Search

Giraffes (Giraffa camelopardalis) possess specialised locomotor morphology, namely elongate and gracile distal limbs. Whilst this contributes to their overall height (and enhanced feeding behaviour), we propose that the combination of long limb segments and modest muscle lever arms results in low effective mechanical advantage (EMA, the ratio of in-lever to out-lever moment arms), when compared with other cursorial mammals. To test this, we used a combination of experimentally measured kinematics and ground rection forces (GRFs), musculoskeletal modelling, and inverse dynamics to calculate giraffe forelimb EMA during walking. Giraffes walk with an EMA of 0.34 (±0.05 S.D.), with no evident association with speed within their walking gait. Giraffe EMA was markedly below the expectations extrapolated from other mammals ranging from 0.03 – 297 kg, and provides further evidence that EMA plateaus or even diminishes in mammals exceeding horse size. We further tested the idea that limb segment length is a factor which determines EMA, by modelling the GRF and muscle moment arms in the extinct giraffid Sivatherium giganteum and the other extant giraffid Okapia johnstoni. Giraffa and Okapia shared similar EMA, despite a 4-6 fold difference in body mass (Okapia EMA = 0.38). In contrast Sivatherium, sharing a similar body mass to Giraffa, had greater EMA (0.59), which we propose reflects behavioural differences, such athletic performance. Our modelling approach suggests that limb length is a determinant of GRF moment arm magnitude, and that unless muscle moment arms scale isometrically with limb length, tall mammals are prone to low EMA.Significance StatementGiraffes are the tallest living animals - using their height to access food unavailable to their competitors. It is not clear how their specialized anatomy impacts their athletic ability. We made musculoskeletal models of the forelimbs from a giraffe and two close relatives, and used motion-capture and forceplate data to measure how efficient they are when walking in a straight line. A horse for example, uses just 1 unit of muscle force to oppose 1 unit of force on the ground. Giraffe limbs however are comparatively disadvantaged – their muscles must develop 3 units of force to oppose 1 unit of force at the ground. This explains why giraffes walk and run at relatively slow speeds.

Behavioral plasticity, or the mechanism by which an organism can adjust its behavior in response to exogenous change, has been highlighted as a potential buffer against extinction risk. Giraffes (Giraffa spp.) are gregarious, long-lived, highly mobile megaherbivores with a large brain size, characteristics that have been associated with high levels of behavioral plasticity. However, while there has been a recent focus on genotypic variability and morphological differences among giraffe populations, there has been relatively little discussion centered on behavioral flexibility within giraffe populations. In large wild herbivores, one measure of behavioral plasticity is the ability to adjust herd size in line with local environmental conditions. Here, we examine whether a genetically isolated population of Angolan giraffes (G. g. angolensis) in a heterogeneous environment adjust their herd sizes in line with spatiotemporal variation in habitat. Our results suggest that ecological factors play a role in driving herd size, but that social factors also shape and stabilize herd-size dynamics. Specifically, we found that 1) mixed-sex herds were larger than single-sex herds, suggesting that sexual composition of herds played a role in driving herd size; 2) the presence of young did not influence herd size, suggesting that giraffes did not make use of the dilution effect to safeguard their young from predation; and 3) there was a strong relationship between herd size and spatial, but not seasonal, variation in food biomass availability, suggesting stability in herd sizes over time, but temporary variation in line with resource availability. These findings indicate that giraffes adjust herd size in line with local exogenous factors, signaling high behavioral plasticity, but also suggest that this mechanism operates within the constraints of the social determinants of giraffe herd size.

