Search

Antibiotic persistence describes the presence of phenotypic variants within an isogenic bacterial population that are transiently tolerant to antibiotic treatment. Perturbations of metabolic homeostasis can promote antibiotic persistence, but the precise mechanisms are not well understood. Here, we use laboratory evolution, population-wide sequencing and biochemical characterizations to identify mutations in respiratory complex I and discover how they promote persistence in Escherichia coli. We show that persistence-inducing perturbations of metabolic homeostasis are associated with cytoplasmic acidification. Such cytoplasmic acidification is further strengthened by compromised proton pumping in the complex I mutants. While RpoS regulon activation induces persistence in the wild type, the aggravated cytoplasmic acidification in the complex I mutants leads to increased persistence via global shutdown of protein synthesis. Thus, we propose that cytoplasmic acidification, amplified by a compromised complex I, can act as a signaling hub for perturbed metabolic homeostasis in antibiotic persisters., (© 2022. The Author(s).)

Methicillin-resistant Staphylococcus aureu s (MRSA) infections represent a difficult clinical treatment issue. Recently, a novel phenotype was discovered amongst selected MRSA which exhibited enhanced β-lactam susceptibility in vitro in the presence of NaHCO 3 (termed 'NaHCO 3 -responsiveness'). This increased β-lactam susceptibility phenotype has been verified in both ex vivo and in vivo models. Mechanistic studies to-date have implicated NaHCO 3 -mediated repression of genes involved in the production, as well as maturation, of the alternative penicillin-binding protein (PBP) 2a, a necessary component of MRSA β-lactam resistance. Herein, we utilized RNA-sequencing (RNA-seq) to identify genes that were differentially expressed in NaHCO 3 -responsive (MRSA 11/11) vs. non-responsive (COL) strains, in the presence vs. absence of NaHCO 3 -β-lactam co-exposures. These investigations revealed that NaHCO 3 selectively repressed the expression of a cadre of genes in strain 11/11 known to be a part of the sigB - sarA - agr regulon, as well as a number of genes involved in the anchoring of cell wall proteins in MRSA. Moreover, several genes related to autolysis, cell division, and cell wall biosynthesis/remodeling, were also selectively impacted by NaHCO 3 -OXA exposure in the NaHCO 3 -responsive strain MRSA 11/11. These outcomes provide an important framework for further studies to mechanistically verify the functional relevance of these genetic perturbations to the NaHCO 3 -responsiveness phenotype in MRSA.

The dental cariogenic pathogen Streptococcus mutans coordinates competence for genetic transformation via two peptide pheromones, competence stimulating peptide (CSP) and comX -inducing peptide (XIP). CSP is sensed by the comCDE system and induces competence indirectly, whereas XIP is sensed by the comRS system and induces competence directly. In chemically defined media (CDM), after uptake by oligopeptide permease, XIP interacts with the cytosolic receptor ComR to form the XIP::ComR complex that activates the expression of comX , an alternative sigma factor that initiates the transcription of late-competence genes. In this study, we set out to determine the molecular mechanism of XIP::ComR interaction. To this end, we performed systematic replacement of the amino acid residues in the XIP pheromone and assessed the ability of the mutated analogs to modulate the competence regulon in CDM. We were able to identify structural features that are important to ComR binding and activation. Our structure-activity relationship insights led us to construct multiple XIP-based inhibitors of the comRS pathway. Furthermore, when comCDE and comRS were both stimulated with CSP and XIP, respectively, a lead XIP-based inhibitor was able to maintain the inhibitory activity. Last, phenotypic assays were used to highlight the potential of XIP-based inhibitors to attenuate pathogenicity in S. mutans and to validate the specificity of these compounds to the comRS pathway within the competence regulon. The XIP-based inhibitors developed in this study can be used as lead scaffolds for the design and development of potential therapeutics against S. mutans infections.

Extensive application of methylene blue (MB) for therapeutic and diagnostic purposes, and reports for unwanted side effects, demand better understanding of the mechanisms of biological action of this thiazine dye. Because MB is redox-active, its biological activities have been attributed to transfer of electrons, generation of reactive oxygen species, and antioxidant action. Results of this study show that MB is more toxic to a superoxide dismutase-deficient Escherichia coli mutant than to its SOD-proficient parent, which indicates that superoxide anion radical is involved. Incubation of E. coli with MB induced the enzymes fumarase C, SOD, nitroreductase A, and glucose-6-phosphate dehydrogenase, all controlled by the soxRS regulon. Induction of these enzymes was prevented by blocking protein synthesis with chloramphenicol and was not observed when soxRS-negative mutants were incubated with MB. These results show that MB is capable of inducing the soxRS regulon of E. coli, which plays a key role in protecting bacteria against oxidative stress and redox-cycling compounds. Irrespective of the abundance of heme-containing proteins in living cells, which are preferred acceptors of electrons from the reduced form of MB, reduction of oxygen to superoxide radical still takes place. Induction of the soxRS regulon suggests that in humans, beneficial effects of MB could be attributed to activation of redox-sensitive transcription factors like Nrf2 and FoxO. If defense systems are compromised or genes coding for protective proteins are not induced, MB would have deleterious effects., (Copyright © 2020 Elsevier B.V. All rights reserved.)

The toxic effect of strained hydrocarbon 2,2'-bis (bicyclo[2.2.1]heptane) (BBH) was studied using whole-cell bacterial lux-biosensors based on Escherichia coli cells in which luciferase genes are transcriptionally fused with stress-inducible promoters. It was shown that BBH has the genotoxic effect causing bacterial SOS response however no alkylating effect has been revealed. In addition to DNA damage, there is an oxidative effect causing the response of OxyR/S and SoxR/S regulons. The most sensitive to BBH lux-biosensor was E. coli pSoxS-lux which reacts to the appearance of superoxide anion radicals in the cell. It is assumed that the oxidation of BBH leads to the generation of reactive oxygen species, which provide the main contribution to the genotoxicity of this substance., Competing Interests: The authors have declared that no competing interests exist.

Stress response pathways are critical for cellular homeostasis, promoting survival through adaptive changes in gene expression and metabolism. They play key roles in numerous diseases and are implicated in cancer progression and chemoresistance. However, the underlying mechanisms are only poorly understood. We have employed a multi-omics approach to monitor changes to gene expression after induction of a stress response pathway, the unfolded protein response (UPR), probing in parallel the transcriptome, the proteome, and changes to translation. Stringent filtering reveals the induction of 267 genes, many of which have not previously been implicated in stress response pathways. We experimentally demonstrate that UPR-mediated translational control induces the expression of enzymes involved in a pathway that diverts intermediate metabolites from glycolysis to fuel mitochondrial one-carbon metabolism. Concomitantly, the cells become resistant to the folate-based antimetabolites Methotrexate and Pemetrexed, establishing a direct link between UPR-driven changes to gene expression and resistance to pharmacological treatment.

