Search

Phedimus takesimensis (Ulleungdo flat-leaved stonecrop) is endemic to Ulleung and Dokdo Islands off the east coast of the Korean Peninsula. It was suggested that P. takesimensis originated via anagenetic speciation from the continental progenitor species P. kamtchaticus or P. aizoon. However, little is known of the phylogenetic relationships and population genetic structure among species of Phedimus in the Korean Peninsula and Ulleung/Dokdo Islands. We inferred the phylogenetic relationships among congeneric species in Korea based on nuclear ribosomal DNA internal transcribed spacer and chloroplast noncoding regions. We also sampled extensively for P. takesimensis on Ulleung Island and the continental species, P. kamtschaticus and P. aizoon, to assess the genetic consequences of anagenetic speciation. We found (1) the monophyly of P. takesimensis, (2) no apparent reduction in genetic diversity in anagenetically derived P. takesimensis compared to the continental progenitor species, (3) apparent population genetic structuring of P. takesimensis, and (4) two separate colonization events for the origin of the Dokdo Island population. This study contributes to our understanding of the genetic consequences of anagenetic speciation on Ulleung Island., Competing Interests: The authors have declared that no competing interests exist.

Background: The genus Brassica mainly comprises three diploid and three recently derived allotetraploid species, most of which are highly important vegetable, oil or ornamental crops cultivated worldwide. Despite being extensively studied, the origination of B. napus and certain detailed interspecific relationships within Brassica genus remains undetermined and somewhere confused. In the current high-throughput sequencing era, a systemic comparative genomic study based on a large population is necessary and would be crucial to resolve these questions., Results: The chloroplast DNA and mitochondrial DNA were synchronously resequenced in a selected set of Brassica materials, which contain 72 accessions and maximally integrated the known Brassica species. The Brassica genomewide cpDNA and mtDNA variations have been identified. Detailed phylogenetic relationships inside and around Brassica genus have been delineated by the cpDNA- and mtDNA- variation derived phylogenies. Different from B. juncea and B. carinata, the natural B. napus contains three major cytoplasmic haplotypes: the cam-type which directly inherited from B. rapa, polima-type which is close to cam-type as a sister, and the mysterious but predominant nap-type. Certain sparse C-genome wild species might have primarily contributed the nap-type cytoplasm and the corresponding C subgenome to B. napus, implied by their con-clustering in both phylogenies. The strictly concurrent inheritance of mtDNA and cpDNA were dramatically disturbed in the B. napus cytoplasmic male sterile lines (e.g., mori and nsa). The genera Raphanus, Sinapis, Eruca, Moricandia show a strong parallel evolutional relationships with Brassica., Conclusions: The overall variation data and elaborated phylogenetic relationships provide further insights into genetic understanding of Brassica, which can substantially facilitate the development of novel Brassica germplasms.

Vachellia and Senegalia are the most important genera in the subfamily Mimosoideae (Fabaceae). Recently, species from both genera were separated from the long-characterized Acacia due to their macro-morphological characteristics. However, this morpho-taxonomic differentiation struggles to discriminate some species, for example, Vachellia nilotica and Senegalia senegal. Therefore, sequencing the chloroplast (cp) genomes of these species and determining their phylogenetic placement via conserved genes may help to validate the taxonomy. Hence, we sequenced the cp genomes of V. nilotica and S. senegal, and the results showed that the sizes of the genomes are 165.3 and 162.7 kb, respectively. The cp genomes of both species comprised large single-copy regions (93,849~91,791 bp) and pairs of inverted repeats (IR; 26,093~26,008 bp). The total numbers of genes found in the V. nilotica and S. senegal cp genomes were 135 and 132, respectively. Approximately 123:130 repeats and 290:281 simple sequence repeats were found in the S. senegal and V. nilotica cp genomes, respectively. Genomic characterization was undertaken by comparing these genomes with those of 17 species belonging to related genera in Fabaceae. A phylogenetic analysis of the whole genome dataset and 56 shared genes was undertaken by generating cladograms with the same topologies and placing both species in a new generic system. These results support the likelihood of identifying segregate genera from Acacia with phylogenomic disposition of both V. nilotica and S. senegal in the subfamily Mimosoideae. The current study is the first to obtain complete genomic information on both species and may help to elucidate the genome architecture of these species and evaluate the genetic diversity among species., Competing Interests: The authors have declared that no competing interests exist.

The complexity of the leaf constitution of foxtail millet (Setaria italica (L.) P. Beauv.) makes it difficult to obtain high-purity cpDNA. Here, we developed a protocol to isolate high-quality cpDNA from foxtail millet and other crops. The new protocol replaces previous tissue grinding and homogenization by enzyme digestion of tiny leaf strips to separate protoplasts from leaf tissue and protects chloroplasts from damage by undue grinding and homogenization and from contamination of cell debris and nuclear DNA. Using the new protocol, we successfully isolated high-quality cpDNAs for whole-genome sequencing from four foxtail millet cultivars, and comparative analysis revealed that they were approximately 27‰ longer than their reference genome. In addition, six cpDNAs of four other species with narrow and thin leaf blades, including wheat (Triticum aestivum L.), maize (Zea may L.), rice (Oryza sativa L.) and sorghum (Sorghum bicolor (L.) Moench), were also isolated by our new protocol, and they all exhibited high sequence identities to their corresponding reference genomes. A maximum-likelihood tree based on the chloroplast genomes we sequenced here was constructed, and the result was in agreement with previous reports, confirming that these cpDNA sequences were available for well-supported phylogenetic analysis and could provide valuable resources for future research.

Knowing what animals eat is fundamental to our ability to understand and manage biodiversity and ecosystems, but researchers often must rely on indirect methods to infer trophic position and food intake. Using an approach that combines evidence from stable isotope analysis and DNA metabarcoding, we assessed the diet and trophic position of Anthene usamba butterflies, for which there are no known direct observations of larval feeding. An earlier study that analyzed adults rather than caterpillars of A. usamba inferred that this butterfly was aphytophagous, but we found that the larval guts of A. usamba and two known herbivorous lycaenid species contain chloroplast 16S sequences. Moreover, chloroplast barcoding revealed high sequence similarity between chloroplasts found in A. usamba guts and the chloroplasts of the Vachellia drepanolobium trees on which the caterpillars live. Stable isotope analysis provided further evidence that A. usamba caterpillars feed on V. drepanolobium, and the possibilities of strict herbivory versus limited omnivory in this species are discussed. These results highlight the importance of combining multiple approaches and considering ontogeny when using stable isotopes to infer trophic ecology where direct observations are difficult or impossible., Competing Interests: The authors have declared that no competing interests exist.

