Search

Life at Berkeley for the past 57 years involved research on the thermodynamics, kinetics, and spectroscopic properties of RNA to better understand its structures, interactions, and functions. We (myself and all the graduate students and postdocs who shared in the fun) began with dinucleoside phosphates and slowly worked our way up to megadalton-sized RNA molecular motors. We used UV absorption, circular dichroism, circular intensity differential scattering, fluorescence, NMR, and single-molecule methods. We learned a lot and had fun doing it.

Much of the dynamics information is lost in bulk measurements because of the population averaging. Single-molecule methods measure one molecule at a time; they provide knowledge not obtainable by other means. In this article, we review the application of the two most widely used single-molecule methods--fluorescence resonance energy transfer (FRET) and force versus extension measurements--to several RNA reactions. First, we discuss folding/unfolding studies on a hairpin ribozyme that revealed multiple conformations of the RNA with distinct kinetics, and on a series of RNA pseudoknots, whose mechanical stabilities were found to show a strong correlation with their frameshifting efficiency during translation. We also discuss several RNA-related molecular motors. Single-molecule experiments revealed detailed mechanisms for the interaction of HIV reverse transcriptase and nucleic acid helicases (NS3 and RIG-1) with their substrates. Optical tweezers studies showed that translation of a single messenger RNA by a ribosome occurs by successive translocation-and-pause cycles. Single-molecule FRET experiments yielded important information on ribosome conformational changes and tRNA dynamics during translation. Overall, single-molecule experiments have been very valuable for understanding RNA reactions.

The pseudoknot is an important RNA structural element that provides an excellent model system for studying the contributions of tertiary interactions to RNA stability and to folding kinetics. RNA pseudoknots are also of interest because of their key role in the control of ribosomal frameshifting by viral RNAs. Their mechanical properties are directly relevant to their unfolding by ribosomes during translation. We have used optical tweezers to study the kinetics and thermodynamics of mechanical unfolding and refolding of single RNA molecules. Here we describe the unfolding of the frameshifting pseudoknot from infectious bronchitis virus (IBV), three constituent hairpins, and three mutants of the IBV pseudoknot. All four pseudoknots cause -1 programmed ribosomal frameshifting. We have measured the free energies and rates of mechanical unfolding and refolding of the four frameshifting pseudoknots. Our results show that the IBV pseudoknot requires a higher force than its corresponding hairpins to unfold. Furthermore, its rate of unfolding changes little with increasing force, in contrast with the rate of hairpin unfolding. The presence of Mg(2+) significantly increases the kinetic barriers to unfolding the IBV pseudoknot, but has only a minor effect on the hairpin unfolding. The greater mechanical stability of pseudoknots compared to hairpins, and their kinetic insensitivity to force supports the hypothesis that -1 frameshifting depends on the difficulty of unfolding the mRNA.

Understanding how RNA folds and what causes it to unfold has become more important as knowledge of the diverse functions of RNA has increased. Here we review the contributions of single-molecule experiments to providing answers to questions such as: How much energy is required to unfold a secondary or tertiary structure? How fast is the process? How do helicases unwind double helices? Are the unwinding activities of RNA-dependent RNA polymerases and of ribosomes different from other helicases? We discuss the use of optical tweezers to monitor the unfolding activities of helicases, polymerases, and ribosomes, and to apply force to unfold RNAs directly. We also review the applications of fluorescence and fluorescence resonance energy transfer to measure RNA dynamics.

Using optical tweezers, we have measured the effect of monovalent cation concentration and species on the folding free energy of five large (49-124 nt) RNA hairpins, including HIV-1 TAR and molecules approximating A.U and G.C homopolymers. RNA secondary structure thermodynamics are accurately described by a model consisting of nearest-neighbor interactions and additive loop and bulge terms. Melting of small (<15 bp) duplexes and hairpins in 1 M NaCl has been used to determine the parameters of this model, which is now used extensively to predict structure and folding dynamics. Few systematic measurements have been made in other ionic conditions or for larger structures. By applying mechanical force, we measured the work required to fold and unfold single hairpins at room temperature over a range of cation concentrations from 50 to 1000 mM. Free energies were then determined using the Crooks fluctuation theorem. We observed the following: (1) In most cases, the nearest-neighbor model accurately predicted the free energy of folding at 1 M NaCl. (2) Free energy was proportional to the logarithm of salt concentration. (3) Substituting potassium ions for sodium slightly decreased hairpin stability. The TAR hairpin also misfolded nearly twice as often in KCl, indicating a differential kinetic response. (4) Monovalent cation concentration affects RNA stability in a sequence-dependent manner. G.C helices were unaffected by changing salt concentration, A.U helices were modestly affected, and the hairpin loop was very sensitive. Surprisingly, the U.C.U bulge of TAR was found to be equally stable in all conditions tested. We also report a new estimate for the elastic parameters of single-stranded RNA.