Objective: The present study was carried out to investigate the transcriptional response of marA (Multiple antibiotic resistance A gene), soxS (Superoxide S gene) and rob (Right-origin-binding gene) under carbapenem stress., Results: 12 isolates were found over-expressing AcrAB-TolC efflux pump system and showed reduced expression of OmpF (Outer membrane porin) gene were selected for further study. Among them, over expression of marA and rob was observed in 7 isolates. Increasing pattern of expression of marA and rob against meropenem was observed. The clones of marA and rob showed reduced susceptibility towards carbapenems.

Streptococcus pneumoniae is an opportunistic human pathogen that utilizes the competence regulon, a quorum-sensing circuitry, to acquire antibiotic resistance genes and initiate its attack on the human host. Interception of the competence regulon can therefore be utilized to study S. pneumoniae cell-cell communication and behavioral changes, as well as attenuate S. pneumoniae infectivity. Herein we report the design and synthesis of cyclic dominant negative competence-stimulating peptide (dnCSP) analogs capable of intercepting the competence regulon in both S. pneumoniae specificity groups with activities at the low nanomolar range. Structural analysis of lead analogs provided important insights as to the molecular mechanism that drives CSP receptor binding and revealed that the pan-group cyclic CSPs exhibit a chimeric hydrophobic patch conformation that resembles the hydrophobic patches required for both ComD1 and ComD2 binding. Moreover, the lead cyclic dnCSP, CSP1-E1A-cyc(Dap6E10), was found to possess superior pharmacological properties, including improved resistance to enzymatic degradation, while remaining nontoxic. Lastly, CSP1-E1A-cyc(Dap6E10) was capable of attenuating mouse mortality during acute pneumonia caused by both group 1 and group 2 S. pneumoniae strains. This cyclic pan-group dnCSP is therefore a promising drug lead scaffold against S. pneumoniae infections that could be administered individually or utilized in combination therapy to augment the effects of current antimicrobial agents., Competing Interests: The authors declare no competing interest.

We explored quenching of the PlcR-PapR quorum-sensing system in Bacillus cereus. We generated PapR7-peptidic derivatives that inhibit this system and thus the production of virulence factors, reflected by a loss in hemolytic activity, without affecting bacterial growth. To our knowledge, these peptides represent the first potent synthetic inhibitors of quorum-sensing in B. cereus.

Recent physiological studies indicated that S. lividans metabolism was mainly glycolytic, whereas S. coelicolor metabolism was mainly oxidative. To determine whether such metabolic characteristics were correlated with consistent proteomics features, a comparative label-free, shotgun proteomics analysis of these strains was carried out. Among 2024 proteins identified, 360 showed significant differences in abundance between the strains. This study revealed that S. coelicolor catabolized glucose less actively than S. lividans, whereas the amino acids present in the medium were catabolized less actively by S. lividans than by S. coelicolor. The abundance of glycolytic proteins in S. lividans was consistent with its high glycolytic activity, whereas the abundance of proteins involved in the catabolism of amino acids in S. coelicolor provided an explanatory basis for its predominantly oxidative metabolism. In this study, conducted under conditions of low O 2 availability, proteins involved in resistance to oxidative stress and those belonging to a DosR-like dormancy regulon were abundant in S. coelicolor, whereas tellurium resistance proteins were abundant in S. lividans. This indicated that the strains reacted differently to O 2 limitation. Proteins belonging to the CDA, RED, and ACT pathways, usually highly expressed in S. coelicolor, were not detected under these conditions, whereas proteins of siderophores, 5-hydroxyectoine, and terpenoid biosynthetic pathways were present.

Pseudomonas aeruginosa is an important nosocomial pathogen that is frequently recalcitrant to available antibiotics, underlining the urgent need for alternative therapeutic options against this pathogen. Targeting virulence functions is a promising alternative strategy as it is expected to generate less-selective resistance to treatment compared to antibiotics. Capitalizing on our nonligand-based benzamide-benzimidazole (BB) core structure compounds reported to efficiently block the activity of the P. aeruginosa multiple virulence factor regulator MvfR, here we report the first class of inhibitors shown to interfere with PqsBC enzyme activity, responsible for the synthesis of the MvfR activating ligands HHQ and PQS, and the first to target simultaneously MvfR and PqsBC activity. The use of these compounds reveals that inhibiting PqsBC is sufficient to block P. aeruginosa's acute virulence functions, as the synthesis of MvfR ligands is inhibited. Our results show that MvfR remains the best target of this QS pathway, as we show that antagonists of this target block both acute and persistence-related functions. The structural properties of the compounds reported in this study provide several insights that are instrumental for the design of improved MvfR regulon inhibitors against both acute and persistent P. aeruginosa infections. Moreover, the data presented offer the possibility of a polypharmacology approach of simultaneous silencing two targets in the same pathway. Such a combined antivirulence strategy holds promise in increasing therapeutic efficacy and providing alternatives in the event of a single target's resistance development.

Proteotoxic stress, which is generated by the accumulation of unfolded or aberrant proteins due to environmental or cellular perturbations, can be mitigated by several mechanisms, including activation of the unfolded protein response and coordinated increases in protein chaperones and activities that direct proteolysis, such as the 26S proteasome. Using RNA-seq analyses combined with chemical inhibitors or mutants that induce proteotoxic stress by impairing 26S proteasome capacity, we defined the transcriptional network that responds to this stress in Arabidopsis thaliana This network includes genes encoding core and assembly factors needed to build the complete 26S particle, alternative proteasome capping factors, enzymes involved in protein ubiquitylation/deubiquitylation and cellular detoxification, protein chaperones, autophagy components, and various transcriptional regulators. Many loci in this proteasome-stress regulon contain a consensus cis-element upstream of the transcription start site, which was previously identified as a binding site for the NAM/ATAF1/CUC2 78 (NAC78) transcription factor. Double mutants disrupting NAC78 and its closest relative NAC53 are compromised in the activation of this regulon and notably are strongly hypersensitive to the proteasome inhibitors MG132 and bortezomib. Given that NAC53 and NAC78 homo- and heterodimerize, we propose that they work as a pair in activating the expression of numerous factors that help plants survive proteotoxic stress and thus play a central regulatory role in maintaining protein homeostasis., (© 2016 American Society of Plant Biologists. All rights reserved.)