Artemisia selengenesis is not only a health food, but also a well-known traditional Chinese medicine. Only a fraction of the chloroplast (cp) genome data of Artemisia has been reported and chloroplast genomic materials have been widely used in genomic evolution studies, molecular marker development, and phylogenetic analysis of the genus Artemisia, which makes evolutionary studies, genetic improvement, and phylogenetic identification very difficult. In this study, the complete chloroplast genome of A. selengensis was compared with that of other species within Artemisia and phylogenetic analyses was conducted with other genera in the Asteraceae family. The results showed that A. selengensis is an AT-rich species and has a typical quadripartite structure that is 151,215 bp in length. Comparative genome analyses demonstrated that the available chloroplast genomes of species of Artemisia were well conserved in terms of genomic length, GC contents, and gene organization and order. However, some differences, which may indicate evolutionary events, were found, such as a re-inversion event within the Artemisia genus, an unequal duplicate phenomenon of the ycf1 gene because of the expansion and contraction of the IR region, and the fast-evolving regions. Repeated sequences analysis showed that Artemisia chloroplast genomes presented a highly similar pattern of SSR or LDR distribution. A total of 257 SSRs and 42 LDRs were identified in the A. selengensis chloroplast genome. The phylogenetic analysis showed that A. selengensis was sister to A. gmelinii. The findings of this study will be valuable in further studies to understand the genetic diversity and evolutionary history of Asteraceae., Competing Interests: The authors have declared that no competing interests exist.

Mycorrhizal symbiosis between soil fungi and land plants is one of the most widespread and ecologically important mutualisms on earth. It has long been hypothesized that the Glomeromycotina, the mycorrhizal symbionts of the majority of plants, facilitated colonization of land by plants in the Ordovician. This view was recently challenged by the discovery of mycorrhiza-like associations with Mucoromycotina in several early diverging lineages of land plants. Utilizing a large, species-level database of plants' mycorrhiza-like associations and a Bayesian approach to state transition dynamics we here show that the recruitment of Mucoromycotina is the best supported transition from a non-mycorrhizal state. We further found that transitions between different combinations of either or both of Mucoromycotina and Glomeromycotina occur at high rates, and found similar promiscuity among combinations that include either or both of Glomeromycotina and Ascomycota with a nearly fixed association with Basidiomycota. Our results portray an evolutionary scenario of evolution of mycorrhizal symbiosis with a prominent role for Mucoromycotina in the early stages of land plant diversification.

Androdioecy is the rarest sexual system among plants. The majority of androdioecious species are herbaceous plants that have evolved from dioecious ancestors. Nevertheless, some woody and androdioecious plants have hermaphrodite ancestors, as in the Annonaceae, where androdioecious genera have arisen several times in different lineages. The majority of androdioecious species of Annonaceae belong to the Neotropical tribe Malmeeae. In addition to these species, Pseudoxandra spiritus-sancti was recently confirmed to be androdioecious. Here, we describe the morphology of male and bisexual flowers of Pseudoxandra spiritus-sancti, and investigate the evolution of androdioecy in Malmeeae. The phylogeny of tribe Malmeeae was reconstructed using Bayesian inference, maximum parsimony and maximum likelihood of 32 taxa, using DNA sequences of 66 molecular markers of the chloroplast genome, sequenced by next generation sequencing. The reconstruction of ancestral states was performed for characters associated with sexual systems and floral morphology. The phylogenetic analyses reconstructed three main groups in Malmeeae, (Malmea (Cremastosperma, Pseudoxandra)) sister to the rest of the tribe, and (Unonopsis (Bocageopsis, Onychopetalum)) sister to (Mosannona, Ephedranthus, Klarobelia, Oxandra, Pseudephedranthus fragrans, Pseudomalmea, Ruizodendron ovale). Hermaphroditism is plesiomorphic in the tribe, with four independent evolutions of androdieocy, which represents a synapomorphy of two groups, one that includes three genera and 14 species, the other with a single genus of seven species. Male flowers are unisexual from inception and bisexual flowers possess staminodes and functional stamens. Pseudoxandra spiritus-sancti is structurally androdioecious., (Copyright © 2017 Elsevier Inc. All rights reserved.)

The Arracacia clade (Apiaceae, Apioideae) is a heterogeneous assemblage of 12 genera, comprising 111 known species distributed in high montane temperate and sub-alpine habitats of meso- and South America. Previous studies have indicated that the genera Arracacia, Coulterophytum, and Prionosciadium are polyphyletic, but for the most part relationships among the members of the clade are largely unknown. Initially, cladistic analyses of nrDNA ITS sequences were carried out on 212 accessions (122 taxa), representing 92 species of the Arracacia clade and outgroups from the closely-related páramo genera Cotopaxia, Niphogeton, and Perissocoeleum and members of the Perennial Endemic North American clade and its allies. Using the ITS results to inform sampling of a small subset of taxa, a pilot study examining the phylogenetic utility of 20 noncoding chloroplast loci was subsequently performed to identify those regions most useful at resolving relationships. A cost-benefit analysis determined that five loci (trnQ-5'rps16, trnD-trnT, rpl32-trnL, psbD-trnT, ndhA intron) would maximize resolution and branch support in the clade. Cladistic analyses of four of these loci (trnQ-5'rps16, trnD-trnT, rpl32-trnL, ndhA intron) and the ITS region, separately and combined, revealed that Arracacia, Coaxana, Coulterophytum, Prionosciadium, and Rhodosciadium are each polyphyletic and that Donnellsmithia and Myrrhidendron are each monophyletic. Although most relationships in the Arracacia clade and among the closely-related genera Cotopaxia, Niphogeton, and Perissocoeleum are poorly resolved and supported, ten groups are recognized for future revisionary studies. Polyploidy and rapid species radiation have likely confounded generic circumscriptions and interpretation of relationships., (Copyright © 2017 Elsevier Inc. All rights reserved.)