RNA unfolding and folding reactions in physiological conditions can be facilitated by mechanical force one molecule at a time. By using force-measuring optical tweezers, we studied the mechanical unfolding and folding of a hairpin-type pseudoknot in human telomerase RNA in a near-physiological solution, and at room temperature. Discrete two-state folding transitions of the pseudoknot are seen at approximately 10 and approximately 5 piconewtons (pN), with ensemble rate constants of approximately 0.1 sec(-1), by stepwise force-drop experiments. Folding studies of the isolated 5'-hairpin construct suggested that the 5'-hairpin within the pseudoknot forms first, followed by formation of the 3'-stem. Stepwise formation of the pseudoknot structure at low forces are in contrast with the one-step unfolding at high forces of approximately 46 pN, at an average rate of approximately 0.05 sec(-1). In the constant-force folding trajectories at approximately 10 pN and approximately 5 pN, transient formation of nonnative structures were observed, which is direct experimental evidence that folding of both the hairpin and pseudoknot takes complex pathways. Possible nonnative structures and folding pathways are discussed.

By exerting mechanical force, it is possible to unfold/refold RNA molecules one at a time. In a small range of forces, an RNA molecule can hop between the folded and the unfolded state with force-dependent kinetic rates. Here, we introduce a mesoscopic model to analyze the hopping kinetics of RNA hairpins in an optical tweezers setup. The model includes different elements of the experimental setup (beads, handles, and RNA sequence) and limitations of the instrument (time lag of the force-feedback mechanism and finite bandwidth of data acquisition). We investigated the influence of the instrument on the measured hopping rates. Results from the model are in good agreement with the experiments reported in the companion article. The comparison between theory and experiments allowed us to infer the values of the intrinsic molecular rates of the RNA hairpin alone and to search for the optimal experimental conditions to do the measurements. We conclude that the longest handles and softest traps that allow detection of the folding/unfolding signal (handles approximately 5-10 Kbp and traps approximately 0.03 pN/nm) represent the best conditions to obtain the intrinsic molecular rates. The methodology and rationale presented here can be applied to other experimental setups and other molecules.

Experimental variables of optical tweezers instrumentation that affect RNA folding/unfolding kinetics were investigated. A model RNA hairpin, P5ab, was attached to two micron-sized beads through hybrid RNA/DNA handles; one bead was trapped by dual-beam lasers and the other was held by a micropipette. Several experimental variables were changed while measuring the unfolding/refolding kinetics, including handle lengths, trap stiffness, and modes of force applied to the molecule. In constant-force mode where the tension applied to the RNA was maintained through feedback control, the measured rate coefficients varied within 40% when the handle lengths were changed by 10-fold (1.1-10.2 Kbp); they increased by two- to threefold when the trap stiffness was lowered to one-third (from 0.1 to 0.035 pN/nm). In the passive mode, without feedback control and where the force applied to the RNA varied in response to the end-to-end distance change of the tether, the RNA hopped between a high-force folded-state and a low-force unfolded-state. In this mode, the rates increased up to twofold with longer handles or softer traps. Overall, the measured rates remained with the same order-of-magnitude over the wide range of conditions studied. In the companion article on pages 3010-3021, we analyze how the measured kinetics parameters differ from the intrinsic molecular rates of the RNA, and thus how to obtain the molecular rates.

The rugged folding-energy landscapes of RNAs often display many competing minima. How do RNAs discriminate among competing conformations in their search for the native state? By using optical tweezers, we show that the folding-energy landscape can be manipulated to control the fate of an RNA: individual RNA molecules can be induced into either native or misfolding pathways by modulating the relaxation rate of applied force and even be redirected during the folding process to switch from misfolding to native folding pathways. Controlling folding pathways at the single-molecule level provides a way to survey the manifold of folding trajectories and intermediates, a capability that previously was available only to theoretical studies.

Single-molecule methods have made it possible to apply force to an individual RNA molecule. Two beads are attached to the RNA; one is on a micropipette, the other is in a laser trap. The force on the RNA and the distance between the beads are measured. Force can change the equilibrium and the rate of any reaction in which the product has a different extension from the reactant. This review describes use of laser tweezers to measure thermodynamics and kinetics of unfolding/refolding RNA. For a reversible reaction the work directly provides the free energy; for irreversible reactions the free energy is obtained from the distribution of work values. The rate constants for the folding and unfolding reactions can be measured by several methods. The effect of pulling rate on the distribution of force-unfolding values leads to rate constants for unfolding. Hopping of the RNA between folded and unfolded states at constant force provides both unfolding and folding rates. Force-jumps and force-drops, similar to the temperature jump method, provide direct measurement of reaction rates over a wide range of forces. The advantages of applying force and using single-molecule methods are discussed. These methods, for example, allow reactions to be studied in non-denaturing solvents at physiological temperatures; they also simplify analysis of kinetic mechanisms because only one intermediate at a time is present. Unfolding of RNA in biological cells by helicases, or ribosomes, has similarities to unfolding by force.