Cth2 is an mRNA-binding protein that participates in remodeling yeast cell metabolism in iron starvation conditions by promoting decay of the targeted molecules, in order to avoid excess iron consumption. This study shows that in the absence of Cth2 immediate upregulation of expression of several of the iron regulon genes (involved in high affinity iron uptake and intracellular iron redistribution) upon oxidative stress by hydroperoxide is more intense than in wild type conditions where Cth2 is present. The oxidative stress provokes a temporary increase in the levels of Cth2 (itself a member of the iron regulon). In such conditions Cth2 molecules accumulate at P bodies-like structures when the constitutive mRNA decay machinery is compromised. In addition, a null Δcth2 mutant shows defects, in comparison to CTH2 wild type cells, in exit from α factor-induced arrest at the G1 stage of the cell cycle when hydroperoxide treatment is applied. The cell cycle defects are rescued in conditions that compromise uptake of external iron into the cytosol. The observations support a role of Cth2 in modulating expression of diverse iron regulon genes, excluding those specifically involved in the reductive branch of the high-affinity transport. This would result in immediate adaptation of the yeast cells to an oxidative stress, by controlling uptake of oxidant-promoting iron cations.

A number of TP53-MDM2 inhibitors are currently under investigation as therapeutic agents in a variety of clinical trials in patients with TP53 wild type tumors. Not all wild type TP53 tumors are sensitive to such inhibitors. In an attempt to improve selection of patients with TP53 wild type tumors, an mRNA expression signature based on 13 TP53 transcriptional target genes was recently developed (Jeay et al. 2015). Careful reanalysis of TP53 status in the study validation data set of cancer cell lines considered to be TP53 wild type detected TP53 inactivating alterations in 23% of cell lines. The subsequent reanalysis of the remaining TP53 wild type cell lines clearly demonstrated that unfortunately the 13-gene signature cannot predict response to TP53-MDM2 inhibitor in TP53 wild type tumors.

Mycobacterium tuberculosis must sense and adapt to host environmental cues to establish and maintain an infection. The two-component regulatory system PhoPR plays a central role in sensing and responding to acidic pH within the macrophage and is required for M. tuberculosis intracellular replication and growth in vivo. Therefore, the isolation of compounds that inhibit PhoPR-dependent adaptation may identify new antivirulence therapies to treat tuberculosis. Here, we report that the carbonic anhydrase inhibitor ethoxzolamide inhibits the PhoPR regulon and reduces pathogen virulence. We show that treatment of M. tuberculosis with ethoxzolamide recapitulates phoPR mutant phenotypes, including downregulation of the core PhoPR regulon, altered accumulation of virulence-associated lipids, and inhibition of Esx-1 protein secretion. Quantitative single-cell imaging of a PhoPR-dependent fluorescent reporter strain demonstrates that ethoxzolamide inhibits PhoPR-regulated genes in infected macrophages and mouse lungs. Moreover, ethoxzolamide reduces M. tuberculosis growth in both macrophages and infected mice. Ethoxzolamide inhibits M. tuberculosis carbonic anhydrase activity, supporting a previously unrecognized link between carbonic anhydrase activity and PhoPR signaling. We propose that ethoxzolamide may be pursued as a new class of antivirulence therapy that functions by modulating expression of the PhoPR regulon and Esx-1-dependent virulence., (Copyright © 2015, American Society for Microbiology. All Rights Reserved.)

Bacillus pumilus is characterized by a higher oxidative stress resistance than other comparable industrially relevant Bacilli such as B. subtilis or B. licheniformis. In this study the response of B. pumilus to oxidative stress was investigated during a treatment with high concentrations of hydrogen peroxide at the proteome, transcriptome and metabolome level. Genes/proteins belonging to regulons, which are known to have important functions in the oxidative stress response of other organisms, were found to be upregulated, such as the Fur, Spx, SOS or CtsR regulon. Strikingly, parts of the fundamental PerR regulon responding to peroxide stress in B. subtilis are not encoded in the B. pumilus genome. Thus, B. pumilus misses the catalase KatA, the DNA-protection protein MrgA or the alkyl hydroperoxide reductase AhpCF. Data of this study suggests that the catalase KatX2 takes over the function of the missing KatA in the oxidative stress response of B. pumilus. The genome-wide expression analysis revealed an induction of bacillithiol (Cys-GlcN-malate, BSH) relevant genes. An analysis of the intracellular metabolites detected high intracellular levels of this protective metabolite, which indicates the importance of bacillithiol in the peroxide stress resistance of B. pumilus.

Background: Mycobacterium tuberculosis senses and responds to the shifting and hostile landscape of the host. To characterize the underlying intertwined gene regulatory network governed by approximately 200 transcription factors of M. tuberculosis, we have assayed the global transcriptional consequences of overexpressing each transcription factor from an inducible promoter., Results: We cloned and overexpressed 206 transcription factors in M. tuberculosis to identify the regulatory signature of each. We identified 9,335 regulatory consequences of overexpressing each of 183 transcription factors, providing evidence of regulation for 70% of the M. tuberculosis genome. These transcriptional signatures agree well with previously described M. tuberculosis regulons. The number of genes differentially regulated by transcription factor overexpression varied from hundreds of genes to none, with the majority of expression changes repressing basal transcription. Exploring the global transcriptional maps of transcription factor overexpressing (TFOE) strains, we predicted and validated the phenotype of a regulator that reduces susceptibility to a first line anti-tubercular drug, isoniazid. We also combined the TFOE data with an existing model of M. tuberculosis metabolism to predict the growth rates of individual TFOE strains with high fidelity., Conclusion: This work has led to a systems-level framework describing the transcriptome of a devastating bacterial pathogen, characterized the transcriptional influence of nearly all individual transcription factors in M. tuberculosis, and demonstrated the utility of this resource. These results will stimulate additional systems-level and hypothesis-driven efforts to understand M. tuberculosis adaptations that promote disease.

Nitrofurantoin and phenazopyridine are two drugs commonly used against urinary tract infections. Both compounds exert oxidative damage in patients deficient in glucose-6-phosphate dehydrogenase. This study was done to assess the interactions of these drugs with the soxRS regulon of Escherichia coli, a superoxide-defense system (that includes a nitroreductase that yields the active metabolite of nitrofurantoin) involved in antibiotic multi-resistance. The effects of either nitrofurantoin or phenazopyridine, upon strains with different soxRS genotypes, were measured as minimum inhibitory concentrations (MICs) and growth curves. Also, the ability of these drugs to induce the expression of a soxS'::lacZ gene fusion was assessed. The effect of antibiotics in the presence of phenazopyridine, paraquat (a known soxRS inducer), or an efflux inhibitor, was measured using the disk diffusion method. A strain constitutively expressing the soxRS regulon was slightly more susceptible to nitrofurantoin, and more resistant to phenazopyridine, compared to wild-type and soxRS-deleted strains, during early treatment, but 24-h MICs were the same (8 mg/l nitrofurantoin, 1,000 mg/l phenazopyridine) for all strains. Both compounds were capable of inducing the expression of a soxS'::lacZ fusion, but less than paraquat. Subinhibitory concentrations of phenazopyridine increased the antimicrobial effect of ampicillin, chloramphenicol, tetracycline, and nitrofurantoin. The induction or constitutive expression of the soxRS regulon seems to be a disadvantage for E. coli during nitrofurantoin exposure; but might be an advantage during phenazopyridine exposure, indicating that the latter compound could act as a selective pressure for mutations related to virulence and antibiotic multi-resistance.