The polyphagous mirid bug Apolygus lucorum (Heteroptera: Miridae) has more than 200 species of host plants and is an insect pest of important agricultural crops, including cotton (Gossypium hirsutum) and mungbean (Vigna radiata). Previous field trials have shown that A. lucorum adults prefer mungbean to cotton plants, indicating the considerable potential of mungbean as a trap crop in cotton fields. However, direct evidence supporting the migration of A. lucorum adults from cotton to mungbean is lacking. We developed a DNA-based polymerase chain reaction (PCR) approach to reveal the movement of A. lucorum between neighboring mungbean and cotton fields. Two pairs of PCR primers specific to cotton or mungbean were designed to target the trnL-trnF region of chloroplast DNA. Significant differences in the detectability half-life (DS50) were observed between these two host plants, and the mean for cotton (8.26 h) was approximately two times longer than that of mungbean (4.38 h), requiring weighted mean calculations to compare the detectability of plant DNA in the guts of field-collected bugs. In field trials, cotton DNA was detected in the guts of the adult A. lucorum individuals collected in mungbean plots, and the cotton DNA detection rate decreased successively from 5 to 15 m away from the mungbean-cotton midline. In addition to the specific detection of cotton- and mungbean-fed bugs, both cotton and mungbean DNA were simultaneously detected within the guts of single individuals caught from mungbean fields. This study successfully established a tool for molecular gut-content analyses and clearly demonstrated the movement of A. lucorum adults from cotton to neighboring mungbean fields, providing new insights into understanding the feeding characteristics and landscape-level ecology of A. lucorum under natural conditions.

The genus Gentiana is the largest in the Gentianaceae family with ca. 400 species. However, with most species growing on the Qinghai-Tibet plateau, the processes of adaptive evolution and speciation within the genus is not clear. Also, the genomic analyses could provide important information. So far, the complete chloroplast (cp) genome data of the genus are still deficient. As the second and third sequenced members within Gentianaceae, we report the construction of complete cp sequences of Gentiana robusta King ex Hook. f. and Gentiana crassicaulis Duthie ex Burk., and describe a comparative study of three Gentiana cp genomes, including the cp genome of Gentiana straminea Maxim. published previously. These cp genomes are highly conserved in gene size, gene content, and gene order and the rps16 pseudogene with exon2 missing was found common. Three repeat types and five SSR types were investigated, and the number and distribution are similar among the three genomes. Sixteen genome divergent hotspot regions were identified across these cp genomes that could provide potential molecular markers for further phylogenetic studies in Gentiana. The IR/SC boundary organizations in Gentianales cp genomes were compared and three different types of boundaries were observed. Six data partitions of cp genomes in Gentianales were used for phylogenetic analyses and different data partitions were largely congruent with each other. The ML phylogenetic tree was constructed based on the fragments in cp genomes commonly available in 33 species from Lamiids, including 12 species in Gentianales, 1 in Boraginaceae, 10 in Solanales, and 10 in Lamiales. The result strongly supports the position of Boraginaceae (Ehretia acuminata) as the sister of Solanales, with the bootstrap values of 97 %. This study provides a platform for further research into the molecular phylogenetics of species in the order Gentianales (family Gentianaceae) notably in respect of speciation and species identification.

The complete chloroplast genome of Iris sanguinea was sequenced newly in this study. The total chloroplast genome size of I. sanguinea was 152 408 bp, its structure and gene contents were well conserved as typical chloroplast characteristics. Large single copy (LSC) and small single copy (SSC) of 82 340 bp and 18 016 bp, respectively, were separated from a pair of inverted repeats (IRA and IRB) of 26 026 bp. A total of 112 genes, i.e. 78 protein-coding genes, 30 tRNA genes, and four rRNA genes, were encoded in the chloroplast genome of I. sanguinea. Overall GC content of I. sanguinea was 36.83%. Phylogenetic analysis with the reported chloroplast genomes revealed that I. sanguinea is most closely related to I. gatesii.

Background and Aims: Anthosachne Steudel is a group of allopolyploid species that was derived from hexaploidization between the Asian StY genome Roegneria entity and the Australasia W genome Australopyrum species. Polyploidization and apomixis contribute to taxonomic complexity in Anthosachne Here, a study is presented on the phylogeny and evolutionary history of Anthosachne australasica The aims are to demonstrate the process of polyploidization events and to explore the differentiation patterns of the St genome following geographic isolation., Methods: Chloroplast rbcL and trnH-psbA and nuclear Acc1 gene sequences of 60 Anthosachne taxa and nine Roegneria species were analysed with those of 33 diploid taxa representing 20 basic genomes in Triticeae. The phylogenetic relationships were reconstructed. A time-calibrated phylogeny was generated to estimate the evolutionary history of A. australasica Nucleotide diversity patterns were used to assess the divergence within A. australasica and between Anthosachne and its putative progenitors., Key Results: Three homoeologous copies of the Acc1 sequences from Anthosachne were grouped with the Acc1 sequences from Roegneria, Pseudoroegneria, Australopyrum, Dasypyrum and Peridictyon The chloroplast sequences of Anthosachne were clustered with those from Roegneria and Pseudoroegneria Divergence time for Anthosachne was dated to 4·66 million years ago (MYA). The level of nucleotide diversity in Australasian Anthosachne was higher than that in continental Roegneria A low level of genetic differentiation within the A. australasica complex was found., Conclusions: Anthosachne originated from historical hybridization between Australopyrum species and a Roegneria entity colonized from Asia to Australasia via South-east Asia during the late Miocene. The St lineage served as the maternal donor during the speciation of Anthosachne A contrasting pattern of population genetic structure exists in the A. australasica complex. Greater diversity in island Anthosachne compared with continental Roegneria might be associated with mutation, polyploidization, apomixis and expansion. It is reasonable to consider that A. australasica var. scabra and A. australasica var. plurinervisa should be included in the A. australasica complex., (© The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

The genus Citrus and its close relatives are economically and nutritionally important fruit trees. However, the huge controversy over the phylogeny of key wild species, as well as the genetic relationship between the cultivated species and their putative wild progenitors, remains unresolved. Comparative analyses of chloroplast (cp) genomes have been useful in resolving various phylogenetic issues. Thus far, the cp genomes of only two Citrus species have been sequenced. In this study, we sequenced six complete cp genomes, four belonging to the genus Citrus, and two belonging to the genera Fortunella and Poncirus, respectively. These newly sequenced genomes together with the two publicly available were used for comparative analyses of the genus Citrus and its close relatives. All eight cp genomes share similar basic structure, gene order and gene content. Phylogenetic analyses supported the monophyly of the three genera in the order Sapindales within the major clade Malvidae.