Population numbers of Kordofan giraffe (Giraffa camelopardalis antiquorum) have declined throughout its range by more than 85% in the last three decades, including in the isolated easternmost population found in the Garamba National Park (NP) in the Democratic Republic of Congo.We provide new data on the conservation status and ecology of Kordofan giraffe in Garamba NP, specifically on the current population dynamics, distribution patterns, and spatial ecology for informed conservation management decisions.Data were gathered between September 26, 2016, and August 17, 2017, through direct observation and from eight GPS satellite collars deployed in early 2016. Movements, distribution patterns, and autocorrelated kernel density home ranges were estimated using the Continuous‐Time Movement Modeling (CTMM) framework. We then compared results with home ranges calculated using the kernel density estimation (95% KDE) method.The Garamba NP population was estimated to be 45 giraffe with a female‐dominated sex ratio (35% males; 65% females), and adult‐dominated age class ratio (11.2% juveniles; 17.7% subadults; 71.1% adults). The giraffe's distribution was limited to the south‐central sector of the Park, and giraffe were divided over different areas with some degree of connectivity. The average giraffe home range size was 934.3 km2 using AKDE and 268.8 km2 using KDE. Both methods have shown surprisingly large home ranges despite of the relatively high humidity of Garamba NP.Based on the outcomes of this research, urgent conservation action is needed to protect Garamba's remaining giraffe population., Presented manuscript highlights the outputs of extensive fieldwork in Garamba National Park, Democratic Republic of Congo, and brings the first results about the remaining spatially isolated population of the critically endangered Kordofan giraffe. The results of this study represent a solid baseline for conservation decision which will hopefully lead to the long‐term survival of this unique giraffe population.

Giraffe populations have declined in abundance by almost 40% over the last three decades, and the geographic ranges of the species (previously believed to be one, now defined as four species) have been significantly reduced or altered. With substantial changes in land uses, loss of habitat, declining abundance, translocations, and data gaps, the existing geographic range maps for giraffe need to be updated. We performed a review of existing giraffe range data, including aerial and ground observations of giraffe, existing geographic range maps, and available literature. The information we collected was discussed with and validated by subject‐matter experts. Our updates may serve to correct inaccuracies or omissions in the baseline map, or may reflect actual changes in the distribution of giraffe. Relative to the 2016 International Union for Conservation of Nature Red List Assessment range map, the updated geographic range maps show a 5.6% decline in the range area of all giraffe taxa combined. The ranges of Giraffa camelopardalis (northern giraffe) and Giraffa tippelskirchi (Masai giraffe) decreased in area by 37% (122432 km2) and 4.7% (20816 km2) respectively, whereas 14% (41696 km2) of the range of Giraffa reticulata (reticulated giraffe) had not been included in the original geographic range map and has now been added. The range of Giraffa giraffa (southern giraffe) showed little overall change; it increased by 0.1% (419 km2). Ranges were larger than previously reported in six of the 21 range countries (Botswana, Ethiopia, Mozambique, South Sudan, Tanzania, and Zimbabwe), had declined in seven (Cameroon, Central African Republic, Chad, Malawi, Niger, Uganda, and Zambia) and remained unchanged in seven (Angola, Democratic Republic of Congo, eSwatini, Namibia, Rwanda, Somalia, and South Africa). In Kenya, the ranges of both Giraffa tippelskirchi and Giraffa camelopardalis decreased, but the range of Giraffa reticulata was larger than previously believed. Our updated range maps increase existing knowledge, and are important for conservation planning for giraffe. However, since rapid infrastructure development throughout much of Africa is a driver of giraffe population declines, there is an urgent need for a continent‐wide, consistent and systematic giraffe survey to produce more accurate range maps, in order to inform conservation and policy planning.

O Erro é meu amigo! é um livro dedicado a evidenciar que os erros são parte do processo de ensino-aprendizagem, ou melhor, da ensinagem. Dedicado a professores da educação infantil, o livro foi desenvolvido por Lucia Giraffa e Margarete Santos com apoio do CNPq, através de Bolsa de Produtividade e Pesquisa concedida à primeira autora.

