Search

Introduction Blood proteins are emerging as candidate biomarkers for Alzheimer's disease (AD). We systematically profiled the plasma proteome to identify novel AD blood biomarkers and develop a high-performance, blood-based test for AD. Methods We quantified 1160 plasma proteins in a Hong Kong Chinese cohort by high-throughput proximity extension assay and validated the results in an independent cohort. In subgroup analyses, plasma biomarkers for amyloid, tau, phosphorylated tau, and neurodegeneration were used as endophenotypes of AD. Results We identified 429 proteins that were dysregulated in AD plasma. We selected 19 "hub proteins" representative of the AD plasma protein profile, which formed the basis of a scoring system that accurately classified clinical AD (area under the curve = 0.9690-0.9816) and associated endophenotypes. Moreover, specific hub proteins exhibit disease stage-dependent dysregulation, which can delineate AD stages. Discussion This study comprehensively profiled the AD plasma proteome and serves as a foundation for a high-performance, blood-based test for clinical AD screening and staging.

Recent advances in genetic sequencing have enabled comprehensive genetic analyses of human diseases, resulting in the identification of numerous genetic risk factors for heritable disorders including Alzheimer’s disease (AD). Such analyses enable AD risk prediction well before disease onset, which is critical for early interventions. However, current analytical approaches have limited ability to accurately estimate the risk effects of genetic variants owing to epistatic effects, which have been overlooked in most previous studies, resulting in unsatisfactory disease risk prediction. Herein, we modeled AD polygenic risk using deep learning methods, which outperformed existing models (i.e., weighted polygenic risk score and lasso models) for classifying disease risk. Moreover, by examining the associations between the outcomes from deep learning methods and multi-omics data obtained from our in-house Chinese AD cohorts, we identified the pathways that are potentially regulated by AD polygenic risk, including immune-associated signaling pathways. Thus, our results demonstrate the utility of deep learning methods for modeling the genetic risks of human diseases, which can facilitate both disease risk classification and the study of disease mechanisms.

Summary Background The genetic basis of variation in the progression of primary tauopathies has not been determined. We aimed to identify genetic determinants of survival in progressive supranuclear palsy (PSP). Methods In stage one of this two stage genome-wide association study (GWAS), we included individuals with PSP, diagnosed according to pathological and clinical criteria, from two separate cohorts: the 2011 PSP GWAS cohort, from brain banks based at the Mayo Clinic (Jacksonville, FL, USA) and in Munich (Germany), and the University College London PSP cohort, from brain banks and the PROSPECT study, a UK-wide longitudinal study of patients with atypical parkinsonian syndromes. Individuals were included if they had clinical data available on sex, age at motor symptom onset, disease duration (from motor symptom onset to death or to the date of censoring, Dec 1, 2019, if individuals were alive), and PSP phenotype (with reference to the 2017 Movement Disorder Society criteria). Genotype data were used to do a survival GWAS using a Cox proportional hazards model. In stage two, data from additional individuals from the Mayo Clinic brain bank, which were obtained after the 2011 PSP GWAS, were used for a pooled analysis. We assessed the expression quantitative trait loci (eQTL) profile of variants that passed genome-wide significance in our GWAS using the Functional Mapping and Annotation of GWAS platform, and did colocalisation analyses using the eQTLGen and PsychENCODE datasets. Findings Data were collected and analysed between Aug 1, 2016, and Feb 1, 2020. Data were available for 1001 individuals of white European ancestry with PSP in stage one. We found a genome-wide significant association with survival at chromosome 12 (lead single nucleotide polymorphism rs2242367, p=7·5 × 10−10, hazard ratio 1·42 [95% CI 1·22–1·67]). rs2242367 was associated with survival in the individuals added in stage two (n=238; p=0·049, 1·22 [1·00–1·48]) and in the pooled analysis of both stages (n=1239; p=1·3 × 10−10, 1·37 [1·25–1·51]). An eQTL database screen revealed that rs2242367 is associated with increased expression of LRRK2 and two long intergenic non-coding RNAs (lncRNAs), LINC02555 and AC079630.4, in whole blood. Although we did not detect a colocalisation signal for LRRK2, analysis of the PSP survival signal and eQTLs for LINC02555 in the eQTLGen blood dataset revealed a posterior probability of hypothesis 4 of 0·77, suggesting colocalisation due to a single shared causal variant. Interpretation Genetic variation at the LRRK2 locus was associated with survival in PSP. The mechanism of this association might be through a lncRNA-regulated effect on LRRK2 expression because LINC02555 has previously been shown to regulate LRRK2 expression. LRRK2 has been associated with sporadic and familial forms of Parkinson's disease, and our finding suggests a genetic overlap with PSP. Further functional studies will be important to assess the potential of LRRK2 modulation as a disease-modifying therapy for PSP and related tauopathies. Funding PSP Association, CBD Solutions, Medical Research Council (UK).