Background: Organisms of the genus Clostridium are Gram-positive endospore formers of great importance to the carbon cycle, human normo- and pathophysiology, but also in biofuel and biorefinery applications. Exposure of Clostridium organisms to chemical and in particular toxic metabolite stress is ubiquitous in both natural (such as in the human microbiome) and engineered environments, engaging both the general stress response as well as specialized programs. Yet, despite its fundamental and applied significance, it remains largely unexplored at the systems level., Results: We generated a total of 96 individual sets of microarray data examining the transcriptional changes in C. acetobutylicum, a model Clostridium organism, in response to three levels of chemical stress from the native metabolites, butanol and butyrate. We identified 164 significantly differentially expressed transcriptional regulators and detailed the cellular programs associated with general and stressor-specific responses, many previously unexplored. Pattern-based, comparative genomic analyses enabled us, for the first time, to construct a detailed picture of the genetic circuitry underlying the stress response. Notably, a list of the regulons and DNA binding motifs of the stress-related transcription factors were identified: two heat-shock response regulators, HrcA and CtsR; the SOS response regulator LexA; the redox sensor Rex; and the peroxide sensor PerR. Moreover, several transcriptional regulators controlling stress-responsive amino acid and purine metabolism and their regulons were also identified, including ArgR (arginine biosynthesis and catabolism regulator), HisR (histidine biosynthesis regulator), CymR (cysteine metabolism repressor) and PurR (purine metabolism repressor)., Conclusions: Using an exceptionally large set of temporal transcriptional data and regulon analyses, we successfully built a STRING-based stress response network model integrating important players for the general and specialized metabolite stress response in C. acetobutylicum. Since the majority of the transcription factors and their target genes are highly conserved in other organisms of the Clostridium genus, this network would be largely applicable to other Clostridium organisms. The network informs the molecular basis of Clostridium responses to toxic metabolites in natural ecosystems and the microbiome, and will facilitate the construction of genome-scale models with added regulatory-network dimensions to guide the development of tolerant strains.

Klebsiella pneumoniae has been frequently associated with nosocomial infections. Efflux systems are ubiquitous transporters that also function in drug resistance. Genome analysis of K. pneumoniae strain NTUH-K2044 revealed the presence of ∼15 putative drug efflux systems. We discuss here for the first time the characterization of a putative SMR-type efflux pump, an ebrAB homolog (denoted here as kpnEF) with respect to Klebsiella physiology and the multidrug-resistant phenotype. Analysis of hypermucoviscosity revealed direct involvement of kpnEF in capsule synthesis. The ΔkpnEF mutant displayed higher sensitivity to hyperosmotic (∼2.8-fold) and high bile (∼4.0-fold) concentrations. Mutation in kpnEF resulted in increased susceptibility to cefepime, ceftriaxone, colistin, erythromycin, rifampin, tetracycline, and streptomycin; mutated strains changed from being resistant to being susceptible, and the resistance was restored upon complementation. The ΔkpnEF mutant displayed enhanced sensitivity toward structurally related compounds such as sodium dodecyl sulfate, deoxycholate, and dyes, including clinically relevant disinfectants such as benzalkonium chloride, chlorhexidine, and triclosan. The prevalence of kpnEF in clinical strains broadens the diversity of antibiotic resistance in K. pneumoniae. Experimental evidence of CpxR binding to the efflux pump promoter and quantification of its expression in a cpxAR mutant background demonstrated kpnEF to be a member of the Cpx regulon. This study helps to elucidate the unprecedented biological functions of the SMR-type efflux pump in Klebsiella spp.

Background: High concentrations of reactive oxygen species (ROS) were reported to cause oxidative stress to E. coli cells associated with reduced or inhibited growth. The high ROS concentrations described in these reports were generated by exposing the bacteria to H2O2 and superoxide-generating chemicals which are non-physiological growth conditions. However, the effect of molecular oxygen on oxidative stress response has not been evaluated. Since the use of oxygen-enriched air is a common strategy to support high density growth of E. coli, it was important to investigate the effect of high dissolved oxygen concentrations on the physiology and growth of E. coli and the way it responds to oxidative stress., Results: To determine the effect of elevated oxygen concentrations on the growth characteristics, specific gene expression and enzyme activity in E. coli, the parental and SOD-deficient strain were evaluated when the dissolved oxygen (dO2) level was increased from 30% to 300%. No significant differences in the growth parameters were observed in the parental strain except for a temporary decrease of the respiration and acetate accumulation profile. By performing transcriptional analysis, it was determined that the parental strain responded to the oxidative stress by activating the SoxRS regulon. However, following the dO2 switch, the SOD-deficient strain activated both the SoxRS and OxyR regulons but it was unable to resume its initial growth rate., Conclusion: The transcriptional analysis and enzyme activity results indicated that when E. coli is exposed to dO2 shift, the superoxide stress regulator SoxRS is activated and causes the stimulation of the superoxide dismutase system. This enables the E. coli to protect itself from the poisoning effects of oxygen. The OxyR protecting system was not activated, indicating that H2O2 did not increase to stressing levels.

Burkholderia cepacia complex strains communicate using N-acyl homoserine lactones and BDSF-dependent quorum sensing (QS) systems. Burkholderia cenocepacia QS systems include CepIR, CciIR, CepR2 and BDSF. Analysis of CepR, CciIR, CepR2 and RpfF (BDSF synthase) QS regulons revealed that these QS systems both independently regulate and coregulate many target genes, often in an opposing manner. The role of QS and several QS-regulated genes in virulence has been determined using vertebrate, invertebrate and plant infection models. Virulence phenotypes are strain and model dependent, suggesting that different QS-regulated genes are important depending on the strain and type of infection. QS inhibitors in combination with antibiotics can reduce biofilm formation and virulence in infection models.

Current tuberculosis treatment regimens are notoriously limited, lengthy and becoming increasingly ineffective due to the emergence of drug-resistant mutant strains of Mycobacterium tuberculosis. The intrinsic resistance of M. tuberculosis to the majority of available drugs relies both on the impermeability of its cell envelope, and its ability to activate specific genes and physiological states. WhiB7 is a transcriptional regulatory protein underlying this adaptive process. Transcription of the whiB7 gene is upregulated in response to a variety of antibiotics having different structures and targets, as well as in response to metabolic signals. The whiB7 regulon activates various systems of intrinsic drug resistance involving antibiotic export, antibiotic inactivation (by chemical modifications of the drug or its target) and significant changes to thiol redox balance. Drugs have been identified that inactivate resistance determinants in the whiB7 regulon, thereby potentiating the activities of diverse antibiotics against M. tuberculosis.

