmic Ca2+ but proliferated at a reduced level in response to cross-linking with anti-TCR mAb. However, these cells formed conjugates, mobilized Ca2+, and proliferated in response to Mls-1a when activated B cells were used as stimulators, although they produced reduced levels of IL-2. In Mls-1a/b V beta 8.1 transgenic mice, a subset in CD4+8-V beta 8.1+ cells did not mobilize cytoplasmic Ca2+ after TCR cross-linking. Their conjugate formation, Ca2+ mobilization, or proliferation in response to Mls-1a on activated B cells was undetectable. Finally, CD4+8-V beta 8.1+ cells from the BM chimeras proliferated to TCR cross-linking at a partially reduced level and formed conjugates, mobilized Ca2+, and proliferated in response to Mls-1a on activated B cells. These features suggest that the mechanisms underlying the maintenance of anergy in Mls-1a spleen cell-injected mice are distinct from those in Mls-1a mice.

Three apple (Malus × domestica) cultivars and 11 Malus accessions have been investigated by the probe hybridization method on their mitochondrial DNA (mtDNA). The gene probes used were: coxI, coxII, atpA, atp6, and atp9. Our results revealed enough variation to characterize ten mtDNA haplotypes among the Malus genotypes examined. The taxonomic and phylogenetic implications of mtDNA polymorphism are also discussed

Mitochondrial DNA (mtDNA) diversity has been determined in apple landraces and cultivars, based upon restriction fragment length polymorphisms (RFLPs) for several mitochondrial genes. Our analysis includes three cultivars, ‘Golden Delicious’, ‘McIntosh’ and ‘Delicious’, which represent the various patterns of mtDNA polymorphisms previously described (Ishikawa et al., 1992). A total of five RFLPs were detected, allowing classification of the apple genotypes into four cytoplasmic groups: GroupI, ‘Golden Delicious’-type; GroupII, ‘McIntosh’-type; GroupIII, ‘Delicious’-type; and Group IV, ‘Dolgo Crab’-type. European landraces and cultivars were assigned to Groups I, II, and III, while chinese crab apples were placed in either Group III or IV.

Clonal deletion and anergy are two major mechanisms of self-tolerance. However, the molecular mechanisms underlying clonal deletion and anergy, as well as the threshold of TCR affinity/avidity required for these processes, are not known. Expression of the V beta 8.1 TCR correlates with the reactivity of the T cells to the minor lymphocyte stimulating locus-1a (Mls-1a) and T cells expressing this TCR are deleted in the thymus of Mls-1a mice. Similarly, in TCR V beta 8.1 transgenic mice, the number of CD4+CD8-T cells is reduced in Mls-1a mice. However, small numbers of CD4+CD8-T cells remain in the periphery of adult Mls-1a transgenic mice. We have generated T cell clones from TCR V beta 8.1 transgenic mice by stimulation of lymph node T cells with C57BL/6 alloantigens. Interestingly, CD4+CD8-V beta 8.1+ clones isolated from the transgenic mice of Mls-1a background responded to the self-antigen Mls-1a, to which they did not respond in primary assay. Reactive patterns of the clones were compared with clones derived from Mls-1b mice. Proliferation and cytokine production of the clones from Mls-1a mice to the self-antigen Mls-1a were generally reduced when compared with clones from Mls-1b mice. More importantly, T cell clones from Mls-1a mice required more Mls-1a antigen for their activation, and were more susceptible to the inhibitory effects of anti-CD4 antibody on the proliferative responses to Mls-1a than those from Mls-1b mice. These results suggest that the T cell receptor on clones derived from Mls-1a mice have functional but reduced affinity/avidity for self-antigen Mls-1a.

The “well engineering” of a retrograde twin well formed by high-energy ion implantation for 0.5 μm CMOS is demonstrated to be quite useful in improving many device characteristics, such as leakage current reduction, soft-error immunity, low latchup susceptibility, smaller device isolation dimensions, etc. In forming a heavily doped buried layer by high-energy ion implantation, a drastic reduction in leakage current has been found. This would be caused by gettering of impurities or mudefects by secondary defects which are induced either by implantation of dopant itself (“self-gettering”) or by an additional implantation of oxygen, carbon or fluorine (“proximity gettering”).