A population of more than six million people worldwide at high risk of Alzheimer’s disease (AD) are those with Down Syndrome (DS, caused by trisomy 21 (T21)), 70% of whom develop dementia during lifetime, caused by an extra copy of β-amyloid-(Aβ)-precursor-protein gene. We report AD-like pathology in cerebral organoids grown in vitro from non-invasively sampled strands of hair from 71% of DS donors. The pathology consisted of extracellular diffuse and fibrillar Aβ deposits, hyperphosphorylated/pathologically conformed Tau, and premature neuronal loss. Presence/absence of AD-like pathology was donor-specific (reproducible between individual organoids/iPSC lines/experiments). Pathology could be triggered in pathology-negative T21 organoids by CRISPR/Cas9-mediated elimination of the third copy of chromosome 21 gene BACE2, but prevented by combined chemical β and γ-secretase inhibition. We found that T21 organoids secrete increased proportions of Aβ-preventing (Aβ1–19) and Aβ-degradation products (Aβ1–20 and Aβ1–34). We show these profiles mirror in cerebrospinal fluid of people with DS. We demonstrate that this protective mechanism is mediated by BACE2-trisomy and cross-inhibited by clinically trialled BACE1 inhibitors. Combined, our data prove the physiological role of BACE2 as a dose-sensitive AD-suppressor gene, potentially explaining the dementia delay in ~30% of people with DS. We also show that DS cerebral organoids could be explored as pre-morbid AD-risk population detector and a system for hypothesis-free drug screens as well as identification of natural suppressor genes for neurodegenerative diseases.

The genetic basis of variation in the rate of disease progression of primary tauopathies has not been determined. In two independent progressive supranuclear palsy cohorts, we show that common variation at the LRRK2 locus determines survival from motor symptom onset to death, possibly through regulation of gene expression. This links together genetic risk in alpha-synuclein and tau disorders, and suggests that modulation of proteostasis and neuro-inflammation by LRRK2 inhibitors may have a therapeutic role across disorders.

A population of >6 million people worldwide at high risk of Alzheimer’s disease (AD) are those with Down Syndrome (DS, caused by trisomy 21 (T21)), 70% of whom develop dementia during lifetime, caused by an extra copy of β-amyloid-(Aβ)-precursor-protein gene. We report AD-like pathology in cerebral organoids grownin vitrofrom non-invasively sampled strands of hair from 71% of DS donors. The pathology consisted of extracellular diffuse and fibrillar Aβ deposits, hyperphosphorylated/pathologically conformed Tau, and premature neuronal loss.Presence/absence of AD-like pathology was donor-specific (reproducible between individual organoids/iPSC lines/experiments). Pathology could be triggered in pathology-negative T21 organoids by CRISPR/Cas9-mediated elimination of the third copy of chromosome-21-geneBACE2, but prevented by combined chemical β and γ-secretase inhibition. We found that T21-organoids secrete increased proportions of Aβ-preventing (Aβ1-19) and Aβ-degradation products (Aβ1-20 and Aβ1-34). We show these profiles mirror in cerebrospinal fluid of people with DS. We demonstrate that this protective mechanism is mediated by BACE2-trisomy and cross-inhibited by clinically trialled BACE1-inhibitors. Combined, our data prove the physiological role ofBACE2as a dose-sensitive AD-suppressor gene, potentially explaining the dementia delay in ∼30% of people with DS. We also show that DS cerebral organoids could be explored as pre-morbid AD-risk population detector and a system for hypothesis-free drug screens as well as identification of natural suppressor genes for neurodegenerative diseases.