In extreme environments, temperature and precipitation are often the main forces responsible for structuring ecological communities and species distributions. The role of biotic interactions is typically thought to be minimal. By clustering around rare and isolated features, like surface water, however, effects of herbivory by desert-dwelling wildlife can be amplified. Understanding how species interact in these environments is critical to safeguarding vulnerable or data-deficient species. We examined whether African elephants (Loxodonta africana), black rhinoceros (Diceros bicornis), and southern giraffe (Giraffa giraffa) modulate insectivorous bat communities around permanent waterholes in the Namib Desert. We estimated megaherbivore use of sites based on dung transects, summarized vegetation productivity from satellite measurements of the normalized difference vegetation index, and surveyed local bat communities acoustically. We used structural equation models to identify relationships among megaherbivores and bat species richness and dry- (November 2016-January 2017) and wet- (February-May 2017) season bat activity. Site-level megaherbivore use in the dry season was positively associated with bat activity-particularly that of open-air foragers-and species richness through indirect pathways. When resources were more abundant (wet season), however, these relationships were weakened. Our results indicate that biotic interactions contribute to species distributions in desert areas and suggest the conservation of megaherbivores in this ecosystem may indirectly benefit insectivorous bat abundance and diversity. Given that how misunderstood and understudied most bats are relative to other mammals, such findings suggest that managers pursue short-term solutions (e.g., community game guard programs, water-point protection near human settlements, and ecotourism) to indirectly promote bat conservation and that research includes megaherbivores' effects on biodiversity at other trophic levels.Efectos Indirectos de la Conservación de Mega Herbívoros Africanos sobre la Diversidad de Murciélagos en el Desierto Más Antiguo del Mundo Resumen Es común que en los ambientes extremos la temperatura y la precipitación sean las principales responsables de la estructura en las comunidades ecológicas y en la distribución de las especies. Con frecuencia se cree que el papel de las interacciones bióticas en estas características es mínimo. Sin embargo, si nos enfocamos en características raras y aisladas, como el agua superficial, los efectos de la herbivoría ocasionada por la fauna del desierto puede ser amplificada. El entendimiento de cómo las especies interactúan en estos ambientes es importante para salvaguardar a las especies vulnerables o con datos insuficientes. Examinamos si los elefantes africanos (Loxodonta africana), los rinocerontes negros (Diceros bicornis) y la jirafa sureña (Giraffa giraffa) modulan las comunidades de murciélagos insectívoros alrededor de los abrevaderos permanentes en el Desierto del Namib. Estimamos el uso que le dan los mega herbívoros a ciertos sitios con base en transectos, en la productividad de la vegetación resumida a partir de las medidas satelitales del índice normalizado de diferencias en la vegetación (INDV) y en censos acústicos de las comunidades locales de murciélagos. Usamos modelos de ecuaciones estructurales para identificar las relaciones entre los mega herbívoros y la riqueza de especies de murciélagos con la actividad de los quirópteros durante la temporada seca (noviembre 2016 - enero 2017) y la lluviosa (febrero - mayo 2017). El uso a nivel de sitio dado por los mega herbívoros durante la temporada seca estuvo asociado positivamente con la actividad de los murciélagos-particularmente para aquellos que forrajean a cielo abierto-y la riqueza de especies por vías indirectas. Sin embargo, cuando los recursos fueron más abundantes (temporada de lluvias), estas relaciones fueron débiles. Nuestros resultados indican que las interacciones bióticas contribuyen a la distribución de las especies en áreas desérticas y sugieren que la conservación de los mega herbívoros en este ecosistema puede beneficiar indirectamente a la abundancia y la diversidad de los murciélagos insectívoros. Ya que los murciélagos suelen ser poco valorados y poco estudiados en comparación con otros mamíferos, nuestros descubrimientos sugieren que los gestores buscan soluciones a corto plazo (p. ej.: programas de guardias comunitarias de las presas de caza, protección de puntos de abastecimiento de agua cercanos a establecimientos humanos, ecoturismo) para promover indirectamente la conservación de murciélagos y que la investigación incluye los efectos de los mega herbívoros sobre la biodiversidad en otros niveles tróficos.

Objective Skeletal dysplasias, cartilaginous or skeletal disorders that sometimes result in abnormal bone development, are seldom reported in free-ranging wild animals. Here, we use photogrammetry and comparative morphometric analyses to describe cases of abnormal appendicular skeletal proportions of free-ranging giraffe in two geographically distinct taxa: a Nubian giraffe (Giraffa camelopardalis camelopardalis) in Murchison Falls National Park, Uganda and an Angolan giraffe (Giraffa giraffa angolensis) on a private farm in central Namibia. Results These giraffe exhibited extremely shortened radius and metacarpal bones relative to other similarly aged giraffe. Both giraffe survived to at least subadult life stage. This report documents rare occurrences of these apparent skeletal dysplasias in free-ranging wild animals and the first records in giraffe.