In single cells obtained by enzymic treatment of rabbit small-intestinal smooth muscle, and held under voltage clamp by patch pipette in the whole-cell recording mode, release of inositol trisphosphate (InsP3) from its caged precursor by flash photolysis caused complete inhibition of the voltage-dependent calcium current. No inhibition was seen in control experiments where the cage (2-nitrosoacetophenone) was released by flash photolysis from caged ATP. The inhibition by InsP3 of the calcium current was prevented if 10 mM EGTA or 2 mg/ml heparin was included in the pipette solution. Heparin is known to block InsP3 receptors. These results suggest that release of calcium stores by InsP3 raises Cai and that calcium ions inhibit the calcium current by acting either directly or otherwise on the internal mouth of the calcium channel.

We experienced 2 infants in whom octreotide acetate was effective on intractable chylothorax after surgery for congenital heart diseases. They were 8- and 5-month-old. They were diagnosed as having corrected transposition of the great arteries (TGA) and tetralogy of Fallot respectively, and underwent bidirectional Glenn anastomosis and right modified Blalock Taussig shunt. Chylothorax was revealed on the 11th and the 1st postoperative day, and was not improved by any conventional therapy in either case. Then octreotide acetate was infused continuously with 0.1-0.6 micorg/kg/hour for 24 and 7 days. Chylothorax disappeared completely without any complications such as disturbance of blood sugar level or growth retardation. Octreotide acetate was effective and safe even in infants in intractable chylothorax after surgery for congenital heart diseases, as long as used for short period.

Thirteen cases of functional single ventricle who had undergone bidirectional Glenn procedure were divided into 2 groups according to presence (5) or absence (8) of additional pulmonary blood flow. Additional flow was preserved in cases with relatively small pulmonary artery index (PA index), and their sources were antegrade pulmonary blood flow (2), and Blalock-Taussig (BT) shunt (3). In the control group, PA index was reduced to about 70% of the preoperative value, while in the additional group, pulmonary artery growth was recognized without significant elevation of mean pulmonary artery pressure. However, atrioventricular valve regurgitation progressed and systemic ventricular volume did not decrease after Glenn in the additional group. Therefore special consideration for the timing of Fontan procedure is mandatory.

We performed aortic valve replacement in 24 patients aged over 70 with small calcified valves. The surgical management of such patients remains controversial as the extensive calcification compromises implantation. Hence, we used an ultrasonic debridement instrument to remove calcium and selected a small prosthesis with the largest possible orifice without enlargement of the aortic annulus. Echocardiography showed significant reductions in left ventricular mass index compared with preoperative values. Early and mid-term prognosis has been relatively good.

5-Hydroxytryptamine (5-HT) receptor subtypes involved in 5-HT-induced contraction of the chicken gastrointestinal tract were characterized pharmacologically using subtype-selective agonists and antagonists. The proventriculus (area of stomach adjacent to the oesophagus) and ileum are examined. 5-HT applied cumulatively caused sustained contraction of the proventriculus that was not decreased by tetrodotoxin, atropine or l-nitro-arginine methylester (l-NAME). alpha-Methyl-5-HT showed the same potency as that of 5-HT, indicating the involvement of the 5-HT(2) receptor. (+/-)-1-(2,5-dimethoxy-4-iodophenyl)-2-amino-propane (DOI), 5-methoxytryptamine and 1-(3-chlorophenyl)piperazine hydrochloride (mCPP) were potent, and 2-methyl-5-HT, 5-carboxamidotryptamine, BW723C86 and 6-chloro-2-(1-piperazinyl)pyrazine hydrochloride (MK212) were moderate, but (+/-)-8-hydroxy-2-dipropylaminotetralin hydrobromide (8-OH-DPAT), [endo-N-8-methyl-8-azabicyclo-(3,2,1)oct-3-yl]-2,3-dihydro-(1-methyl)ethyl-2-oxo-1H-benzimidazol-1-carboxamide (BIMU-8) and cisapride were weak agonists. Correlation of pEC(50) values of these agonists with documented pEC(50) values for 5-HT(2C) receptor was higher than 5-HT(2A) and 5-HT(2B). Cinanserin, ketanserin, methiothepin, methysergide, mianserin, (8-[5-(2,4-dimethoxy-5-(4-trifluoromethylphenylsulphonamido)phenyl-5-oxopentyl)-1,3,8-triazaspiro[4,5]decane-2,4-dione hydrochloride (RS102221), N-(1-methyl-1H-indolyl-5-yl)-N'-(3-methyl-5-isothiazolyl)urea (SB204741), spiperone and N-desmethylclozapine concentration-dependently inhibited the contractile responses to 5-HT. Correlation of pK(b)/pA(2) of antagonists with documented pK(i) for 5-HT(2C) receptor was highest among 5-HT(2) receptor subtypes. In the methysergide- and ketanserin-treated proventriculus, 5-HT, 2-methyl-5-HT and cisapride did not enhance the electrical field stimulation (5 Hz)-induced cholinergic contractions. 5-HT applied non-cumulatively caused transient contraction of ileum, and the responses were partly decreased by atropine or tetrodotoxin. 5-Methoxytryptamine, alpha-methyl-5-HT, 5-carboxamidotryptamine, L692,247 and DOI were potent agonists. However, 2-methyl-5-HT, cisapride, BW723C86, 8-OH-DPAT and 5-nonyloxytryptamine, mCPP and MK212 were less effective. Ketanserin and methysergide decreased the 5-HT-induced ileal contraction, but neither GR113808 nor SB269970 inhibited the responses. In conclusion, 5-HT causes contraction of the proventriculus via 5-HT(2C)-like receptors present on smooth muscle. 5-HT also causes contraction of the ileum, but the underlying mechanisms are complex, involving neural and smooth muscle components, and both 5-HT(1)- and 5-HT(2)-like receptors. Neural 5-HT receptors similar to 5-HT(3)/5-HT(4) receptors were not found in the chicken proventriculus and ileum.