The complete nucleotide sequence of Pinus tabuliformis chloroplast genome (cpDNA) was carried out using Illumina Hiseq 2500. The genome is 119 646 bp in length, and the overall base composition of H-strand is 30.6% for A, 19.3% for C, 19.2% for G and 30.9% for T. There are 116 genes in the cpDNA, including 74 protein-coding genes, four ribosomal RNA genes (four rRNA species), and 36 transfer RNA genes (20 tRNA species). Phylogenetic analyses of P. tabuliformis and other 12 species belonging to Pinales were carried out using MEGA 6.0 with Neighbor-Joining methods. The sequences of P. tabuliformis were clustered in subfamily Pinaceae.

A comparative analysis of the chloroplast genome of Euglena mutabilis underlined a high diversity in the evolution of plastids in euglenids. Gene clusters in more derived Euglenales increased in complexity with only a few, but remarkable changes in the genus Euglena. Euglena mutabilis differed from other Euglena species in a mirror-inverted arrangement of 12 from 15 identified clusters, making it very likely that the emergence at the base of the genus Euglena, which has been considered a long branch artifact, is truly a probable position. This was corroborated by many similarities in gene arrangement and orientation with Strombomonas and Monomorphina, rendering the genome organization of E. mutabilis in certain clusters as plesiomorphic feature. By RNA analysis exact exon-intron boundaries and the type of the 77 introns identified were mostly determined unambiguously. A detailed intron study of psbC pointed at two important issues: First, the number of introns varied even between species, and no trend from few to many introns could be observed. Second, mat1 was localized in Eutreptiales exclusively in intron 1, and mat2 was not identified. With the emergence of Euglenaceae in most species, a new intron containing mat2 inserted in front of the previous intron 1 and thereby became intron 2 with mat1., (© 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.)

The complete chloroplast genome sequence of wild cucumber (Cucumis sativus var. hardwickii) was determined and characterized in this study. The genome is of 155 277 bp in length, containing a pair of inverted repeats regions (IRs) of 25 198 bp, which are separated by a large single-copy region of 86 618 bp and a small single-copy region of 18 263 bp. The wild cucumber chloroplast genome has 130 known genes, including 85 protein-coding genes, 8 ribosomal RNA genes, and 37 tRNA genes. Among these genes, 19 comprise one or two introns. There are 11 tRNA genes present in the IR of the chloroplast genome. Phylogenomic analysis showed that C. sativus var. hardwickii forms a cluster with other Cucumis species with strong bootstrap supports and is closely related to C. sativus var. sativus. This newly sequenced chloroplast genome sequence may provide useful genetic information to explore wild cucumber germplasms for cucumber breeding programs.

Lilium distichum is a native lily species in Korea, northeastern China and far eastern Russia. The complete chloroplast genome sequence of L. distichum was generated by de novo assembly using whole genome next generation sequences. The chloroplast genome of L. distichum was 152 598 bp in length and divided into four distinct regions, such as large single copy region (82 031 bp), small single copy region (17 487 bp) and a pair of inverted repeat regions (26 540 bp). The genome annotation predicted a total of 112 genes, including 78 protein-coding genes, 30 tRNA genes,and 4 rRNA genes. Phylogenetic analysis with the reported chloroplast genomes revealed that L. distichum is most closely related to L. superbum (Turk's-cap lily).

Ficus racemosa, with immense medicinal value, and known as Cluster Fig Tree, Indian Fig Tree or Goolar (Gular) Figis, is a species of plant which belongs to family Moraceae. The complete chloroplast genome of Ficus racemosa was obtained by de novo assembly using next-generation sequencing data. The chloroplast genome of F. racemosa was 159 473 bp in length, which consisted of a large single region (88 110 bp), a small single copy region (20 007 bp) and a pair of invert repeat regions (25 678 bp). The overall GC content of this chloroplast genome was 36.0%. The chloroplast genome harbored 117 genes, including 84 protein-coding genes, 27 tRNA, and eight rRNA genes (4.5S rRNA, 5S rRNA, 16s rRNA and 23s rRNA) that were two copied. Phylogenetic analysis of the complete chloroplast genome sequences with the report-related chloroplast genomes revealed that Ficus racemosa is most closely related to Morus indica, a typical higher plant in fiamly Moraceae.

Brassica juncea L. is the second most important edible oil seed crop of India. In the current study, we report the complete chloroplast genome sequence of Indian mustard, Brassica juncea L. The size of the complete chloroplast genome was found to be 153 483 bp long with an overall GC content of 36.36%. A large single copy (LSC) region of 83 286 bp and a short single copy region (SSC) region of 17 775 bp were separated by a pair of inverted repeat (IR) regions of 26 211 bp. A total of 113 unique genes were annotated, which includes 79 protein-coding genes, 30 tRNA genes, and four rRNA genes. Either one or two introns were present in nine protein-coding genes and six tRNA genes. Phylogenetic analysis with the complete chloroplast genomes of other related species revealed that B. juncea is much closer to Brassica rapa.

Maddenia hypoleuca Koehne belonging to family Rosaceae is a native species in China. The complete chloroplast (cp) genome was generated by de novo assembly using low coverage whole genome sequencing data and manual correction. The cp genome was 158 084 bp in length, with GC content of 36.63%. It exhibited a typical quadripartite structure: a pair of large inverted repeat regions (IRs, 26 246 bp each), a large single-copy region (LSC, 86 713 bp), and a small single-copy region (SSC, 18 879 bp). A total of 114 genes were predicted, which included 80 protein-coding genes, 30 tRNA genes, and four rRNA genes. Phylogenetic analysis indicated that M. hypoleuca is most closely related to Prunus padus within the Prunoideae subfamily, which conforms to the traditional classification.