Dystonia is a neurological disorder characterized by sustained or intermittent muscle contractions causing abnormal movements and postures, often occurring in absence of any structural brain abnormality. Psychiatric comorbidities, including anxiety, depression, obsessive-compulsive disorder and schizophrenia, are frequent in patients with dystonia. While mutations in a fast-growing number of genes have been linked to Mendelian forms of dystonia, the cellular, anatomical, and molecular basis remains unknown for most genetic forms of dystonia, as does its genetic and biological relationship to neuropsychiatric disorders. Here we applied an unbiased systems-biology approach to explore the cellular specificity of all currently known dystonia-associated genes, predict their functional relationships, and test whether dystonia and neuropsychiatric disorders share a genetic relationship. To determine the cellular specificity of dystonia-associated genes in the brain, single-nuclear transcriptomic data derived from mouse brain was used together with expression-weighted cell-type enrichment. To identify functional relationships among dystonia-associated genes, we determined the enrichment of these genes in co-expression networks constructed from 10 human brain regions. Stratified linkage-disequilibrium score regression was used to test whether co-expression modules enriched for dystonia-associated genes significantly contribute to the heritability of anxiety, major depressive disorder, obsessive-compulsive disorder, schizophrenia, and Parkinson’s disease. Dystonia-associated genes were significantly enriched in adult nigral dopaminergic neurons and striatal medium spiny neurons. Furthermore, 4 of 220 gene co-expression modules tested were significantly enriched for the dystonia-associated genes. The identified modules were derived from the substantia nigra, putamen, frontal cortex, and white matter, and were all significantly enriched for genes associated with synaptic function. Finally, we demonstrate significant enrichments of the heritability of major depressive disorder, obsessive-compulsive disorder and schizophrenia within the putamen, frontal cortex and white matter modules, and nominal enrichment of the heritability of Parkinson’s disease within the substantia nigra module. In conclusion, multiple dystonia-associated genes interact and contribute to pathogenesis likely through dysregulation of synaptic signalling in striatal medium spiny neurons, adult nigral dopaminergic neurons and frontal cortical neurons. Furthermore, the enrichment of the heritability of psychiatric disorders in the co-expression modules enriched for dystonia-associated genes indicates that psychiatric symptoms associated with dystonia are likely to be intrinsic to its pathophysiology., See Busch and Klein (doi:10.1093/brain/awaa253) for a scientific commentary on this article. Mencacci et al. show that multiple dystonia genes are functionally related and likely contribute to modulation of synaptic signalling in striatal, dopaminergic and frontal cortical neurons. They also demonstrate a genetic relationship between dystonia and psychiatric disorders including depression, OCD and schizophrenia.