From dimensional considerations it is deduced that in wind–windsea equilibrium the fluid dynamical conditions can be described by only two nondimensional parameters. One is the wave age for the representative windsea. This describes the degree of windsea development relative to the local wind. The other is the windsea Reynolds number RB, which is defined by u 2 /νσp, where u∗ is the air friction velocity, ν is the air kinematic viscosity, and σp is the angular frequency at the windsea spectral peak. RBwas introduced by Toba and Koga in 1986, and formerly it was denoted as the breaking-wave parameter. It is the fundamental controlling parameter for the windsea boundary layer, and consequently for the behavior of air–sea transfers. RBis shown to be much superior to the 10-m wind speed, U10 or u∗, in studying the behavior of transfer coefficients. The air–sea CO2 transfer has traditionally been expressed in terms of a transfer velocity kLas a function of U10. We propose the use of a nondimensional transfer

Four cases of Jatene procedure with arch repair were performed since 2000 in our department. Two-stage repair was used in all cases and the extended end-to-end anastomosis and pulmonary artery banding (PAB) were performed in 3 cases as the initial repair. In a recent case of TGA type I with coarctation of the aorta (CoA), only subclavian flap aortoplasty was performed when he was 6-day-old and patent ductus arteriosus (PDA) was preserved and rapid two-stage Jatene procedure was performed when he was 8-day-old. There was no hospital or late death, or reoperation. The results of the two-stage Jatene procedure with arch repair was good and safe. Rapid two-stage repair was thought to be a useful choice especially for TGA type I with arch anomaly.

A 7-month-old girl was referred to us for further examination of absence of the right pulmonary artery. She had no symptom at that time. Diagnosis was made by chest computed tomography (CT) and cardiac catheterization. Though the size of the right pulmonary artery was not apparent, right pulmonary vein wedge angiography revealed the distal portion of right pulmonary artery sufficient for surgical repair. But the distance between the pulmonary trunk and right pulmonary artery was too far to perform direct anastomosis, and some systemic collaterals had already been recognized. Pulmonary vasculature was also not inadequate. Therefore we planned a palliative procedure. At the age of 7 months, right modified Blalock-Tausig shunt using 5mm expand-polytetrafluoroethylene (ePTFE) tube and angioplasty of the distal portion of right pulmonary artery using autologous pericardium roll with Dacron mesh was performed. Postoperative course was uneventful. She has been followed up for 6 months after the palliation. In the near future the completion of the definitive repair will be considered.

A combined linear and logarithmic image sensor is implemented in a 0.35 /spl mu/m 1P3M technology. The pixel is 7.5/spl times/7.5 /spl mu/m/sup 2/ with a 37% fill factor and contains only 4 transistors. Offset calibration in the logarithmic region is realized by using electrical charge injection into the photodiode. The sensor achieves 120 dB DR and the offset calibration reduces the FPN from 13 mV to 5 mV.