By using optical tweezers, we have investigated the mechanical unfolding of a minimal kissing complex with only two G.C base pairs. The loop-loop interaction is exceptionally stable; it is disrupted at forces ranging from 7 to 30 pN, as compared with 14-20 pN for unfolding hairpins of 7 and 11 bp. By monitoring unfolding/folding trajectories of single molecules, we resolved the intermediates, measured their rate constants, and pinpointed the rate-limiting steps. The two hairpins unfold only after breaking the intramolecular kissing interaction, and the kissing interaction forms only after the folding of the hairpins. At forces that favor the unfolding of the hairpins, the entire RNA structure is kinetically stabilized by the kissing interaction, and extra work is required to unfold the metastable hairpins. The strong mechanical stability of even a minimal kissing complex indicates the importance of such loop-loop interactions in initiating and stabilizing RNA dimers in retroviruses.

Helicases are a ubiquitous class of enzymes involved in nearly all aspects of DNA and RNA metabolism. Despite recent progress in understanding their mechanism of action, limited resolution has left inaccessible the detailed mechanisms by which these enzymes couple the rearrangement of nucleic acid structures to the binding and hydrolysis of ATP. Observing individual mechanistic cycles of these motor proteins is central to understanding their cellular functions. Here we follow in real time, at a resolution of two base pairs and 20 ms, the RNA translocation and unwinding cycles of a hepatitis C virus helicase (NS3) monomer. NS3 is a representative superfamily-2 helicase essential for viral replication, and therefore a potentially important drug target. We show that the cyclic movement of NS3 is coordinated by ATP in discrete steps of 11 +/- 3 base pairs, and that actual unwinding occurs in rapid smaller substeps of 3.6 +/- 1.3 base pairs, also triggered by ATP binding, indicating that NS3 might move like an inchworm. This ATP-coupling mechanism is likely to be applicable to other non-hexameric helicases involved in many essential cellular functions. The assay developed here should be useful in investigating a broad range of nucleic acid translocation motors.

Mechanical unfolding and refolding of single RNA molecules have previously been observed in optical traps as sudden changes in molecular extension. Two methods have been traditionally used: "force-ramp", with the applied force continuously changing, and "hopping". In hopping experiments the force is held constant and the molecule jumps spontaneously between two different states. Unfolding/refolding rates are measured directly, but only over a very narrow range of forces. We have now developed a force-jump method to measure the unfolding and refolding rates independently over a wider range of forces. In this method, the applied force is rapidly stepped to a new value and either the unfolding or refolding event is monitored through changes in the molecular extension. The force-jump technique is compared to the force-ramp and hopping methods by using a 52-nucleotide RNA hairpin with a three-nucleotide bulge, i.e., the transactivation response region RNA from the human immunodeficiency virus. We find the unfolding kinetics and Gibbs free energies obtained from all three methods to be in good agreement. The transactivation response region RNA hairpin unfolds in an all-or-none two-state reaction at any loading rate with the force-ramp method. The unfolding reaction is reversible at small loading rates, but shows hysteresis at higher loading rates. Although the RNA unfolds and refolds without detectable intermediates in constant-force conditions (hopping and force-jump), it shows partially folded intermediates in force-ramp experiments at higher unloading rates. Thus, we find that folding of RNA hairpins can be more complex than a simple single-step reaction, and that application of several methods can improve understanding of reaction mechanisms.

Atomic force microscopes and optical tweezers are widely used to probe the mechanical properties of individual molecules and molecular interactions, by exerting mechanical forces that induce transitions such as unfolding or dissociation. These transitions often occur under nonequilibrium conditions and are associated with hysteresis effects-features usually taken to preclude the extraction of equilibrium information from the experimental data. But fluctuation theorems allow us to relate the work along nonequilibrium trajectories to thermodynamic free-energy differences. They have been shown to be applicable to single-molecule force measurements and have already provided information on the folding free energy of a RNA hairpin. Here we show that the Crooks fluctuation theorem can be used to determine folding free energies for folding and unfolding processes occurring in weak as well as strong nonequilibrium regimes, thereby providing a test of its validity under such conditions. We use optical tweezers to measure repeatedly the mechanical work associated with the unfolding and refolding of a small RNA hairpin and an RNA three-helix junction. The resultant work distributions are then analysed according to the theorem and allow us to determine the difference in folding free energy between an RNA molecule and a mutant differing only by one base pair, and the thermodynamic stabilizing effect of magnesium ions on the RNA structure.

We have used laser tweezers to unfold single RNA molecules at room temperature and in physiological-type solvents. The forces necessary to unfold the RNAs are over the range 10-20 pN, forces that can be generated by cellular enzymes. The Gibbs free energy for the unfolding of TAR (transactivation-responsive) RNA from HIV was found to be increased after the addition of argininamide; the TAR hairpin was stabilized. The rate of unfolding was decreased and the rate of folding was increased by argininamide.

Single-molecule studies of RNA folding and unfolding are providing impressive details of the intermediates that occur and their rates of interconversion. The folding and unfolding of RNA are controlled by varying the concentration of magnesium ions and measuring fluorescence energy transfer, or by applying force to the RNA and measuring the end-to-end distance. The hierarchical nature of RNA folding - first secondary structure, then tertiary structure - makes the process susceptible to analysis and prediction.