The complete chloroplast sequence of Ostrya rehderiana is 159 347 bp in length, containing 85 protein-coding genes, 8 ribosomal RNA genes, and 31 transfer RNA genes. The circular genome exhibits a typical chloroplast genome structure comprising a large single copy region of 88 552 bp, a small single copy region of 18 941 bp and a pair of inverted repeats of 25 927 bp. The overall GC content of the chloroplast genome is 36.5%. Phylogenetic analysis of O. rehderiana sequence together with 12 complete chloroplast genomes revealed a basal placement of O. rehderiana within the Fagales species.

Cynanchum auriculatum is a climbing vine belonging to the Apocynaceae family and shows very similar morphology to Cynanchum wilfordii, a medicinal plant. The complete chloroplast genome of C. auriculatum was generated by de novo assembly using the small amount of whole genome sequencing data. The chloroplast genome of C. auriculatum was 160 840 bp in length and consisted of four distinct regions, such as large single copy region (91 973 bp), small single copy region (19 667 bp), and a pair of inverted repeat regions (24 600 bp). The overall GC contents of the chloroplast genome were 37.8%. A total of 114 genes were predicted and included 80 protein-coding genes, 30 tRNA genes, and four rRNA genes. Phylogenetic analysis with the reported chloroplast genomes revealed that C. auriculatum is most closely related to Cynanchum wilfordii, a medicinal plant.

Mazus sunhangii, a new species of Mazaceae from central China is described and illustrated based on evidence from morphology and molecular phylogeny. This new species is morphologically similar to M. puchellus and M. omeiensis but differs in erect habit, inflorescence position, leaf pattern and corolla color. Phylogenetic analysis based on four chloroplast DNA regions (rbcL, rps16, trnL-F, and psbA-trnH) identified the new species as the independent lineage sister to the other East Asian Mazus species. The new species is known only from a single location in Mt. Shennongjia area in northwest Hubei province, at the elevation of 760 m. The species grows on the limestone cliff, and, because a tourist arterial highway is located along this cliff, its habitat can be easily disturbed or destroyed. We propose that the only known species location is recognized as critical habitat (i.e., as the habitat required to ensure the persistence of a species) and the species listed as Critically Endangered based on the International Union for Conservation of Nature Red List Categories and Criteria B2a., Competing Interests: The authors have declared that no competing interests exist.

The complete chloroplast genome of the wild Cupressus gigantea (Cupressaceae) is determined in this study. The circular genome is 128 244 bp in length with 115 single copy genes and two duplicated genes (trnI-CAU and trnQ-UUG). This genome contains 82 protein-coding genes, four ribosomal RNA genes and 31 transfer RNA genes. In these genes, eight genes (atpF, rpoC1, ndhA, ndhB, petB, petD, rpl16 and rpl2) harbor a single intron and two genes (rps12 and ycf3) harbor two introns. This genome does not contain canonical IRs, and the overall GC content is 34.7%. A maximum parsimony phylogenetic analysis revealed that C. gigantea and C. sempervirens are more closely related.

Echinolaena and Ichnanthus are two tropical grass genera distributed mostly in the Americas, characterized by the presence of rachilla appendages in the shape of convex swellings, scars or wings at the base of the upper anthecium. However, recent studies have shown that rachilla appendages arose several times independently in several groups within Paniceae and Paspaleae (Panicoideae). Thus, this study aimed to assess the monophyly of Echinolaena and Ichnanthus and their relationship to other genera of Paniceae and Paspaleae, especially those including species with rachilla appendages. Parsimony and Bayesian analyses of the cpDNA regions ndhF, rpl16, trnH-(rps19)-psbA, trnL-trnF, trnS-(psbZ)-trnG, and the rDNA ITS region included 29 of the 39 known species of Echinolaena and Ichnanthus, 23 of which were sampled for the first time. The multiple loci analyses indicated that Echinolaena and Ichnanthus are polyphyletic in their current circumscriptions, with species in four distinct lineages within subtribe Paspalinae, each one characterized by a single type of rachilla appendage. Thus, Echinolaena and Ichnanthus are each circumscribed in a narrow sense, and the other two lineages excluded from them are proposed as the new genera Hildaea and Oedochloa, resulting in 15 new combinations and the restablishment of I. oplismenoides Munro ex Döll., (Copyright © 2015 Elsevier Inc. All rights reserved.)

The present study illustrates an optimized sample preparation method for an efficient DNA isolation from low quantities of honey samples. A conventional PCR-based method was validated, which potentially enables characterization of plant species from as low as 3 ml bee-honey samples. In the present study, an anionic detergent was used to lyse the hard outer pollen shell, and DTT was used for isolation of thiolated DNA, as it might facilitate protein digestion and assists in releasing the DNA into solution, as well as reduce cross-links between DNA and other biomolecules. Optimization of both the quantity of honey sample and time duration for DNA isolation was done during development of this method. With the use of this method, chloroplast DNA was successfully PCR amplified and sequenced from honey DNA samples.

Biodiversity, phylogeography and population genetic studies will be revolutionized by access to large data sets thanks to next-generation sequencing methods. In this study, we develop an easy and cost-effective protocol for in-solution enrichment hybridization capture of complete chloroplast genomes applicable at deep-multiplexed levels. The protocol uses cheap in-house species-specific probes developed via long-range PCR of the entire chloroplast. Barcoded libraries are constructed, and in-solution enrichment of the chloroplasts is carried out using the probes. This protocol was tested and validated on six economically important West African crop species, namely African rice, pearl millet, three African yam species and fonio. For pearl millet, we also demonstrate the effectiveness of this protocol to retrieve 95% of the sequence of the whole chloroplast on 95 multiplexed individuals in a single MiSeq run at a success rate of 95%. This new protocol allows whole chloroplast genomes to be retrieved at a modest cost and will allow unprecedented resolution for closely related species in phylogeography studies using plastomes., (© 2014 John Wiley & Sons Ltd.)