Giraffa giraffa (Boddaert, 1784) Diagnosis Anterior horn rudimentary, shanks coloured and fully spotted, three ES in the C1orf74 intron: 24 A=>T, 33 A=>G, 825 C=> G; three ES in the DHX36 intron: 127 G =>A, 449 dAT, 498 A=>G; one ES in the IGF2B1 intron: 45 G =>A; one ES in the UBN2 intron: 386 dTCT; six ES in the USP33 intron: 267 G =>A, 279 T=>C, 309 dAA, 538 G =>T, 805 A=>G, 928 G =>A. Type material examined Neotype (here designated) NAMIBIA • 1 specimen (mounted skeleton), “Giraffe of Levaillant”; North of the Orange river; MNHN-A7977. Distribution Angola, Botswana, Mozambique, Namibia (neotype), South Africa, Zambia, Zimbabwe. Remarks No concrete holotype specimen assigned, as specimens of the Prince of Orange Museum in The Hague and the giraffe of Vosmaer (1787) from the Naturalis museum in Leiden (Netherlands) are ʻwhereabouts unknownʼ., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Boddaert P. 1784. Camelopardalis giraffa. Elenchus Animalium Vol. 1: Systems Quadrupedia. C. R. Hake, Rotterdam.","Vosmaer A. 1787. Description du chameau-leopard (Camelopardalis). P. Meyer and G. Warners, Amsterdam."]}

Giraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL • 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali.

Giraffa giraffa giraffa (Boddaert, 1784) Camelopardalis australis Swainson, 1835: 284. Camelopardalis capensis Lesson, 1842: 168. Camelopardalis maculata Weinland, 1863: 205, fig. p. 206. Giraffa camelopardalis angolensis Lydekker, 1903: 121, fig. p. 121. Diagnosis One ES in the Cytb gene: 798 T=>C; two ES in the CR: 130 iT, 170 A=>G. Distribution Angola, Botswana, Namibia, Zimbabwe., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Boddaert P. 1784. Camelopardalis giraffa. Elenchus Animalium Vol. 1: Systems Quadrupedia. C. R. Hake, Rotterdam.","Swainson W. 1835. A Treatise on the Geography and Classification of Animals. Green Longman, London. https: // doi. org / 10.5962 / bhl. title. 25975","Lesson R. P. 1842. Nouveau tableau du Regne animal: Mammiferes. Arthus Bertrand, Paris.","Weinland D. F. 1863. Zur Erinnerung an unsere Giraffe. Zoologischer Garten 4: 204 - 207.","Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London."]}

Giraffa camelopardalis peralta Thomas, 1898 Diagnosis Elongated skull, large spatulate nasal opening, vertically upright direction of the ossicones, fawncoloured patch below the ears, white sparsely spotted occipital region; two ES in the Cytb gene: 219 C=>T, 1080 C=>T, and one ES in the CR: 23 A=> G. Type material Holotype NIGERIA • 1 specimen (skull and bones of right fore and left hind limb); Lokoja; NHMUK-1898.2.18.1. Distribution Niger. Remarks The type locality has originally been assigned to the junction between the Niger and Benue rivers in Nigeria, but it was corrected in this study to Lokoja (Nigeria) north of the confluence of the Niger and Benue rivers in accordance with Happold (1969)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on pages 22-23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Thomas O. 1898. On a new subspecies of giraffe from Nigeria. Proceedings Zoological Society London 1898: 39 - 41.","Happold D. C. D. 1969. The present distribution and status of the giraffe in West Africa. Mammalia 33 (3): 516 - 521. https: // doi. org / 10.1515 / mamm. 1969.33.3.516"]}

Intensified exploration of sub-Saharan Africa during the 18th and 19th centuries led to many newly described giraffe subspecies. Several populations described at that time are now extinct, which is problematic for a full understanding of giraffe taxonomy. In this study, we provide mitochondrial sequences for 41 giraffes, including 19 museum specimens of high importance to resolve giraffe taxonomy, such as Zarafa from Sennar and two giraffes from Abyssinia (subspecies camelopardalis), three of the first southern individuals collected by Levaillant and Delalande (subspecies capensis), topotypes of the former subspecies congoensis and cottoni, and giraffes from an extinct population in Senegal. Our phylogeographic analysis shows that no representative of the nominate subspecies camelopardalis was included in previous molecular studies, as Zarafa and two other specimens assigned to this taxon are characterized by a divergent haplogroup, that the former subspecies congoensis and cottoni should be treated as synonyms of antiquorum, and that the subspecies angolensis and capensis should be synonymized with giraffa, whereas the subspecies wardi should be rehabilitated. In addition, we found evidence for the existence of a previously unknown subspecies from Senegal (newly described in this study), which is now extinct. Based on these results, we propose a new classification of giraffes recognizing three species and 10 subspecies. According to our molecular dating estimates, the divergence among these taxa has been promoted by Pleistocene climatic changes resulting in either savannah expansion or the development of hydrographical networks (Zambezi, Nile, Lake Chad, Lake Victoria). A correction has been published: Petzold A., Magnant A.-S., Edderai D., Chardonnet B., Rigoulet J., Saint-Jalme M. & Hassanin A. 2020. First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens – Corrigendum. European Journal of Taxonomy 717: 1–2. https://doi.org/10.5852/ejt.2020.717.1093