The effect of force on the thermodynamics and kinetics of reactions is described. The key parameters are the difference in end-to-end distance between reactant and product for thermodynamics, and the distance to the transition state for kinetics. I focus the review on experimental results on force unfolding of RNA. Methods to measure Gibbs free energies and kinetics for reversible and irreversible reactions are described. The use of the worm-like-chain model to calculate the effects of force on thermodynamics and kinetics is illustrated with simple models. The main purpose of the review is to describe the simple experiments that have been done so far, and to encourage more people to enter a field that is new and full of opportunities.

The Watson-Crick double helix of DNA was first revealed in 1953. Since then a wide range of physical chemical methods have been applied to DNA and to its more versatile relative RNA to determine their structures and functions. My major goal is to predict the folded structure of any RNA from its sequence. We have used bulk and single-molecule measurements of thermodynamics and kinetics, plus various spectroscopic methods (UV absorption, optical rotation, circular dichroism, circular intensity differential scattering, fluorescence, NMR) to approach this goal.

Here we use mechanical force to induce the unfolding and refolding of single RNA molecules: a simple RNA hairpin, a molecule containing a three-helix junction, and the P5abc domain of the Tetrahymena thermophila ribozyme. All three molecules (P5abc only in the absence of Mg2+) can be mechanically unfolded at equilibrium, and when kept at constant force within a critical force range, are bi-stable and hop between folded and unfolded states. We determine the force-dependent equilibrium constants for folding/unfolding these single RNA molecules and the positions of their transition states along the reaction coordinate.

The solution structure of a 22 nt RNA hairpin and its complex with Co(NH(3))(6)(3+) bound to the GAAA tetraloop has been determined by NMR spectroscopy. Co(NH(3))(6)(3+) has a similar geometry to Mg(H(2)O)(6)(2+) and can be used as a probe for binding sites of completely solvated magnesium ions. The hairpin contains tandem G.A mismatches, similar to the P5abc region of a group I intron, and is closed by a GAAA tetraloop. The tandem G.A mismatches are imino hydrogen bonded in contrast with the sheared G.A mismatches found in a different context in the crystal structure of the P4-P6 domain. Chemical shift changes of the imino protons upon titration of the RNA hairpin with Mg(2+) and with Co(NH(3))(6)(3+) were used to identify ion-binding sites. Paramagnetic resonance broadening upon titration with Mn(2+) was also used. The titration curves gave dissociation binding constants for the magnesium ions in the millimolar range, similar to the binding in the major groove of RNA at tandem G.U base-pairs. Although the largest chemical shift change occurred at an imino proton of one of the G.A base-pairs, no nuclear Overhauser enhancement cross-peaks between the cobalt ligand and neighboring RNA protons were seen, presumably due to the high mobility of the Co(NH(3))(6)(3+) at this site. Nuclear Overhauser enhancement cross-peaks between Co(NH(3))(6)(3+) and the GAAA tetraloop were observed, which allowed the determination of the structure of the tetraloop binding site. The Co(NH(3))(6)(3+) is bound in the major groove of the GAAA tetraloop with hydrogen bonds to guanine base N7 and to phosphate oxygen atoms of the tetraloop., (Copyright 2000 Academic Press.)

To understand the RNA-folding problem, we must know the extent to which RNA structure formation is hierarchical (tertiary folding of preformed secondary structure). Recently, nuclear magnetic resonance (NMR) spectroscopy was used to show that Mg2+-dependent tertiary interactions force secondary structure rearrangement in the 56-nt tP5abc RNA, a truncated subdomain of the Tetrahymena group I intron. Here we combine mutagenesis with folding computations, nondenaturing gel electrophoresis, high-resolution NMR spectroscopy, and chemical-modification experiments to probe further the energetic interplay of tertiary and secondary interactions in tP5abc. Point mutations predicted to destabilize the secondary structure of folded tP5abc greatly disrupt its Mg2+-dependent folding, as monitored by nondenaturing gels. Imino proton assignments and sequential NOE walks of the two-dimensional NMR spectrum of one of the tP5abc mutants confirm the predicted secondary structure, which does not change in the presence of Mg2+. In contrast to these data on tP5abc, the same point mutations in the context of the P4-P6 domain (of which P5abc is a subdomain) shift the Mg2+ dependence of P4-P6 folding only moderately, and dimethyl sulfate (DMS) modification experiments demonstrate that Mg2+ does cause secondary structure rearrangement of the P4-P6 mutants' P5abc subdomains. Our data provide experimental support for two simple conclusions: (1) Even single point mutations at bases involved only in secondary structure can be enough to tip the balance between RNA tertiary and secondary interactions. (2) Domain context must be considered in evaluating the relative importance of tertiary and secondary contributions. This tertiary/secondary interplay is likely relevant to the folding of many large RNA and to bimolecular snRNA-snRNA and snRNA-intron RNA interactions.

We describe the RNA folding problem and contrast it with the much more difficult protein folding problem. RNA has four similar monomer units, whereas proteins have 20 very different residues. The folding of RNA is hierarchical in that secondary structure is much more stable than tertiary folding. In RNA the two levels of folding (secondary and tertiary) can be experimentally separated by the presence or absence of Mg2+. Secondary structure can be predicted successfully from experimental thermodynamic data on secondary structure elements: helices, loops, and bulges. Tertiary interactions can then be added without much distortion of the secondary structure. These observations suggest a folding algorithm to predict the structure of an RNA from its sequence. However, to solve the RNA folding problem one needs thermodynamic data on tertiary structure interactions, and identification and characterization of metal-ion binding sites. These data, together with force versus extension measurements on single RNA molecules, should provide the information necessary to test and refine the proposed algorithm., (Copyright 1999 Academic Press.)