Background: Performing chloroplast DNA (cpDNA) isolation is considered a major challenge among different plant groups, especially conifers. Isolating chloroplasts in conifers by such conventional methods as sucrose gradient and high salt has not been successful. So far, plastid genome sequencing protocols for conifer species have been based mainly on long-range PCR, which is known to be time-consuming and difficult to implement., Methodology/principal Findings: We developed a protocol for cpDNA isolation using three different conifer families: Araucaria angustifolia and Araucaria bidwilli (Araucariaceae), Podocarpus lambertii (Podocarpaceae) and Pinus patula (Pinaceae). The present protocol is based on high salt isolation buffer followed by saline Percoll gradient. Combining these two strategies allowed enhanced chloroplast isolation, along with decreased contamination caused by polysaccharides, polyphenols, proteins, and nuclear DNA in cpDNA. Microscopy images confirmed the presence of intact chloroplasts in high abundance. This method was applied to cpDNA isolation and subsequent sequencing by Illumina MiSeq (2×250 bp), using only 50 ng of cpDNA. Reference-guided chloroplast genome mapping showed that high average coverage was achieved for all evaluated species: 24.63 for A. angustifolia, 135.97 for A. bidwilli, 1196.10 for P. lambertii, and 64.68 for P. patula., Conclusion: Results show that this improved protocol is suitable for enhanced quality and yield of chloroplasts and cpDNA isolation from conifers, providing a useful tool for studies that require isolated chloroplasts and/or whole cpDNA sequences.

Sequencing of chloroplast genomes is a key tool for analysis of chloroplasts and the impact of manipulation of chloroplast genomes by biotechnology. Advances in genome sequencing allow the complete sequencing of the chloroplast genome and assessment of variation in the chloroplast genome sequences within a plant. Isolation of chloroplast DNA has been a traditional starting point in these analyses, but the capacity of current sequencing technologies allows effective analysis of the chloroplast genome sequence by shotgun sequencing of a preparation of total DNA from the plant. Chloroplast insertions in the nuclear genome can be distinguished by their much lower copy number. Short-read sequences are best assembled by alignment with a reference chloroplast genome.

This chapter introduces and reviews methods for analyzing variation in chloroplast DNA, mainly by polymerase chain reaction (PCR) and subsequent revelation of polymorphisms. Sources for chloroplast primers are discussed, as well as methods such as Sanger sequencing, PCR followed by restriction fragment length polymorphism (RFLP), gel electrophoresis, fragment analysis on automated DNA sequencers, denaturing high-performance liquid chromatography (dHPLC), and next-generation sequencing (NGS). A special section deals with peculiarities of chloroplast DNA variation, such as tandem repeats and mini- and microsatellites.

The phylogeographical patterns of Rhodiola dumulosa, an alpine plant species restrictedly growing in the crevices of rock piles, were investigated based on 4 fragments of the chloroplast genome. To cover the full distribution of R. dumulosa in China, 19 populations from 3 major disjunct distribution areas (northern, central, and northwestern China) were sampled. A total of 5881bp (after alignment) of chloroplast DNA (cpDNA) from 100 individuals were sequenced. The combined cpDNA data set yielded 36 haplotypes. The total genetic diversity of R. dumulosa was remarkably high (H(T) = 0.981). The interpopulation genetic differentiation was significantly large (F(ST) = 0.8537, P < 0.001), possibly due to the long-term isolation of the natural populations. N(ST) was significantly larger than G(ST) (P < 0.001), indicating the presence of phylogeographical structure among the R. dumulosa populations. We propose 2 migration steps to explain the current distribution of R. dumulosa in China. First, this species migrated from refugia in the Qinghai-Tibetan Plateau to northern areas via the intervening highlands when temperatures increased; second, the highland populations migrated toward the mountaintops when temperatures increased further because R. dumulosa is adapted to cold environments. During the second migration step, the common ancestral haplotypes may have been gradually lost.

Chloroplast sequence contamination in 16S ribosomal RNA gene (16S) analyses can be particularly problematic when sampling microbial communities in plants and folivorous arthropods. We previously encountered high levels of plastid contamination in herbivorous insect samples when we used the predominant 454 pyrosequencing 16S methodologies described in the literature. 799F, a primer previously found to exclude chloroplast sequences, was modified to enhance its efficacy, and we describe, in detail, our methodology throughout amplicon pyrosequencing. Thirteen versions of 799F were assessed for the exclusion of chloroplast sequences from our samples. We found that a shift in the mismatch between 799F and chloroplast 16S resulted in significant reduction of chloroplast reads. Our results also indicate that amplifying sequences from environmental samples in a two-step PCR process, with the addition of the multiplex identifiers and 454 adapters in a second round of PCR, further improved primer specificity. Primers that included 3' phosphorothioate bonds, which were designed to block primer degradation, did not amplify consistently across samples. The different forward primers do not appear to bias the bacterial communities detected. We provide a methodological framework for reducing chloroplast reads in high-throughput sequencing data sets that can be applied to a number of environmental samples and sequencing techniques., (© 2013.)

We report an efficient, simple, and cost-effective protocol for the isolation of genomic DNA from an aromatic medicinal plant, common sage (Salvia officinalis L.). Our modification of the standard CTAB protocol includes two polyphenol adsorbents (PVP 10 and activated charcoal), high NaCl concentrations (4 M) for removing polysaccharides, and repeated Sevag treatment to remove proteins and other carbohydrate contaminants. The mean DNA yield obtained with our Protocol 2 was 330.6 μg DNA g(-1) of dry leaf tissue, and the absorbance ratios 260/280 and 260/230 nm averaged 1.909 and 1.894, respectively, revealing lack of contamination. PCR amplifications of one nuclear (26S rDNA) and one chloroplast (rps16-trnK) locus indicated that our DNA isolation protocol may be used in common sage and other aromatic and medicinal plants containing essential oil for molecular biologic and biotechnological studies and for population genetics, phylogeographic, and conservation surveys in which nuclear or chloroplast genomes would be studied in large numbers of individuals.

Dried parts of different plant species often look alike, especially in powdered form, making them very difficult to identify. Ruta graveolens, sold as a dried medicinal herb, can be adulterated with Euphorbia dracunculoides. The genomic DNA was isolated from the leaf powder (100 mg each) using the modified CTAB method. Internal transcribed spacer sequences of nuclear ribosomal DNA (nrDNA-ITS), and chloroplast spacer sequences (rpoB and rpoC1) are regarded as potential genes for plant DNA barcoding. We amplified and sequenced these spacer sequences and confirmed the sequences with a BLAST search. Sequence alignment was performed using ClustalX to look for differences in the sequences. A DNA marker was developed based on rpoB and rpoC1 of the nrDNA-ITS for the identification of the adulterant E. dracunculoides in samples of R. graveolens that are sold in local herbal markets. Sequence-characterized amplified region markers of 289 and 264 bp for R. graveolens and 424 bp for E. dracunculoides were developed from dissimilar sequences of this nrDNA-ITS to speed up the authentication process. This marker successfully distinguished these species in extracted samples with as little as 5 ng DNA/μL extract.