We report our experience using a sutureless technique for oozing type postinfarction left ventricular free wall rupture. Several materials such as fibrin seat, autologous or heterologous pericardial patch, fibrin glue, and geratin-resorcin-formaldehyde (GRF) glue have been used. Nine patients, who developed postinfarction left ventricular free wall rupture, underwent surgical repair using a sutureless technique between 1999 and 2004. All patients survived and discharged our hospital without any postoperative complications. And all are alive an exellent condition in 5 to 44 months. A sutureless technique for the treatment of oozing type postinfarction left ventricular free wall rupture is simple, effective, and associated with a favorable outcome.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

(1) The effects on the whole-cell carbachol-induced muscarinic cationic current (mIcat) of antibodies against the alpha-subunits of various G proteins, as well as the effect of a Gbetagamma subunit, were studied in single guinea-pig ileal smooth muscle cells voltage-clamped at -50 mV. Ionized intracellular calcium concentration, [Ca(2+)](i), was clamped at 100 nM using a 1,2-bis(2-aminophenoxyl-ethane-N,N,N',N'-tetraacetic acid)/Ca(2+) mixture. (2) Application of ascending concentrations of carbachol (1-300 micro M) activated mIcat (mean amplitude 0.83 nA at 300 micro M carbachol; EC(50) 8 micro M; Hill slope 1.0). A 20 min or longer intracellular application via the pipette solution of G(i3)/G(o) or G(o) antibodies resulted in about a 70% depression of the maximum response without change in the EC(50) value. In contrast, antibodies against alpha-subunits of G(i1), G(i1)/G(i2), G(i3), G(q)/G(11) or G(s) protein over a similar or longer period did not significantly reduce mIcat. Antibodies to common Gbeta or infusion of the Gbetagamma subunit itself had no effect on mIcat. (3) If cells were exposed briefly to carbachol (50 or 100 micro M) at early times (3 min) after infusion of antibodies to Galpha(i3)/Galpha(o) or to Galpha(o) had begun, carbachol responses remained unchanged even after 20-60 min; that is, the depression of mIcat by these antibodies was prevented. (4) These data show that Galpha(o) protein couples the muscarinic receptor to the cationic channel in guinea-pig ileal longitudinal smooth muscle and that Gbetagamma is not involved. They also show that prior activation of the muscarinic receptor presumably causes a long-lasting postactivation change of the G protein, which is not reflected in mIcat, but acts to hinder antibody binding.

In this paper, we study axially symmetric solutions with $B=2-5$ in the chiral quark soliton model.In the background of axially symmetric chiral fields, the quark eigenstates and profile functions of the chiral fields are computed self-consistently. The resultant quark bound spectrum are doubly degenerate due to the symmetry of the chiral field. Upon quantization, various observable spectra of the chiral solitons are obtained. Taking account of the Finkelstein-Rubinstein constraints, we show that our results exactly coincide with the physical observations for B=2 and 4 while B=3 and 5 do not., 19 pages, 11 figures, 5 tables

This paper describes the implementation of a BIST circuit with timing margin test functions to a 200 MHz 1 Gbit synchronous DRAM. 220 ps-resolution timing signals with up to 80 ns cycle time are generated by a phase-locked loop (PLL) circuit and a delayed timing generator. These timing signals are used not only as actual control signals but also as reference signals in an AC timing comparator. The entire BIST circuit, which includes 20/spl times/4 bit LFSRs, occupies only 0.8% of the chip area. A cost evaluation of the BIST shows that the technology is effective for 64 Mbit high-speed DRAMs and beyond.

Recessed LOCOS isolation using high pressure dry O/sub 2/ oxidation has been studied. The effect of the high pressure dry O/sub 2/ oxidation on the bird's beak encroachment was clarified. This advanced LOCOS process was found to provide superior gate oxide integrity and junction characteristics. It meets the required isolation characteristics for 256 Mbit DRAM and beyond while maintaining the process simplicity.

The aim of the work is to develop basic techniques of an oceanographic vertical observation buoy system to keep the position within some area, such as a warm-core. The authors have designed and tested experimentally a prototype of a dynamic positioning buoy with GPS. The authors describe the design and examination of the prototype in detail and discuss the problem of practical use.