Coherences were observed between 15N3 of cytosine and its trans amino proton (H42) using a modified gradient-based heteronuclear single quantum coherence (HSQC) pulse sequence optimized for three-bond proton-nitrogen couplings. The method is demonstrated with a 22-nucleotide RNA fragment of the P5abc region of a group I intron uniformly labeled with 15N. Use of intraresidue 15N3-amino proton couplings to assign cytosine 15N3 signals complements the recently proposed JNN HNN COSY [Dingley, A.J. and Grzesiek, S. (1998) J. Am. Chem. Soc., 120, 8293-8297] method of identifying hydrogen-bonded base pairs in RNA.

An RNA spin-labeling technique was developed using the well-characterized interaction between the HIV Rev peptide and the Rev response element (RRE) RNA as a model system. Spin-labeled RNA molecules were prepared by incorporating guanosine monophosphorothioate (GMPS) at the 5' end using T7 RNA polymerase and then covalently attaching a thiol-specific nitroxide spin label. Three different constructs of the RRE RNA were made by strategically displacing the 5' end within the native three-dimensional structure. Nitroxide-to-nitroxide distance measurements were made between the specifically bound RNA and peptide using electron paramagnetic resonance (EPR) spectroscopy. The dipolar EPR method can reliably measure distances up to 25 A, the calculation of which is derived from the 1/r3 dependence of the broadening of EPR lines in motionally frozen samples. This RNA-labeling technique, dubbed 5' displacement spin labeling, extends the usefulness of the dipolar EPR method developed for analysis of protein structure. The advantage of this technique is that it is applicable to large RNA systems such as the ribosome, which are difficult to study by other structural methods.

Identification and characterization of a metal ion binding site in an RNA pseudoknot was accomplished using cobalt (III) hexammine, Co(NH3)63+, as a probe for magnesium (II) hexahydrate, Mg(H2O)62+, in nuclear magnetic resonance (NMR) structural studies. The pseudoknot causes efficient -1 ribosomal frameshifting in mouse mammary tumor virus. Divalent metal ions, such as Mg2+, are critical for RNA structure and function; Mg2+preferentially stabilizes the pseudoknot relative to its constituent hairpins. The use of Co(NH3)63+as a substitute for Mg2+was investigated by ultraviolet absorbance melting curves, NMR titrations of the imino protons, and analysis of NMR spectra in the presence of Mg2+or Co (NH3)63+. The structure of the pseudoknot-Co(NH3)63+complex reveals an ion-binding pocket formed by a short, two-nucleotide loop and the major groove of a stem. Co(NH3)63+stabilizes the sharp loop-to-stem turn and reduces the electrostatic repulsion of the phosphates in three proximal strands. Hydrogen bonds are identified between the Co(NH3)63+protons and non-bridging phosphate oxygen atoms, 2' hydroxyl groups, and nitrogen and oxygen acceptors on the bases. The binding site is significantly different from that previously characterized in the major groove surface of tandem G.U base-pairs, but is similar to those observed in crystal structures of a fragment of the 5 S rRNA and the P5c helix of the Tetrahymena thermophila group I intron. Changes in chemical shifts occurred at the same pseudoknot protons on addition of Mg2+as on addition of Co(NH3)63+, indicating that both ions bind at the same site. Ion binding dissociation constants of approximately 0.6 mM and 5 mM (in 200 mM Na+and a temperature of 15 degrees C) were obtained for Co(NH3)63+and Mg2+, respectively, from the change in chemical shift as a function of metal ion concentration. An extensive array of non-sequence-specific hydrogen bond acceptors coupled with conserved structural elements within the binding pocket suggest a general mode of divalent metal ion stabilization of this type of frameshifter pseudoknot. These results provide new thermodynamic and structural insights into the role divalent metal ions play in stabilizing RNA tertiary structural motifs such as pseudoknots., (Copyright 1999 Academic Press.)

The secondary structure of the P5abc subdomain (a 56-nt RNA) of the Tetrahymena thermophila group I intron ribozyme has been determined by NMR. Its base pairing in aqueous solution in the absence of magnesium ions is significantly different from the RNA in a crystal but is consistent with thermodynamic predictions. On addition of magnesium ions, the RNA folds into a tertiary structure with greatly changed base pairing consistent with the crystal structure: three Watson-Crick base pairs, three G.U base pairs, and an extra-stable tetraloop are lost. The common assumption that RNA folds by first forming secondary structure and then forming tertiary interactions from the unpaired bases is not always correct.