Corticobasal degeneration typically progresses gradually over 5–7 years from onset till death. Fulminant corticobasal degeneration cases with a rapidly progressive course were rarely reported (RP-CBD). This study aimed to investigate their neuropathological characteristics. Of the 124 autopsy-confirmed corticobasal degeneration cases collected from 14 centres, we identified 6 RP-CBD cases (4.8%) who died of advanced disease within 3 years of onset. These RP-CBD cases had different clinical phenotypes including rapid global cognitive decline (N = 2), corticobasal syndrome (N = 2) and Richardson’s syndrome (N = 2). We also studied four corticobasal degeneration cases with an average disease duration of 3 years or less, who died of another unrelated illness (Intermediate-CBD). Finally, we selected 12 age-matched corticobasal degeneration cases out of a cohort of 110, who had a typical gradually progressive course and reached advanced clinical stage (End-stage-CBD). Quantitative analysis showed high overall tau burden (p = 0.2) and severe nigral cell loss (p = 0.47) in both the RP-CBD and End-stage-CBD groups consistent with advanced pathological changes, while the Intermediate-CBD group (mean disease duration = 3 years) had milder changes than End-stage-CBD (p p p = 0.02). In contrast to the predominance of astrocytic plaques we previously reported in preclinical asymptomatic corticobasal degeneration cases, neuronal tau aggregates predominated in RP-CBD exceeding those in Intermediate-CBD (anterior frontal cortex: p p = 0.001) and End-stage-CBD (anterior frontal cortex: p = 0.03, caudate: p = 0.01) as demonstrated by its higher neuronal-to-astrocytic plaque ratios in both anterior frontal cortex and caudate. We did not identify any difference in age at onset, any pathogenic tau mutation or concomitant pathologies that could have contributed to the rapid progression of these RP-CBD cases. Mild TDP-43 pathology was observed in three RP-CBD cases. All RP-CBD cases were men. The MAPT H2 haplotype, known to be protective, was identified in one RP-CBD case (17%) and 8 of the matched End-stage-CBD cases (67%). We conclude that RP-CBD is a distinct aggressive variant of corticobasal degeneration with characteristic neuropathological substrates resulting in a fulminant disease process as evident both clinically and pathologically. Biological factors such as genetic modifiers likely play a pivotal role in the RP-CBD variant and should be the subject of future research.

Introduction Dozens of Alzheimer's disease (AD)‐associated loci have been identified in European‐descent populations, but their effects have not been thoroughly investigated in the Hong Kong Chinese population. Methods TaqMan array genotyping was performed for known AD‐associated variants in a Hong Kong Chinese cohort. Regression analysis was conducted to study the associations of variants with AD‐associated traits and biomarkers. Lasso regression was applied to establish a polygenic risk score (PRS) model for AD risk prediction. Results SORL1 is associated with AD in the Hong Kong Chinese population. Meta‐analysis corroborates the AD‐protective effect of the SORL1 rs11218343 C allele. The PRS is developed and associated with AD risk, cognitive status, and AD‐related endophenotypes. TREM2 H157Y might influence the amyloid beta 42/40 ratio and levels of immune‐associated proteins in plasma. Discussion SORL1 is associated with AD in the Hong Kong Chinese population. The PRS model can predict AD risk and cognitive status in this population.

Highlights • A consideration of the causes of individual differences in Down syndrome, at the level of genes, epigenetics, brain, and behaviour, linking potential differences in early development with elevated risk for Alzheimer’s disease. • Evaluation of environmental (socioeconomic status) and genetic (chromosome 19 apolipoprotein APOE genotype, modulating risk for AD in adulthood) predictors of individual differences in early vocabulary development in a sample of 84 infants and young children with DS. Neither predictor accounted for significant amounts of variance, leaving the wide variability unexplained and likely arising from complex individual effects of the DS genotype. There was weak evidence that early development was faster for the APOE genotype conferring greater AD risk (ε4 carriers) consistent with recent observations in infant attention (D’Souza, Mason et al., 2020) • Proof of principle that prenatal and neonatal magnetic resonance imaging methods may be used to test the predictive power of measures of early brain structure for variation in DS infant cognitive development. Early brain development represents the concerted effect of the DS genotype. • The article argues for the importance of a multi-level, lifespan developmental approach to explore the origins of individual differences in DS cognition. It hypothesises that in this framework, dementia itself may be considered as a developmental disorder (Karmiloff-Smith et al., 2016)., In this article, we focus on the causes of individual differences in Down syndrome (DS), exemplifying the multi-level, multi-method, lifespan developmental approach advocated by Karmiloff-Smith (1998, 2009, 2012, 2016). We evaluate the possibility of linking variations in infant and child development with variations in the (elevated) risk for Alzheimer’s disease (AD) in adults with DS. We review the theoretical basis for this argument, considering genetics, epigenetics, brain, behaviour and environment. In studies 1 and 2, we focus on variation in language development. We utilise data from the MacArthur-Bates Communicative Development Inventories (CDI; Fenson et al., 2007), and Mullen Scales of Early Learning (MSEL) receptive and productive language subscales (Mullen, 1995) from 84 infants and children with DS (mean age 2;3, range 0;7 to 5;3). As expected, there was developmental delay in both receptive and expressive vocabulary and wide individual differences. Study 1 examined the influence of an environmental measure (socio-economic status as measured by parental occupation) on the observed variability. SES did not predict a reliable amount of the variation. Study 2 examined the predictive power of a specific genetic measure (apolipoprotein APOE genotype) which modulates risk for AD in adulthood. There was no reliable effect of APOE genotype, though weak evidence that development was faster for the genotype conferring greater AD risk (ε4 carriers), consistent with recent observations in infant attention (D’Souza, Mason et al., 2020). Study 3 considered the concerted effect of the DS genotype on early brain development. We describe new magnetic resonance imaging methods for measuring prenatal and neonatal brain structure in DS (e.g., volumes of supratentorial brain, cortex, cerebellar volume; Patkee et al., 2019). We establish the methodological viability of linking differences in early brain structure to measures of infant cognitive development, measured by the MSEL, as a potential early marker of clinical relevance. Five case studies are presented as proof of concept, but these are as yet too few to discern a pattern.