AtoSC two-component system plays a pivotal role in many regulatory indispensable Escherichia coli processes. AtoSCDAEB regulon, comprising the AtoSC system and the atoDAEB operon, regulates the short-chain fatty acids catabolism. We report here, that AtoSC up-regulates the high-molecular weight PHB biosynthesis, in recombinant phaCAB(+)E. coli, with the Cupriavidus necator phaCAB operon. PHB accumulation was maximized upon the acetoacetate-mediated induction of AtoSC, under glucose 1% w/v, resulting in a yield of 1.73 g/l with a biopolymer content of 64.5% w/w. The deletion of the atoSC locus, in the ΔatoSC strains, resulted in a 5 fold reduction of PHB accumulation, which was restored by the extrachromosomal introduction of the AtoSC system. The deletion of the atoDAEB operon triggered a significant decrease in PHB synthesis in ΔatoDAEB strains. However, the acetoacetate-induced AtoSC system in those strains increased PHB to 1.55 g/l, while AtoC expression increased PHB to 1.4 g/l upon acetoacetate. The complementation of the ΔatoDAEB phenotype was achieved by the extrachromosomal introduction of the atoSCDAEB regulon. The individual inhibition of β-oxidation and mainly fatty-acid biosynthesis pathways by acrylic acid or cerulenin respectively, reduced PHB biosynthesis. Under those conditions the introduction of the atoSC locus or the atoSCDAEB regulon was capable to up-regulate the biopolymer accumulation. The concurrent inhibition of both the fatty acids metabolic pathways eliminated PHB production. PHB up-regulation in phaCAB(+)E. coli, by AtoSC signaling through atoDAEB operon and its participation in the fatty acids metabolism interplay, provide additional perceptions of AtoSC critical involvement in E. coli regulatory processes towards the biotechnologically improved polyhydroxyalkanoates biosynthesis., (Copyright © 2012 Elsevier Inc. All rights reserved.)

The WalK (histidine kinase)/WalR (response regulator) two-component signal transduction system is a master regulatory system for cell wall metabolism and growth. This system is conserved in low G+C Gram-positive bacteria, including Bacillus subtilis, Staphylococcus aureus, Enterococcus faecalis, and Streptococcus mutans. In this study, we found the first antibiotic that functions as a WalK inhibitor (signermycin B) by screening 10,000 Streptomyces extracts. The chemical structure (C(23)H(35)NO(4); molecular weight, 389.5) comprises a tetramic acid moiety and a decalin ring. Signermycin B exhibited antimicrobial activity, with MIC values ranging from 3.13 μg/ml (8 μM) to 6.25 μg/ml (16 μM) against Gram-positive bacteria that possess the WalK/WalR two-component signal transduction system, including the drug-resistant bacteria methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis. The half-maximal inhibitory concentrations of signermycin B against WalK in these organisms ranged from 37 to 61 μM. To determine the mechanism of action of signermycin B, surface plasmon resonance response analysis with the two WalK domains of Bacillus subtilis and competition assay with ATP were performed. The results showed that signermycin B binds to the dimerization domain but not the ATP-binding domain of WalK. In the presence of the cross-linker glutaraldehyde, signermycin B did not cause protein aggregation but interfered with the cross-linking of WalK dimers. These results suggest that signermycin B targets the conserved dimerization domain of WalK to inhibit autophosphorylation. In Bacillus subtilis and Staphylococcus aureus, signermycin B preferentially controlled the WalR regulon, thereby inhibiting cell division. These phenotypes are consistent with those of cells starved for the WalK/WalR system.

Inactivation of PerR by oxidative stress and a corresponding increase in expression of the perR regulon genes is part of the oxidative stress defense in a variety of anaerobic bacteria. Diluted anaerobic, nearly sulfide-free cultures of mutant and wild-type Desulfovibrio vulgaris (10(5)-10(6) colony-forming units/ml) were treated with 0 to 2,500 μM H(2)O(2) for only 5 min to prevent readjustment of gene expression. Survivors were then scored by plating. The wild type and perR mutant had 50% survival at 58 and 269 μM H(2)O(2), respectively, indicating the latter to be 4.6-fold more resistant to killing by H(2)O(2) under these conditions. Significantly increased resistance of the wild type (38-fold; 50% killing at 2188 μM H(2)O(2)) was observed if cells were pretreated with full air for 30 min, conditions that did not affect cell viability. The resistance of the perR mutant increased less (4.6-fold; 50% killing at 1230 μM H(2)O(2)), when similarly pretreated. Interestingly, no increased resistance of either was achieved by exposure with 10.6 μM H(2)O(2) for 30 min, the highest concentration that could be used without killing the cells. Hence, in environments with low D. vulgaris biomass only the presence of external O(2) effectively activates the perR regulon. As a result, mutant strains lacking one of the perR regulon genes ahpC, dvu0772, rbr1 or rbr2 displayed decreased resistance to H(2)O(2) stress only following pretreatment with air.

The extremely radioresistant bacterium Deinococcus radiodurans possesses a rapid and efficient but poorly known DNA damage response mechanism that mobilizes one-third of its genome to survive lethal radiation damage. Deinococcal PprI serves as a general switch to regulate the expression of dozens of proteins from different pathways after radiation, including the DNA repair proteins RecA, PprA and SSB. However, the underlying mechanism is poorly understood. In this study, we analyzed the dynamic alteration in global transcriptional profiles in wildtype and pprI mutant strains by combining microarrays and time-course sampling. We found that PprI up-regulated transcription of at least 210 genes after radiation, including 21 DNA repair and replication-related genes. We purified PprI and a helix-turn-helix (HTH) domain mutant and found that PprI specifically bound to the promoters of recA and pprA in vitro but did not bind nonspecific double-strand DNA. Chromatin immunoprecipitation (ChIP) assays confirmed that PprI specifically interacted with the promoter DNA of recA and pprA after radiation. Finally, we showed that a DNA-binding activity-deficient pprI mutant only partially restored resistance of the pprI mutant strain to γ radiation, UV radiation, and mitomycin C. Taken together, these results indicate that DNA-binding activity is essential for PprI to program the DNA repair process and cellular survival of D. radiodurans in response to radiation damage., (Copyright © 2011 Elsevier B.V. All rights reserved.)

The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σ(M). Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses.