We present a three-dimensional structure of a 34-nucleotide RNA molecule determined by NMR spectroscopy. The molecule was designed to form a junction between two double-helical stems whose sequence was based on the P4/P6 domain from group I introns. There are 5' and 3' single-strand overhangs at the junctions of the stems. Contrary to our expectations, we found that the 3' end of the molecule is placed in the minor and not the major groove of the P4 helix. As a result of tertiary contacts and stacking interactions from nucleotides in the 3' end, the junction helices are rotated in a left-handed fashion and do not stack coaxially. This conformation is highly dependent on the presence of single-stranded nucleotides at the 3' overhang. When the 3' end is removed, the molecule assumes a radically different structure with 5' end in the minor groove of the P6 helix and overall right-handed rotation between the stems. Only one nucleotide at the 3' end is sufficient to change the geometry of the junction.

Efficient syntheses of pyrimidine and purine nucleosides and nucleotides with selective 13C enrichment in the base moieties are described. Uridine and cytidine are labeled at position C6 and adenosine and guanosine are labeled at position C8. The selectively labeled nucleosides were converted to nucleoside triphosphates and used with in vitro transcription to synthesize labeled RNA. Isotope-edited 12C and 13C sub-spectra of a omega 1-1/2-X-filtered NOESY experiment are demonstrated to be useful for making resonance assignments and for deriving structural information in large (> 20 nt) RNA molecules. The labeled RNAs also allow heteronuclear J-couplings and relaxation parameters to be measured without complications from 13C-13C J-couplings.

RNA molecules of > 20 nucleotides have been the focus of numerous recent NMR structural studies. Several investigators have used the UNCG family of hairpins to ensure proper folding. We show that th UUCG hairpin has a minimum requirement of a two base-pair stem. Hairpins with a CG loop closing base pair and an initial 5'CG or 5'GC base pair have a melting temperature approximately 55 degrees C in 10 mM sodium phosphate. The high stability of even such small hairpins suggests that the hairpin can serve as a nucleation site for folding. For high resolution NMR work, the UNCG loop family (UACG in particular) provides excellent spectroscopic markers in one-dimensional exchangeable spectra, in two-dimensional COSY spectra and in NOESY spectra that clearly define it as forming a hairpin. This allows straightforward initiation of chemical shift assignments.

Studies of RNA structural motifs at high resolution by NMR and X-ray crystallographic methods have provided many insights into the fundamental forces that give rise to the unique structural characteristics of RNA. Non-Watson-Crick purine-pyrimidine, purine-purine, and pyrimidine-pyrimidine base pairing, as well as base-phosphate and base-ribose hydrogen bonding, are important forces for folding and stabilizing RNA structures. Base stacking is as important in determining RNA conformations as hydrogen bonding interactions. With the noncanonical interactions, many single-stranded loop regions such as hairpin loops, bulge loops, and internal loops fold into well-defined secondary structures. Loop-loop and loop-helix interactions can produce tertiary structures such as pseudoknots. Also, single strands adjacent to helical regions can form tertiary contacts with base-paired nucleotides of the helices. As we learn more about the structures of the important motifs we can ask more specific questions about the mechanisms of RNA-mediated functions. Conformational flexibility rather than a specific shape of the RNA may be important for some biological reactions. However, knowledge of the structures and the ease of conformational change of the molecules involved in any process are essential for understanding and eventually controlling the process.

The solution structure of the DNA analogue of the unusually stable r[C(UUCG)G] RNA hairpin, 5'-d[GGA-C(TTCG)GTCC]-3', has been determined by NMR spectroscopy, and its structure has been compared to that of the RNA molecule. The RNA molecule is compact and rigid with a highly structured loop. However, the DNA molecule is much less structured. The DNA hairpin contains a B-form stem of four base pairs. The terminal base pair frays, and the 3'-terminal nucleotides, C11 and C12, are in equilibrium between 2'-endo and 3'-endo conformations. Unlike the RNA loop, the DNA loop contains no syn nucleotides, and there is no evidence for base-base or base-phosphate hydrogen bonding in the loop. The loop is flexible, and reveals no specific internucleotide interactions.

The hairpin stem-loop form of the RNA oligonucleotide rCGC(UUU)GCG has been studied by NMR spectroscopy. In 10 mM phosphate buffer this RNA molecule forms a unimolecular hairpin with a stem of three base pairs and a loop of three uridines, as judged by both NMR and UV absorbance melting behavior. Distance and torsion angle restraints were determined using homonuclear proton-proton and heteronuclear proton-phosphorus 2-D NMR. These values were used in restrained molecular dynamics to determine the structure of the hairpin. The stem has characteristics of A-form geometry, although distortion from A-form occurs in the 3'-side of the stem, presumably to aid in accommodating the small loop. The loop nucleotides adopt C2'-endo conformations. NOE's strongly suggest stacking of the uracils with the stem, especially the first uracil on the 5'-side of the loop. The reversal of the chain direction in the loop seems to occur between U5 and U6. Loop structures produced by molecular dynamics simulations had a wide range of conformations and did not show stacking of the uracils. A flexible loop with significant dynamics is consistent with all the data.