Microtubule Associated Protein Tau (MAPT) forms proteopathic aggregates in several diseases. The G273R tau mutation, located in the first repeat region, was found by exome sequencing in a patient who presented with dementia and parkinsonism. We herein return to pathological examination which demonstrated tau immunoreactivity in neurons and glia consistent of mixed progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD) features. To rationalize the pathological findings, we used molecular biophysics to characterize the mutation in more detail in vitro and in Drosophila. The G273R mutation increases the aggregation propensity of 4-repeat (4R) tau and alters the tau binding affinity towards microtubules (MTs) and F-actin. Tau aggregates in PSP and CBD are predominantly 4R tau. Our data suggest that the G273R mutation induces a shift in pool of 4R tau by lower F-actin affinity, alters the conformation of MT bound 4R tau, while increasing chaperoning of 3R tau by binding stronger to F-actin. The mutation augmented fibrillation of 4R tau initiation in vitro and in glial cells in Drosophila and showed preferential seeding of 4R tau in vitro suggestively causing a late onset 4R tauopathy reminiscent of PSP and CBD. Funding Agencies|Karin & Sten Mortstedt CBD Solutions research grant [512385]; Swedish Research CouncilSwedish Research Council [201504521, 2019-04405]; Goran Gustafsson Foundation; Swedish Alzheimer Foundation; Swedish Brain foundation; Goizueta Alzheimers Disease Research Center at Emory University [NIH P50 AG025688]; UK Dementia Research Institute, from DRI Ltd.; UK Medical Research CouncilMedical Research Council UK (MRC); Alzheimers Society; Alzheimers Research UKAlzheimers Research UK (ARUK); Medical Research CouncilMedical Research Council UK (MRC) [MR/N026004/1]; Wellcome TrustWellcome Trust [202903/Z/16/Z]; Dolby Family Fund; National Institute for Health Research (NIHR) Biomedical Research Centre(BRC) at University College London Hospitals NHS Foundation TrustNational Institute for Health Research (NIHR); University College London; Michael J Fox Foundation; Michael J Fox Foundation.