Competence stimulating peptide (CSP) is a 17-amino acid peptide pheromone secreted by Streptococcus pneumoniae. Upon binding of CSP to its membrane-associated receptor kinase ComD, a cascade of signaling events is initiated, leading to activation of the competence regulon by the response regulator ComE. Genes encoding proteins that are involved in DNA uptake and transformation, as well as virulence, are upregulated. Previous studies have shown that disruption of key components in the competence regulon inhibits DNA transformation and attenuates virulence. Thus, synthetic analogues that competitively inhibit CSPs may serve as attractive drugs to control pneumococcal infection and to reduce horizontal gene transfer during infection. We performed amino acid substitutions on conserved amino acid residues of CSP1 in an effort to disable DNA transformation and to attenuate the virulence of S. pneumoniae. One of the mutated peptides, CSP1-E1A, inhibited development of competence in DNA transformation by outcompeting CSP1 in time and concentration-dependent manners. CSP1-E1A reduced the expression of pneumococcal virulence factors choline binding protein D (CbpD) and autolysin A (LytA) in vitro, and significantly reduced mouse mortality after lung infection. Furthermore, CSP1-E1A attenuated the acquisition of an antibiotic resistance gene and a capsule gene in vivo. Finally, we demonstrated that the strategy of using a peptide inhibitor is applicable to other CSP subtype, including CSP2. CSP1-E1A and CSP2-E1A were able to cross inhibit the induction of competence and DNA transformation in pneumococcal strains with incompatible ComD subtypes. These results demonstrate the applicability of generating competitive analogues of CSPs as drugs to control horizontal transfer of antibiotic resistance and virulence genes, and to attenuate virulence during infection by S. pneumoniae.

Pyrrolidine dithiocarbamate (PDTC), a known inhibitor of NFκB activation, has antioxidative as well as antiviral activities. PDTC is effective against several virus families, indicating that its antiviral mechanism targets host rather than viral functions. To investigate its mode of action, we used baker's yeast as a simple eukaryotic model system and two types of genome-wide analysis. First, expression profiling using whole-genome DNA microarrays identifies more than 200 genes differentially regulated upon PDTC exposure. Interestingly, the Aft1-dependent iron regulon is a main target of PDTC, indicating a lack of iron availability. Moreover, the PDTC-caused zinc influx triggers a strong regulatory effect on zinc transporters due to the cytoplasmic zinc excess. Second, phenotypic screening the EUROSCARF collection for PDTC hypersensitivity identifies numerous mutants implicated in vacuolar maintenance, acidification as well as in transport, mitochondrial organization, and translation. Notably, the screening data indicate significant overlaps of PDTC-sensitive genes and those mediating zinc tolerance. Hence, we show that PDTC induces cytoplasmic zinc excess, eliciting vacuolar detoxification, which in turn, disturbs iron homeostasis and activates the iron-dependent regulator Aft1. Our work reveals a complex crosstalk in yeast ion homeostasis and the underlying regulatory networks.

Cadmium is a toxic metal and the mechanism of its toxicity has been studied in various model systems from bacteria to mammals. We employed Saccharomyces cerevisiae as a model system to study cadmium toxicity at the molecular level because it has been used to identify the molecular mechanisms of toxicity found in higher organisms. cDNA microarray and Northern blot analyses revealed that cadmium salts inhibited the expression of genes related to copper metabolism. Western blotting, Northern blotting and chromatin immunoprecipitation experiments indicated that CTR1 expression was inhibited at the transcriptional level through direct inhibition of the Mac1 transcriptional activator. The decreased expression of CTR1 results in cellular copper deficiency and inhibition of Fet3 activity, which eventually impairs iron uptake. In this way, cadmium exhibits a negative effect on both iron and copper homoeostasis.

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DeltarecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2) and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

In the strict anaerobe Clostridium acetobutylicum, a PerR-homologous protein has recently been identified as being a key repressor of a reductive machinery for the scavenging of reactive oxygen species and molecular O(2). In the absence of PerR, the full derepression of its regulon resulted in increased resistance to oxidative stress and nearly full tolerance of an aerobic environment. In the present study, the complementation of a Bacillus subtilis PerR mutant confirmed that the homologous protein from C. acetobutylicum acts as a functional peroxide sensor in vivo. Furthermore, we used a transcriptomic approach to analyze gene expression in the aerotolerant PerR mutant strain and compared it to the O(2) stimulon of wild-type C. acetobutylicum. The genes encoding the components of the alternative detoxification system were PerR regulated. Only few other targets of direct PerR regulation were identified, including two highly expressed genes encoding enzymes that are putatively involved in the central energy metabolism. All of them were highly induced when wild-type cells were exposed to sublethal levels of O(2). Under these conditions, C. acetobutylicum also activated the repair and biogenesis of DNA and Fe-S clusters as well as the transcription of a gene encoding an unknown CO dehydrogenase-like enzyme. Surprisingly few genes were downregulated when exposed to O(2), including those involved in butyrate formation. In summary, these results show that the defense of this strict anaerobe against oxidative stress is robust and by far not limited to the removal of O(2) and its reactive derivatives.

The eukaryotic translation initiation factor eIF4E is dysregulated in many cancers. eIF4E, through its mRNA export and translation functions, combinatorially modulates the expression of genes involved in Akt dependent survival signaling. For these activities, eIF4E must bind the 7-methyl guanosine (m(7)G) cap moiety on the 5'-end of mRNAs. We demonstrate that a physical mimic of the m(7)G cap, ribavirin, inhibits eIF4E dependent Akt survival signaling. Specifically, ribavirin impairs eIF4E mediated Akt activation via inhibiting the production of an upstream activator of Akt, NBS1. Consequently, ribavirin impairs eIF4E dependent apoptotic rescue. A ribavirin analog with distinct physico-chemical properties, tiazofurin, does not impair eIF4E activity indicating that only analogs that mimic the m(7)G cap will inhibit eIF4E function. Ribavirin represents a first-in-class strategy to inhibit eIF4E dependent cancers, through competition for m(7)G cap binding. Thus, ribavirin coordinately impairs eIF4E dependent pathways and thereby, potently inhibits its biological effects.

Background: The antitumor drug daunorubicin exerts some of its cytotoxic effects by binding to DNA and inhibiting the transcription of different genes. We analysed this effect in vivo at the transcriptome level using the budding yeast Saccharomyces cerevisiae as a model and sublethal (IC40) concentrations of the drug to minimise general toxic effects., Results: Daunorubicin affected a minor proportion (14%) of the yeast transcriptome, increasing the expression of 195 genes and reducing expression of 280 genes. Daunorubicin down-regulated genes included essentially all genes involved in the glycolytic pathway, the tricarboxylic acid cycle and alcohol metabolism, whereas transcription of ribosomal protein genes was not affected or even slightly increased. This pattern is consistent with a specific inhibition of glucose usage in treated cells, with only minor effects on proliferation or other basic cell functions. Analysis of promoters of down-regulated genes showed that they belong to a limited number of transcriptional regulatory units (regulons). Consistently, data mining showed that daunorubicin-induced changes in expression patterns were similar to those observed in yeast strains deleted for some transcription factors functionally related to the glycolysis and/or the cAMP regulatory pathway, which appeared to be particularly sensitive to daunorubicin., Conclusion: The effects of daunorubicin treatment on the yeast transcriptome are consistent with a model in which this drug impairs binding of different transcription factors by competing for their DNA binding sequences, therefore limiting their effectiveness and affecting the corresponding regulatory networks. This proposed mechanism might have broad therapeutic implications against cancer cells growing under hypoxic conditions.