Giraffa giraffa wardi Lydekker, 1904 Giraffa infumata Noack, 1903: 356. Diagnosis Irregular spots, spots on the side of the face restricted to the region below and behind the eyes, two ES in the Cytb gene: 634 C=>T, 705 A=>G. Type material Holotype SOUTH AFRICA • 1 specimen (mounted head and neck); NHMUK-1903.11.18.1. Distribution Botswana, Mozambique, South Africa (holotype), Zambia, Zimbabwe. Remarks The holotype is given by Lydekker (1914) under the collection number NHMUK - 1903.11.18.1, but this catalogue number leads to a fish specimen (Pomatomus telescopus Risso, 1810) on the collection website (https://data.nhm.ac.uk/dataset/collection-specimens/resource/05ff2255-c38a-40c9-b657- 4ccb55ab2feb/record/3124756). However, two other specimens of wardi can be found in the museum collection (NHMUK-1903.11.17.1 and NHMUK-1903.11.17.3), one of which might be considered the neotype if the holotype cannot be found., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 26, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1904. On the Subspecies of Giraffa camelopardalis. Proceedings of the Zoological Society of London 74: 202 - 227. https: // doi. org / 10.1111 / j. 1469 - 7998.1904. tb 08288. x","Lydekker R. 1914. Catalogue of the Ungulate Mammals in the British Museum. British Museum, London."]}

Giraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB-084951. Distribution Kenya, Tanzania (lectotype), Zambia. Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669

Giraffa camelopardalis rothschildi Lydekker, 1903 Diagnosis Lower parts of the legs pure white and unspotted, spots show a tendency to split up into stars, occipital pair of ossicones, one ES in the CR: 129 T=> C. Type material Holotype KENYA • 1 specimen (mounted skin); Guasin-gisha Plateau east of Mount Elgon; NHMUK-1903.4.15.1. Distribution Western Ethiopia, Kenya (holotype), Uganda, South Sudan., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London."]}

Giraffa tippelskirchi tippelskirchi Matschie, 1898 Giraffa schillingsi Matschie, 1898: 79. Diagnosis Stellate formed spots, shanks olive-coloured and spotted down to the hoofs, anterior horn less developed, one ES in the Cytb gene: 1033 C=>T. Distribution Southern Kenya, Tanzania., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669

Giraffa camelopardalis (Linnaeus, 1758) Diagnosis Shanks white, presence of occipital horns, five ES in the Cytb gene: 186 A=> G, 288 G =>A, 333 A=>G, 597 C=>T, 924 C=>T; one ES in the CR: 462 A=>G; two ES in the CTAGE5 intron: 570 T=> C, 705 C=> G; two ES in the CWF19L1 intron: 263 T=> G, 264 T=> G; one ES in the DDX1 intron: 268 dACAT; one ES in the DHX36 intron: 50 iGTT; two ES in the SOS1 intron: 103 T=>C, 118 G=>A. Type material examined Neotype (here designated) ETHIOPIA • 1 specimen (skin and complete skeleton); Abyssinia; MHNT-1996.121.2. Other specimens ETHIOPIA • 1 specimen (skull and skeleton parts); Abyssinia; MNHN-A8012. SUDAN • 1 specimen (skull), “Zarafa”; Sennar; MNHN-1845-211. Distribution Niger, Chad, Cameroon, Central African Republic, Democratic Republic of Congo, South Sudan (holotype), Uganda, Somalia, Ethiopia (neotype), Kenya. Remarks The holotype designation was based on a living giraffe illustrated by Belon du Mans (1553), which was not sampled for a museum collection. The neotype herein designated represents the most complete specimen (skin and complete skeleton) and has been the first giraffe to be dissected, providing several anatomical drawings (see Joly & Lavocat 1845)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on pages 21-22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Linnaeus C. 1758. Systema Naturae per Regna Tria Naturae. Editio decima reformata, Tomus I. Regnum Animale. Laurentius Salvius, Stockholm.","Belon du Mans P. 1553. Les Observations de plusieurs Singularitez et Choses memorables trouvees en Grece, Asie, Iudee, Egypte, Arabie et autres Pays estranges. Corrozet et Canellat, Paris. https: // doi. org / 10.5962 / bhl. title. 127374","Joly N. & Lavocat A. 1845. Recherches historiques, zoologiques, anatomiques et paleontologiques sur la Giraffe (Camelopardalis giraffa, Gmelin). V. Berger-Levrault, Boulogne-Billancourt."]}