Microsatellite repeat expansion disease loci can exhibit pleiotropic clinical and biological effects depending on repeat length. Large expansions in C9orf72 (100s-1000s of units) are the most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal degeneration (FTD). However, whether intermediate expansions also contribute to neurodegenerative disease is not well understood. Several studies have identified intermediate repeats in Parkinson's disease patients, but the association was not found in autopsy-confirmed cases. We hypothesized that intermediate C9orf72 repeats are a genetic risk factor for corticobasal degeneration (CBD), a neurodegenerative disease that can be clinically similar to Parkinson's but has distinct tau protein pathology. Indeed, intermediate C9orf72 repeats were significantly enriched in autopsy-proven CBD (n = 354 cases, odds ratio = 3.59, p = 0.00024). While large C9orf72 repeat expansions are known to decrease C9orf72 expression, intermediate C9orf72 repeats result in increased C9orf72 expression in human brain tissue and CRISPR/cas9 knockin iPSC-derived neural progenitor cells. In contrast to cases of FTD/ALS with large C9orf72 expansions, CBD with intermediate C9orf72 repeats was not associated with pathologic RNA foci or dipeptide repeat protein aggregates. Knock-in cells with intermediate repeats exhibit numerous changes in gene expression pathways relating to vesicle trafficking and autophagy. Additionally, overexpression of C9orf72 without the repeat expansion leads to defects in autophagy under nutrient starvation conditions. These results raise the possibility that therapeutic strategies to reduce C9orf72 expression may be beneficial for the treatment of CBD.

Background The HLA-DRB*1501 haplotype influences the risk of developing multiple sclerosis (MS), but it is not known how it affects grey matter pathology. Aim To assess HLA-DRB * 1501 effects on magnetic resonance imaging (MRI) cortical grey matter pathology. Methods Whole and lesional cortical grey matter volumes, lesional and normal-appearing grey matter magnetization transfer ratio were measured in 85 people with MS and 36 healthy control subjects. HLA-DRB * 1501 haplotype was determined by genotyping (rs3135388). Results No significant differences were observed in MRI measures between the HLA-DRB * 1501 subgroups. Conclusions The HLA-DRB * 1501 haplotype is not strongly associated with MRI-visible grey matter pathology.

Importance Risk of Alzheimer disease (AD) is particularly high for individuals with Down syndrome (DS). The e4 allele of the apolipoprotein E gene (APOE e4) is associated with an additional risk for AD. In typical development, there is evidence that theAPOE e4 genotype is associated with an early cognitive advantage. Here we investigate associations ofAPOE e4 with attention across the life span of individuals with DS. Objective To investigate associations betweenAPOE e4 and attentional abilities in young children and in adults with DS. Design, Settings, and Participants In this cross-sectional study, data were collected from 80 young children with DS (8-62 months of age) and 240 adults with DS (16-71 years of age) during the period from 2013 to 2018 at a research center to examine the association betweenAPOEstatus (e4 carrier vs e4 noncarrier) and attentional abilities. Exposure APOEstatus (e4 carrier vs e4 noncarrier). Main Outcomes and Measures For the children, attentional ability was assessed using an eye-tracking paradigm, the gap-overlap task; the size of the gap effect was the primary outcome. For the adults, attentional ability was assessed using the CANTAB simple reaction time task; the standard deviation of response time latencies was the primary outcome. Cross-sectional developmental trajectories were constructed linking attentional ability with age in e4 carriers and e4 noncarriers for children and adults separately. Results The child sample comprised 23 e4 carriers and 57 e4 noncarriers. The adult sample comprised 61 e4 carriers and 179 e4 noncarriers. For the children, a significant difference between trajectory intercepts (ηp2 = 0.14) indicated that e4 carriers (B = 100.24 [95% CI, 18.52-181.96]) exhibited an attentional advantage over e4 noncarriers (B = 314.78 [95% CI, 252.17-377.39]). There was an interaction betweenAPOEstatus and age (ηp2 = 0.10); while the gap effect decreased with age for e4 noncarriers (B = −4.58 [95% CI, −6.67 to −2.48]), reflecting the development of the attention system, there was no change across age in e4 carriers (B = 0.77 [95% CI, −1.57 to 3.12]). For the adults, there was no main effect of e4 carrier status, but there was an interaction betweenAPOEstatus and age (B = 0.02 [95% CI, 0.004-0.07]), so that e4 carriers had poorer attentional ability than e4 noncarriers at older ages. Conclusions and Relevance APOE e4 is associated with an attentional advantage early in development and a disadvantage later in life for individuals with DS, similar to the pattern reported in typical development. Understanding the differential role ofAPOEacross the life span is an important step toward future interventions.