Proteomic and transcriptomics signatures are powerful tools for visualizing global changes in gene expression in bacterial cells after exposure to stress, starvation or toxic compounds. Based on the global expression profile and the dissection into specific regulons, this knowledge can be used to predict the mode of action for novel antimicrobial compounds. This review summarizes our recent progress of proteomic signatures in the model bacterium for low-GC Gram-positive bacteria Bacillus subtilis in response to the antimicrobial compounds phenol, catechol, salicylic acid, 2-methylhydroquinone (2-MHQ) and 6-brom-2-vinyl-chroman-4-on (chromanon). Catechol, 2-MHQ and diamide displayed a common mode of action, as revealed by the induction of the thiol-specific oxidative stress response. In addition, multiple dioxygenases/glyoxalases, azoreductases and nitroreductases were induced by thiol-reactive compounds that are regulated by two novel thiol-specific regulators, YodB and MhqR (YkvE), both of which contribute to electrophile resistance in B. subtilis. These novel thiol-stress-responsive mechanisms are highly conserved among Gram-positive bacteria and are thought to have evolved to detoxify quinone-like electrophiles.

Genome-wide transcriptome profiling was used to reveal hydrogen peroxide (H(2)O(2))-dependent regulatory mechanisms in the facultatively photosynthetic bacterium Rhodobacter sphaeroides. In this study we focused on the role of the OxyR protein, a known regulator of the H(2)O(2) response in bacteria. The transcriptome profiles of R. sphaeroides wild-type and oxyR mutant strains that were exposed to 1 mM H(2)O(2) for 7 min or were not exposed to H(2)O(2) were analyzed. Three classes of OxyR-dependent genes were identified based on their expression patterns in the wild type of oxyR mutant strains with differing predicted roles of oxidized and reduced OxyR as activators of transcription. DNA binding studies revealed that OxyR binds upstream of class I genes, which are induced by H(2)O(2) and exhibit similar basal levels of expression in the wild-type and oxyR mutant strains. The effect of OxyR on class II genes, which are also induced by H(2)O(2) but exhibit significantly lower basal levels of expression in the wild-type strain than in the mutant, is indirect. Interestingly, reduced OxyR also activates expression of few genes (class III). The role of reduced OxyR as an activator is shown for the first time. Our data reveal that the OxyR-mediated response is fast and transient. In addition, we found that additional regulatory pathways are involved in the H(2)O(2) response.

We compared the transcriptomes of Saccharomyces cerevisiae cells growing under steady-state conditions on 21 unique sources of nitrogen. We found 506 genes differentially regulated by nitrogen and estimated the activation degrees of all identified nitrogen-responding transcriptional controls according to the nitrogen source. One main group of nitrogenous compounds supports fast growth and a highly active nitrogen catabolite repression (NCR) control. Catabolism of these compounds typically yields carbon derivatives directly assimilable by a cell's metabolism. Another group of nitrogen compounds supports slower growth, is associated with excretion by cells of nonmetabolizable carbon compounds such as fusel oils, and is characterized by activation of the general control of amino acid biosynthesis (GAAC). Furthermore, NCR and GAAC appear interlinked, since expression of the GCN4 gene encoding the transcription factor that mediates GAAC is subject to NCR. We also observed that several transcriptional-regulation systems are active under a wider range of nitrogen supply conditions than anticipated. Other transcriptional-regulation systems acting on genes not involved in nitrogen metabolism, e.g., the pleiotropic-drug resistance and the unfolded-protein response systems, also respond to nitrogen. We have completed the lists of target genes of several nitrogen-sensitive regulons and have used sequence comparison tools to propose functions for about 20 orphan genes. Similar studies conducted for other nutrients should provide a more complete view of alternative metabolic pathways in yeast and contribute to the attribution of functions to many other orphan genes.

Natural transformation is a widespread mechanism for genetic exchange in bacteria. Aminoglycoside and fluoroquinolone antibiotics, as well as mitomycin C, a DNA-damaging agent, induced transformation in Streptococcus pneumoniae. This induction required an intact competence regulatory cascade. Furthermore, mitomycin C induction of recA was strictly dependent on the development of competence. In response to antibiotic stress, S. pneumoniae, which lacks an SOS-like system, exhibited genetic transformation. The design of antibiotherapy should take into consideration this potential of a major human pathogen to increase its rate of genetic exchange in response to antibiotics.

Metabolites accumulated in the culture medium of Escherichia coli cells induce expression of the rpoS gene encoding the alternative sigmaS subunit of RNA polymerase, which controls adaptation of E. coli to acid stress during growth in glucose-mineral medium. The effect of acetate and succinate as end products of E. coli metabolism has been investigated on the levels of transcription, translation, and sigmaS protein stability. These end products mainly influenced the stability of the RNA polymerase sigmaS subunit. Under conditions of acid stress caused by acetate addition, the content of polyamines in the cells and medium decreased, whereas artificial rpoS gene switch-off by antisense RNA was accompanied by increase in polyamine level. Addition of polyamine to E. coli cells treated with acetate and especially with succinate caused a significant concentration-dependent stimulatory effect on rpoS expression. Thus, induction of the rpoS regulon depends on the combined action of the investigated metabolites determining adequate control of gene expression under conditions of acid stress. A scheme for metabolic pathways describing the role of putrescine in the maintenance of intracellular pH and polyamine pool homeostasis during E. coli adaptation to acid stress is proposed.

Polyamines, ubiquitous polycationic compounds, are involved in many cellular responses and relieve paraquat-induced cytotoxicity in Escherichia coli. We constructed a new E. coli mutant strain, JIL528, which is deficient in the biosynthesis of both putrescine and spermidine, to examine the physiological role of polyamines under oxidative stress caused by paraquat. Putrescine and spermidine downregulate the expression of soxS induced by paraquat in a concentration-dependent manner. The product of SoxS is a key regulator governing cellular responses against oxidative stress in E. coli. The downregulation of soxS expression by polyamines was not shown in the soxR mutant background. Glucose-6-phosphate dehydrogenase (G6PDH; encoded by zwf) and manganese-containing superoxide dismutase (Mn-SOD; encoded by sodA) activities induced by paraquat were decreased by exogenous polyamines. The induction of the zwf expression by paraquat was also decreased by exogenous polyamines. The polyamine-deficient mutant strain JIL528 showed a higher soxS expression than its parent polyamine-proficient wild type BW1157, on exogenous supplementation of paraquat concentrations below 1 micromol/L. While the growth rate of the mutant was decreased, soxS expression was increased in a concentration-dependent manner above 0.01 micromol/L of paraquat. In contrast, growth inhibition of the mutant by paraquat was relieved, and soxS was no longer induced by exogenous putrescine (1 mmol/L). In conclusion, polyamines protect against paraquat-induced toxicity but downregulate soxS expression, suggesting that the protective role of polyamines against oxidative damage induced by paraquat results in soxS downregulation.