Giraffa tippelskirchi thornicrofti Lydekker, 1911 Diagnosis Low and conical anterior horn, grey colour and scattered spotting of the sides of the face, fawn shanks, three ES in the CR: 39 A=>G, 272 T=>C, 336 T=>A; two ES in the IGF2B1 intron: 60 C=>T, 304 G =>A. Type material Holotype ZAMBIA • 1 specimen (skin); Petauke district; NHMUK-1910.10.17.1. Distribution Luangwa Valley in Zambia., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1911. Two undescribed giraffes. Nature 87: 484. https: // doi. org / 10.1038 / 087484 c 0"]}

Giraffa camelopardalis camelopardalis (Linnaeus, 1758) Camelopardalis aethiopicus Ogilby, 1837: 134. Camelopardalis biturigum Duvernoy, 1844: 12, fig. 4. Giraffa camelopardalis typica Bryden, 1899: 489, plate XIV. Diagnosis Front of the face sparsely and sides fully spotted, similar pattern to reticulata but with chestnut or sandy patches. Past distribution Probably extinct, former range between the Blue Nile and Tekezé /Atbara rivers in southeastern Sudan (eastern Sennar) and northern Ethiopia (Abyssinia)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Linnaeus C. 1758. Systema Naturae per Regna Tria Naturae. Editio decima reformata, Tomus I. Regnum Animale. Laurentius Salvius, Stockholm.","Ogilby W. 1837. On the generic characters of ruminants. Proceedings of the Zoological Society of London 1836: 131 - 139.","Duvernoy M. 1844. Sur une machoire de girafe fossile decouverte a Issoudun. Notes communiques au L'Academie de Science, 1843.","Bryden H. A. 1899. Great and Small Game of Africa: An Account of the Distribution, Habits, and Natural History of the Sporting Mammals, with Personal Hunting Experiences. R. Ward, London."]}

Giraffa camelopardalis antiquorum (Jardine, 1835) Giraffa camelopardalis sennaariensis Trouessart, 1898: p.902. Giraffa camelopardalis congoensis Lydekker, 1903: 386. Giraffa camelopardalis cottoni Lydekker, 1904: 207, fig. 1. Diagnosis Spots on the upper part of the fore-limbs and the thighs broken up in a number of very small and irregular ones. Type material Holotype SUDAN • 1 ♂ (skull and tanned skin of a male giraffe); South of Darfur; SMF-498. Paratype SUDAN • 1 ♀ (skull and tanned skin of a female giraffe); South of Darfur; SMF-497. Distribution Cameroon, Chad, Central African Republic, Democratic Republic of Congo, South Sudan (holotype). Remarks The holotype designation was based on the information provided by Rüppel (1826), who collected two specimens in North Africa. Both specimens can be meanwhile found in the collection of the Senckenberg Museum Frankfurt (Germany) listed as SMF-498 (skull and tanned skin, male): unspecified type and SMF-497 (skull and tanned skin, female): paratype., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Jardine W. 1835. The Natural History of the Ruminating Animals, containing Deer, Antilopes, Camels & c. W. H. Lizars, Edinburgh. https: // doi. org / 10.5962 / bhl. title. 131528","Trouessart L. 1898. Catalogus Mammalium tam viventium quam fossilium. Vol. 4: Tillodontia et Ungulata. Freidlander, Berlin. https: // doi. org / 10.5962 / bhl. title. 130824","Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London.","Lydekker R. 1904. On the Subspecies of Giraffa camelopardalis. Proceedings of the Zoological Society of London 74: 202 - 227. https: // doi. org / 10.1111 / j. 1469 - 7998.1904. tb 08288. x"]}