Many areas of chloroplast research require methods that can assess the quality and quantity of chloroplast DNA (cpDNA). The study of chloroplast functions that depend on the proper maintenance and expression of the chloroplast genome, understanding cpDNA replication and repair, and the development of technologies for chloroplast transformation are just some of the disciplines that require the isolation of high-quality cpDNA. Arabidopsis thaliana offers several advantages for studying these processes because of the sizeable collection of mutants and natural varieties (accessions) available from stock centers and a broad community of researchers that has developed many other genetic resources. Several approaches for the isolation and quantification of cpDNA have been developed, but little consideration has been given to the strengths and weaknesses and the type of information obtained by each method, especially with respect to A. thaliana. Here, we provide protocols for obtaining high-quality cpDNA for PCR and other applications, and we evaluate several different isolation and analytical methods in order to build a robust framework for the study of cpDNA with this model organism.

Ethnopharmacological Relevance: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India., Aim of the Study: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools., Materials and Methods: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0., Results: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH., Conclusion: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus., (Copyright 2010 Elsevier Ireland Ltd. All rights reserved.)

Background: Heterokont algae form a monophyletic group within the stramenopile branch of the tree of life. These organisms display wide morphological diversity, ranging from minute unicells to massive, bladed forms. Surprisingly, chloroplast genome sequences are available only for diatoms, representing two (Coscinodiscophyceae and Bacillariophyceae) of approximately 18 classes of algae that comprise this taxonomic cluster. A universal challenge to chloroplast genome sequencing studies is the retrieval of highly purified DNA in quantities sufficient for analytical processing. To circumvent this problem, we have developed a simplified method for sequencing chloroplast genomes, using fosmids selected from a total cellular DNA library. The technique has been used to sequence chloroplast DNA of two Heterosigma akashiwo strains. This raphidophyte has served as a model system for studies of stramenopile chloroplast biogenesis and evolution., Results: H. akashiwo strain CCMP452 (West Atlantic) chloroplast DNA is 160,149 bp in size with a 21,822-bp inverted repeat, whereas NIES293 (West Pacific) chloroplast DNA is 159,370 bp in size and has an inverted repeat of 21,665 bp. The fosmid cloning technique reveals that both strains contain an isomeric chloroplast DNA population resulting from an inversion of their single copy domains. Both strains contain multiple small inverted and tandem repeats, non-randomly distributed within the genomes. Although both CCMP452 and NIES293 chloroplast DNAs contains 197 genes, multiple nucleotide polymorphisms are present in both coding and intergenic regions. Several protein-coding genes contain large, in-frame inserts relative to orthologous genes in other plastids. These inserts are maintained in mRNA products. Two genes of interest in H. akashiwo, not previously reported in any chloroplast genome, include tyrC, a tyrosine recombinase, which we hypothesize may be a result of a lateral gene transfer event, and an unidentified 456 amino acid protein, which we hypothesize serves as a G-protein-coupled receptor. The H. akashiwo chloroplast genomes share little synteny with other algal chloroplast genomes sequenced to date., Conclusion: The fosmid cloning technique eliminates chloroplast isolation, does not require chloroplast DNA purification, and reduces sequencing processing time. Application of this method has provided new insights into chloroplast genome architecture, gene content and evolution within the stramenopile cluster.

The size, structure and conformation of mitochondrial and plastid genomes differ dramatically among eukaryotes. Similarly, the yield and purity of extracted organelle DNA also vary, and are crucial factors for the success of restriction mapping and sequencing experiments. We describe here procedures for the purification of organelle DNA from a broad range of eukaryotes. By emphasizing the underlying principles, these procedures will facilitate the development of new species-specific protocols. The presented purification schemes involve either isolation of organelles and subsequent extraction of DNA from this subcellular fraction, or processing of whole-cell lysates followed by CsCl gradient centrifugation to separate nuclear and organelle DNAs according to their A + T content. We have successfully used the described procedures for organelle genome sequencing from diverse eukaryotes, including non-axenic protists. Procedures can be completed in 3-5 days, typically yielding a few micrograms of DNA-ample for sequencing complete genomes.

The chloroplast mat-K region and rpL16 intron region were sequenced for 14 species of Schisandraceae, representing both genera Kadsura Kaempf. ex Juss. and Schisandra Michx, to discuss the phylogeny of this family. Analyses were performed both in separate and combined sequence data sets (including the rbc-L sequence), with Illicium angustispealum A. C. Smith as the out-group. The results showed that the Schisandraceae are monophyletic. In all the analyses, Schisandra propinqua var. chinensis Oliva and Schisandra plena A. C. Smith were nested within Kadsura, which implies that the genera Kadsura and Schisandra are closely related. They might have originated from a common ancestor, but then evolved via different routes. The result inferred from the combined data showed a greater resolution within Schisandra than those from the two separate data sets. High bootstrap values supported the monophyly of most subgenera according to Law's system (1996). A combination of morphological, anatomical, and chemical analyses indicates that S. chinensis and S. rubriflora may be the primitive taxa in Schisandra.

During the past decade, there has been a rapid increase in our understanding of plastid genome organization and evolution due to the availability of many new completely sequenced genomes. There are 45 complete genomes published and ongoing projects are likely to increase this sampling to nearly 200 genomes during the next 5 years. Several groups of researchers including ours have been developing new techniques for gathering and analyzing entire plastid genome sequences and details of these developments are summarized in this chapter. The most important developments that enhance our ability to generate whole chloroplast genome sequences involve the generation of pure fractions of chloroplast genomes by whole genome amplification using rolling circle amplification, cloning genomes into Fosmid or bacterial artificial chromosome (BAC) vectors, and the development of an organellar annotation program (Dual Organellar GenoMe Annotator [DOGMA]). In addition to providing details of these methods, we provide an overview of methods for analyzing complete plastid genome sequences for repeats and gene content, as well as approaches for using gene order and sequence data for phylogeny reconstruction. This explosive increase in the number of sequenced plastid genomes and improved computational tools will provide many insights into the evolution of these genomes and much new data for assessing relationships at deep nodes in plants and other photosynthetic organisms.