We determined the melting temperatures (Tm) and thermodynamic parameters of 15 RNA and 19 DNA hairpins at 1 M NaCl, 0.01 M sodium phosphate, 0.1 mM EDTA, at pH 7. All these hairpins have loops of four bases, the most common loop size in 16S and 23S ribosomal RNAs. The RNA hairpins varied in loop sequence, loop-closing base pair (A.U, C.G, or G.C), base sequence of the stem, and stem size (four or five base pairs). The DNA hairpins varied in loop sequence, loop-closing base pair (C.G, or G.C), and base sequence of the four base-pair stem. Thermodynamic properties of a hairpin may be represented by nearest-neighbor interactions of the stem plus contributions from the loop. Thus, we obtained thermodynamic parameters for the formation of RNA and DNA tetraloops. For the tetraloops we studied, a free energy of loop formation (at 37 degrees C) of about +3 kcal/mol is most common for either RNA or DNA. There are extra stable loops with delta G degrees 37 near +1 kcal/mol, but the sequences are not necessarily the same for RNA and DNA. The closing base pair is also important; changing from C.G to G.C lowered the stability of several tetraloops in both RNA and DNA. These values will be useful in predicting RNA and DNA secondary structures.

About 70% of the RNA tetra-loop sequences identified in ribosomal RNAs from different organisms fall into either (UNCG) or (GNRA) families (where N = A, C, G, or U; and R = A or G). RNA hairpins with these loop sequences form unusually stable tetra-loop structures. We have studied the RNA hairpin GGAC(UUCG)GUCC and several sequence variants to determine the effect of changing the loop sequence and the loop-closing base pair on the thermodynamic stability of (UNCG) tetra-loops. The hairpin GGAG(CUUG)CUCC with the conserved loop G(CUUG)C was also unusually stable. We have determined melting temperatures (Tm), and obtained thermodynamic parameters for DNA hairpins with sequences analogous to stable RNA hairpins with (UNCG), C(GNRA)G, C(GAUA)G, and G(CUUG)C loops. DNA hairpins with (TTCG), (dUdUCG), and related sequences in the loop, unlike their RNA counterparts, did not form unusually stable hairpins. However, DNA hairpins with the consensus loop sequence C(GNRA)G were very stable compared to hairpins with C(TTTT)G or C(AAAA)G loops. The C(GATA)G and G(CTTG)C loops were also extra stable. The relative stabilities of the unusually stable DNA hairpins are similar to those observed for their RNA analogs.

The structure of a very common RNA hairpin, 5'GGAC(UUCG)GUCC, has been determined in solution by NMR spectroscopy. The loop sequence, UUCG, occurs exceptionally often in ribosomal and other RNAs, and may serve as a nucleation site for RNA folding and as a protein recognition site. Reverse transcriptase cannot read through this loop, although it normally transcribes RNA secondary structure motifs. A hairpin with that loop displays unusually high thermodynamic stability; its stability decreases when conserved nucleotides are mutated. The three-dimensional structure for the hairpin was derived from interproton distances and scalar coupling constants determined by NMR using distance geometry, followed by restrained energy minimization. The structure was well-defined despite the conservative use of interproton distances, by constraining the backbone conformation by means of scalar coupling measurements. A mismatch G.U base pair, with syn-guanosine, closes the stem. This hairpin has a loop of only two nucleotides; both adopt C2'-endo sugar pucker. A sharp turn in the phosphodiester backbone is stabilized by a specific cytosine-phosphate contact, probably a hydrogen bond, and by stacking of the cytosine nucleotide on the G.U base pair. The structural features of the loop can explain the unusual thermodynamic stability of this hairpin and its sensitivity to mutations of loop nucleotides.

Hairpin loops are important structural elements of RNA, helping to define the three-dimensional structure of large RNAs and providing potential nucleation sites for RNA folding and interaction with other nucleic acids and proteins. Little, however, is known about the conformation of RNA hairpins, most of what we know coming from transfer RNA crystal structures and from studies of DNA hairpins. We report here the determination of the structure of a very stable and common RNA hairpin, 5'GGAC(UUCG)GUCC (loop nucleotides in parenthesis), by NMR spectroscopy. The sequence C(UUCG)G occurs very often in RNA and may be a nucleation site for RNA folding and a protein-binding site. A high-resolution structure for the hairpin was derived from interproton distances and scalar coupling constants determined by NMR. The loop is stabilized by a G.U base pair, with guanine in the syn conformation, a cytosine-phosphate contact and extensive base stacking. These findings and other structural features of the loop can explain the unusual stability of the hairpin and suggest why reverse transcriptase cannot read through the loop, although it can transcribe through other kinds of RNA secondary structure.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.

The hairpin conformation adopted by the RNA sequence 5'GCGAUUUCUGACCGCC3' has been studied by one- and two-dimensional NMR spectroscopy. Exchangeable imino spectra in 60 mM Na+ indicate that the hairpin has a stem of six base pairs (indicated by boldface type) and a loop of three nucleotides. NOESY spectra of nonexchangeable protons confirm the formation of the stem region. The duplex has an A-conformation and contains an A.C apposition; a G.U base pair closes the loop region. The stem nucleotides have C3'-endo sugar conformations, as expected of an A-form duplex, whereas the three loop nucleotides adopt C2'-endo sugar puckers. Stacking within the loop, C8 upon the sugar of U7, stabilizes the structure. The pH dependence of both the exchangeable and nonexchangeable NMR spectra is consistent with the formation of an A+.C base pair, protonated at the N1 position of adenine. The stability of the hairpin was probed by using absorbance melting curves. The hairpin structure with the A+.C base pair is about +2 kcal/mol less stable in free energy at 37 degrees C than the hairpin formed with an A.U pair replacing the A+.C pair.