Summary Species is the fundamental taxonomic unit in biology and its delimitation has implications for conservation. In giraffe (Giraffa spp.), multiple taxonomic classifications have been proposed since the early 1900s. 1 However, one species with nine subspecies has been generally accepted, 2 likely due to limited in-depth assessments, subspecies hybridizing in captivity, 3 , 4 and anecdotal reports of hybrids in the wild. 5 Giraffe taxonomy received new attention after population genetic studies using traditional genetic markers suggested at least four species. 6 , 7 This view has been met with controversy, 8 setting the stage for debate. 9 , 10 Genomics is significantly enhancing our understanding of biodiversity and speciation relative to traditional genetic approaches and thus has important implications for species delineation and conservation. 11 We present a high-quality de novo genome assembly of the critically endangered Kordofan giraffe (G. camelopardalis antiquorum) 12 and a comprehensive whole-genome analysis of 50 giraffe representing all traditionally recognized subspecies. Population structure and phylogenomic analyses support four separately evolving giraffe lineages, which diverged 230–370 ka ago. These lineages underwent distinct demographic histories and show different levels of heterozygosity and inbreeding. Our results strengthen previous findings of limited gene flow and admixture among putative giraffe species 6 , 7 , 9 and establish a genomic foundation for recognizing four species and seven subspecies, the latter of which should be considered as evolutionary significant units. Achieving a consensus over the number of species and subspecies in giraffe is essential for adequately assessing their threat level and will improve conservation efforts for these iconic taxa.

Historically, giraffe have been translocated across Africa to supplement extant populations, reintroduce extinct populations or to establish new populations, often for conservation and tourism. Such faunal relocations were often carried out disregarding taxonomic affiliation. Today, the small giraffe populations in the Republic of Malawi are assumed to consist of South African giraffe (Giraffa giraffa giraffa), which have likely descended from five individuals translocated from Imire Game Park (Zimbabwe) to Nyala Game Park (Malawi) in 1993. However, during the last 25 years, unknown additional translocations, migrations or unrecognized local populations of potential Masai giraffe (Giraffa tippelskirchi) in Malawi may have resulted in introgressive hybridization. Thus, the current taxonomic affiliation for Malawi’s giraffe is uncertain, calling for a genetic assessment to implement further management. We analyzed mitochondrial sequences and nuclear introns for 14 individuals, representing approximately half of the known Malawian population, to genetically determine the (sub)species of giraffe that occur in the Republic of Malawi by comparison with a comprehensive Giraffa dataset. Additionally, we genotyped individuals at ten microsatellite loci to determine the level of inbreeding and potential introgression. All data identify individuals unambiguously as South African giraffe, although two individuals shared a single nuclear allele with Masai giraffe. The low microsatellite genetic variability suggests high inbreeding in the current population. Thus, supplementing Malawi’s giraffe populations with G. g. giraffa will prevent further loss of their genetic diversity and avoid inbreeding depression.

To date, the subgenus Rhomboconnus Franz of Euconnus Thomson was represented by twelve species known to occur in Bolivia, Ecuador, Panama, Peru, and Venezuela. Examination of Neotropical species described by David Sharp and Ludwig Wilhelm Schaufuss revealed that two more species, previously not recognized as members of Rhomboconnus, occur in Guatemala and Brazil: Euconnus cavifrons (L.W. Schaufuss) and E. giraffa Sharp. The latter species was redescribed by Herbert Franz and recorded to occur in Mexico. Franz’s ‘redescription’, however, was based on misidentified specimens. Five new species are described, all known to occur in souther n Mexico: Euconnus (Rhomboconnus) agiraffa sp. n., Euconnus (Rhomboconnus) oaxacanus sp. n., Euconnus (Rhomboconnus) bicarinatus sp. n., Euconnus (Rhomboconnus) cordobanus sp. n., and Euconnus (Rhomboconnus) maya sp. n.