The ability of short-chain sugars to cause oxidative stress has been examined using glycolaldehyde as the simplest sugar. Short-chain sugars autoxidize in air, producing superoxide and alpha,beta-dicarbonyls. In Escherichia coli the soxRS regulon mediates an oxidative stress response, which protects the cell against both superoxide-generating agents and nitric oxide. In superoxide dismutase-deficient E. coli mutants, glycolaldehyde induces fumarase C and nitroreductase A, which are regulated as members of the soxRS regulon. A mutational defect in soxRS eliminates that induction. This establishes that glycolaldehyde can cause induction of this defensive regulon. This effect of glycolaldehyde was oxygen-dependent, was not shown by glyoxal, and was not seen in the superoxide dismutase-replete parental strain, and it was abolished by a cell-permeable SOD mimetic. All of these suggest that superoxide radicals produced by the oxidation of glycolaldehyde played a key role in the induction.

The mechanism of repression of the tyrB promoter by TyrR protein has been studied in vivo and in vitro. In tyrR+ strains, transcription of tyrB is repressed by either tyrosine or phenylalanine. Both of the TyrR binding sites (strong and weak TyrR boxes) lie downstream of the tyrB transcription start site and are required for tyrosine- or phenylalanine-mediated repression. Our results establish that the binding of the TyrR protein to the weak box, induced by cofactor tyrosine or phenylalanine, is critical for repression to occur. Neither the binding of the TyrR protein dimer formed in the presence of phenylalanine, nor the binding of the hexamer formed in the presence of tyrosine, blocks the binding of RNA polymerase to the promoter. Instead, open complex formation is inhibited in the presence of tyrosine whereas a step(s) following open complex formation is inhibited in the presence of phenylalanine. Moving the TyrR boxes 3 bp or more further away from the promoter affects tyrosine-mediated repression without affecting phenylalanine-mediated repression which remains unaltered until 6 bp are inserted between the TyrR boxes and the promoter. Analysis of deletion and insertion mutants fails to reveal any face of the helix specificity for either tyrosine- or phenylalanine-mediated repression.

Bacillus subtilis encodes seven extracytoplasmic function (ECF) sigma factors. The sigma(W) regulon includes functions involved in detoxification and protection against antimicrobials, whereas sigma(M) is essential for growth at high salt concentrations. We now report that antibiotics that inhibit cell wall biosynthesis induce both sigma(W) and sigma(M) regulons as monitored using DNA microarrays. Induction of selected sigma(W)-dependent genes was confirmed using lacZ reporter fusions and Northern blot analysis. The ability of vancomycin to induce the sigma(W) regulon is dependent on both sigma(W) and the cognate anti-sigma, RsiW, but is independent of the transition state regulator AbrB. These results suggest that the membrane-localized RsiW anti-sigma(W) factor mediates the transcriptional response to cell wall stress. Our findings are consistent with the idea that one function of ECF sigma factors is to coordinate antibiosis stress responses and cell envelope homeostasis.

Transcription of ResDE-controlled genes in Bacillus subtilis was induced by sodium nitroprusside and nitric oxide. This induction requires the sensor kinase ResE and the response regulator ResD. Among members of the ResDE regulon, only the flavohemoglobin gene was induced by nitrosative stress via both a ResDE-dependent mechanism and an unidentified ResDE-independent mechanism.

Activation of the Escherichia coli SoxRS-regulon by nitric oxide (NO) and its physiological donors (S-nitrosothiol (GS-NO) and dinitrosyl iron complexes with glutathione (DNIC(glu)) and cysteine (DNIC(cys)) ligands) has been studied. To elucidate the molecular mechanisms of signal transduction via nitrosylation of Fe-S-centers in SoxR, the ability of pure NO and NO-producing agents to activate the SoxRS-regulon in E. coli cells bearing a soxS::lacZ operon (promoter) fusion has been compared. EPR spectroscopy of whole cells has been used to monitor the formation of inducible protein-DNIC complexes. DNIC(cys), GS-NO, and pure NO appeared to be potent inducers of soxS expression, whereas DNIC(glu) was considerably less efficient. Thus, lower in vitro stability of DNIC(cys) was in contrast with its higher biological activity. Pretreatment of the cells with o-phenanthroline, a chelating agent for iron, prevented soxS expression by GS-NO. Treatment of intact E. coli cells with DNIC, GS-NO, and NO at equimolar concentration 150 microM resulted in formation of a single EPR-detectable DNIC-type signal with g = 2.03. The initial stage in the SoxR transcription activity is supposed to include two steps: first, DNIC primers are formed from exogenous NO and free iron, and then these DNIC disintegrate SoxR [2Fe-2S] clusters and thus activate SoxRS-regulon transcription.

The soxRS regulon orchestrates a multifaceted defense against oxidative stress, by inducing the transcription of approximately 15 genes. The induction of this regulon by redox agents, known to mediate O-2 production, led to the view that O-2 is one signal to which it responds. However, redox cycling agents deplete cellular reductants while producing O-2, and one may question whether the regulon responds to the depletion of some cytoplasmic reductant or to O-2, or both. We demonstrate that raising [O-2] by mutational deletion of superoxide dismutases and/or by addition of paraquat, both under aerobic conditions, causes induction of a member of the soxRS regulon and that a mutational defect in soxRS eliminates that induction. This establishes that O-2, directly or indirectly, can cause induction of this defensive regulon.

The mechanism of activation of Escherichia coli redox sensory protein SoxR is still unclear: a [2Fe-2S] cluster contained in a SoxR dimer is potentially redox-sensitive, but the nature of the signal is unknown. Antioxidant vitamins C (ascorbate) and E (alpha-tocopherol) were used to explore the mechanism of activation of the SoxR protein in vivo. Treating E. coli cells with ascorbate or alpha-tocopherol increased their tolerance to paraquat (PQ, a redox-cycling compound), even in the absence of the soxRS locus, suggesting a radical-quenching activity. When using a soxS'::lacZ fusion, whose expression is governed by activated SoxR, ascorbate and alpha-tocopherol also prevented the expression of beta-galactosidase after PQ treatment. A secondary activity was observed in cells carrying soxR101, a mutation resulting in the constitutive expression of the sox regulon, where the overexpression of soxS'::lacZ was also reduced by ascorbate or alpha-tocopherol treatment. Additionally, different mechanisms of action were revealed as alpha-tocopherol was capable of preventing both PQ and meanadione (MD) lethality, whilst ascorbate prevented PQ lethality but increased MD-mediated cell death. It is proposed that alpha-tocopherol, positioned in membranes, can prevent superoxide-dependent membrane damage; however, water-soluble ascorbate is unable to do so and can even increase the concentration of oxygen radicals reacting with released membrane-associated Fe(II).