A protocol that takes advantage of length heteroplasmy in domain V of chloroplast large subunit (cp23S)-ribosomal DNA to identify members of the symbiotic dinoflagellate genus Symbiodinium is presented. This protocol is highly specific for Symbiodinium, can provide intercladal and intracladal identification of a particular Symbiodinium isolate, and can detect multiple Symbiodinium chloroplast genotypes simultaneously in the same isolate, making his technique attractive for a variety of research questions. We used this technique to characterize variation among Symbiodinium populations associated with a range of phylogenetically diverse and geographically discrete hosts. We also examined symbiont variation within a single host, the Caribbean gorgonian Pseudopterogorgia elisabethae, from 9 sites in the Bahamas, and we report a previously undocumented level of symbiont specificity for particular members of Symbiodinium clade B in this gorgonian.

The mode of inheritance of chloroplast DNA has been determined in Encephalartos by employing a restriction fragment length polymorphism analysis of chloroplast DNA. Artificial F1 hybrids were produced between a female specimen of E. natalensis and a male specimen of E. woodii. The hybridization patterns of all hybrids correspond, in all cases, with that of E. natalensis, and are different from that of E. woodii, thus indicating the maternal inheritance of cpDNA in cycads.

Several models of hybrid zone evolution predict the same spatial patterns of genotypic distribution whether or not structuring is due to environment-dependent or -independent selection. In this study, we tested for evidence of environment-dependent selection in an Iris fulva x Iris brevicaulis hybrid population by examining the distribution of genotypes in relation to environmental gradients. We selected 201 Louisiana Iris plants from within a known hybrid population (80 m x 80 m) and placed them in four different genotypic classes (I. fulva, I. fulva-like hybrid, I. brevicaulis-like hybrid and I. brevicaulis) based on seven species-specific random amplified polymorphic DNA (RAPD) markers and two chloroplast DNA haplotypes. Environmental variables were then measured. These variables included percentage cover by tree canopy, elevation from the high water mark, soil pH and percentage soil organic matter. Each variable was sampled for all 201 plants. Canonical discriminant analysis (CDA) was used to infer the environmental factors most strongly associated with the different genotypic groups. Slight differences in elevation (-0.5 m to +0.4 m) were important for distinguishing habitat distributions described by CDA, even though there were no statistical differences between mean elevations alone. I. brevicaulis occurred in a broad range of habitats, while I. fulva had a narrower distribution. Of all the possible combinations, I. fulva-like hybrids and I. brevicaulis-like hybrids occurred in the most distinct habitat types relative to one another. Each hybrid class was not significantly different from its closest parent with regard to habitat occupied, but was statistically unique from its more distant parental species. Within the hybrid genotypes, most, but not all, RAPD loci were individually correlated with environmental variables. This study suggests that, at a very fine spatial scale, environment-dependent selection contributed to the genetic structuring of this hybrid zone.

A DNA fiber-based fluorescence in situ hybridization (fiber-FISH) technique was developed to analyze the structure and organization of a large number of intact chloroplast DNA (cpDNA) molecules from Arabidopsis, tobacco, and pea. Using this cytogenomic approach, we determined that 25 to 45% of the cpDNA within developing leaf tissue consists of circular molecules. Both linear and circular DNA fibers with one to four copies of the chloroplast genome were present, with monomers being the predominant structure. Arabidopsis and tobacco chloroplasts contained previously unidentified multimers (>900 kb) consisting of six to 10 genome equivalents. We further discovered rearranged cpDNA molecules of incomplete genome equivalents, confirmed by both differential hybridizations and size estimations. The unique cpDNA organization and novel structures revealed in this study demonstrate that higher plant cpDNA is more structurally plastic than previous sequence and electrophoretic analyses have suggested. Additionally, we demonstrate how the fiber-FISH-based cytogenomic approach allows for powerful analysis of very rare events that cannot be detected by traditional techniques such as DNA gel blot hybridization or polymerase chain reaction.

A cDNA encoding a plant-type APS reductase was isolated from an axenic cell suspension culture of Catharanthus roseus (Genbank/EMBL-databank accession number U63784). The open reading frame of 1392 bp (termed par) encoded for a protein (Mr=51394) consisting of a N-terminal transit peptide, a PAPS reductase-like core and a C-terminal extension with homology to the thioredoxin-like domain of protein disulfide isomerase. The APS reductase precursor was imported into pea chloroplasts in vitro and processed to give a mature protein of approximately 45 kDa. The homologous protein from pea chloroplast stroma was detected using anti:par polyclonal antibodies. To investigate the catalytical function of the different domains deleted par proteins were purified. ParDelta1 lacking the transit sequence liberated sulfite from APS (Km 2.5+/-0.23 microM) in vitro with glutathione (Km 3+/-0.64 mM) as reductant (Vmax 2.6+/-0.14 U mg-1, molecular activity 126 min-1). ParDelta2 lacking the transit sequence and C-terminal domain had to be reconstituted with exogenous thioredoxin as reductant (Km 15. 3+/-1.27 microM, Vmax 0.6+/-0.014 U mg-1). Glutaredoxin, GSH or DTT were ineffective substitutes. ParDelta1 (35.4%) and parDelta2 (21. 8%) both exhibited insulin reductase activity comparable to thioredoxin (100%). Protein disulfide isomerase activity was observed for parDelta1.

A full-length cDNA of soybean chloroplastic fructose-1,6-bisphosphatase was cloned and sequenced. The cDNA contained 1321 bp with 5' (26 bp) and 3' (88 bp) untranslated regions. The open reading frame of the cDNA contained 1206 bp corresponding to a polypeptide of 402 amino acids with 50 amino acid residues of a transit peptide at N-terminus that is necessary for transport into the chloroplast. A unique site relevant to the action of thioredoxin f was conserved at 221 amino acid residue. Northern blot analysis indicated that the expression of the enzyme was regulated by light illumination.