Left-handed double-helical Z-RNA has been studied using the ribohexanucleotide pentaphosphate r(CpGpCpGpCpG). One-dimensional and two-dimensional proton nmr experiments were used to probe the structural details of the left-handed helix in concentrated sodium perchlorate solution. In 1M NaClO4 the RNA adopts the normal A-form double helix, and in 6M NaClO4 it is nearly all in the Z form. In 4M NaClO4 it exists as nearly equal parts of A form and Z form. Resonances corresponding to both A and Z form appear in the nmr spectrum, indicating that the duplex exchanges slowly between forms. Spin-spin coupling constants between protons in the ribose rings were used to determine the sugar-pucker conformations of the individual nucleotides. Quantitative nuclear Overhauser experiments were used to determine proton-proton distances within the nucleoside, and from these distances values for the glycosidic torsion angle were determined. The results show that the cytidines adopt C2'-endo sugar puckers (S type) with pseudo-rotation phase values (P) of approximately 165 degrees. The bases are in the anti conformation, with chi values of approximately -140 degrees. The internal guanosines adopt C3'-endo sugar puckers (N type) with P approximately 18 degrees, while the 3'-terminal guanosine ribose exists in an equilibrium between S- and N-type conformations. All three guanosine bases adopt the syn conformation, with chi approximately 70 degrees. The results indicate that the solution structure of Z-RNA is very similar to that of Z-DNA.

The mRNA of bacteriophage T4 contains a strikingly abundant intercistronic hairpin. Within the 55 kilobases of known T4 sequence, the hexanucleotide sequence CTTCGG is found 13 times in the DNA strand equivalent to mRNA sequences. In 12 of those occurrences, the sequence is flanked by inverted repeats predictive of RNA hairpins with UUCG in the loop. Avian myeloblastosis virus reverse transcriptase, which can traverse hairpins of larger calculated stability, terminates efficiently at these CUUCGG hairpins. Thermal denaturation studies of model hairpins show that the loop sequence UUCG dramatically stabilizes RNA hairpins when compared to a control sequence. These data, when combined with previously described parameters of helix stability, suggest that T4 has utilized this loop sequence to optimize the stability of intercistronic hairpins. The stability of CUUCGG hairpins is also utilized in the RNAs of many organisms besides T4.

The lifetime for opening of individual base pairs in a DNA (dCA5G + dCT5G), and RNA (rCA5G + rCU5G), and a hybrid DNA-RNA (rCA5G + dCT5G) helix have been measured by proton nuclear magnetic resonance. The lifetimes were obtained by saturation recovery experiments performed on the hydrogen-bonding imino protons of the Watson-Crick base pairs. In these oligonucleotide helices the observed relaxation rates were dominated by exchange with water, with the magnetic spin-lattice relaxation time of the imino protons possibly being important only at the lowest temperatures in the DNA helix. It was shown that three interior base pairs in the DNA heptamer dCA5G + dCT5G were in the open-limited region, which means that these imino protons exchange every time the base pair opens. The lifetime of the terminal G X C base pairs in the DNA helix are much shorter than the interior A X T base pairs. The pH dependence of the terminal base pairs indicated that the ends of the helix open and close many times before exchange of the imino protons with water takes place. The temperature dependence of the lifetimes of the interior A X T imino protons in the DNA helix showed that these protons exchange only when the double helix has dissociated into single strands. Thus, these lifetimes measure the rate for dissociation of the double helix. The activation energy for this process was found to be 47 kcal/mol. Comparison of the lifetimes of the interior protons in the DNA, RNA, and hybrid helices showed that the rates of dissociation of the RNA and hybrid helices are very similar at 5 degrees C, whereas the rate for the DNA helix was approximately 1 order of magnitude smaller than that for the other two helices. The reasons for the differences in the kinetics of the three helices are discussed, as are the general dynamics of oligonucleotide helices in solution.

The conformation and the dynamics of an RNA oligonucleotide (26 nucleotides) which is a model for loop E in eukaryotic 5S RNA have been investigated by one- and two-dimensional NMR. The central portion of the oligonucleotide contains two G A oppositions, a common feature of ribosomal RNAs. The exchangeable proton spectrum indicates that an internal loop separates two stems of four and five base pairs. This observation is not consistent with structures for loop E containing mismatched G.A base pairs proposed from chemical and enzymatic studies on Xenopus laevis 5S RNA. The nonexchangeable proton spectrum has been assigned by two-dimensional NMR. Scalar couplings from correlated experiments and interproton distances from NOESY experiments at short mixing times have been used to determine glycosidic angles, sugar puckers, and other conformational features. The conformation of the stems is very close to standard A-form RNA, and extensive base stacking continues into the internal loop. This result provides a structural basis for the large favorable enthalpy of duplex formation determined in thermodynamic studies. Unusual structural and dynamic features are localized in the nucleotides connecting the loop to the stems.