Importance Large-scale genome-wide association studies in the European population have identified 90 risk variants associated with Parkinson disease (PD); however, there are limited studies in the largest population worldwide (ie, Asian). Objectives To identify novel genome-wide significant loci for PD in Asian individuals and to compare genetic risk between Asian and European cohorts. Design Setting, and Participants Genome-wide association data generated from PD cases and controls in an Asian population (ie, Singapore/Malaysia, Hong Kong, Taiwan, mainland China, and South Korea) were collected from January 1, 2016, to December 31, 2018, as part of an ongoing study. Results were combined with inverse variance meta-analysis, and replication of top loci in European and Japanese samples was performed. Discovery samples of 31 575 individuals passing quality control of 35 994 recruited were used, with a greater than 90% participation rate. A replication cohort of 1 926 361 European-ancestry and 3509 Japanese samples was analyzed. Parkinson disease was diagnosed using UK Parkinson’s Disease Society Brain Bank Criteria. Main Outcomes and Measures Genotypes of common variants, association with disease status, and polygenic risk scores. Results Of 31 575 samples identified, 6724 PD cases (mean [SD] age, 64.3 [10] years; age at onset, 58.8 [10.6] years; 3472 [53.2%] men) and 24 851 controls (age, 59.4 [11.4] years; 11 030 [45.0%] men) were analyzed in the discovery study. Eleven genome-wide significant loci were identified; 2 of these loci were novel (SV2CandWBSCR17) and 9 were previously found in Europeans. Replication in European-ancestry and Japanese samples showed robust association forSV2C(rs246814; odds ratio, 1.16; 95% CI, 1.11-1.21;P = 1.17 × 10−10in meta-analysis of discovery and replication samples) but showed potential genetic heterogeneity atWBSCR17(rs9638616;I2=67.1%;P = 3.40 × 10−3for hetereogeneity). Polygenic risk score models including variants at these 11 loci were associated with a significant improvement in area under the curve over the model based on 78 European loci alone (63.1% vs 60.2%;P = 6.81 × 10−12). Conclusions and Relevance This study identified 2 apparently novel gene loci and found 9 previously identified European loci to be associated with PD in this large, meta–genome-wide association study in a worldwide population of Asian individuals and reports similarities and differences in genetic risk factors between Asian and European individuals in the risk for PD. These findings may lead to improved stratification of Asian patients and controls based on polygenic risk scores. Our findings have potential academic and clinical importance for risk stratification and precision medicine in Asia.

ObjectiveThe basis for clinical variation related to underlying Progressive Supranuclear Palsy (PSP) pathology is unknown. We performed a genome wide association study (GWAS) to identify genetic determinants of PSP phenotype.MethodsTwo independent pathological and clinically diagnosed PSP cohorts were genotyped and phenotyped to create Richardson’s syndrome (RS) and non-RS groups. We carried out separate logistic regression GWAS to compare RS and non-RS groups and then combined datasets to carry out a whole cohort analysis (RS=367, non-RS=130). We validated our findings in a third cohort by referring to data from 100 deeply phenotyped cases from a recent GWAS. We assessed the expression/co-expression patterns of our identified genes and used our data to carry out gene-based association testing.ResultsOur lead single nucleotide polymorphism (SNP), rs564309, showed an association signal in both cohorts, reaching genome wide significance in our whole cohort analysis – OR 5.5 (3.2-10.0), p-value 1.7×10−9. rs564309 is an intronic variant of the tripartite motif-containing protein 11 (TRIM11) gene, a component of the ubiquitin proteasome system (UPS). In our third cohort, minor allele frequencies of surrogate SNPs in high linkage disequilibrium with rs564309 replicated our findings. Gene based association testing confirmed an association signal at TRIM11. We found that TRIM11 is predominantly expressed neuronally, in the cerebellum and basal ganglia.InterpretationOur study suggests that the TRIM11 locus is a genetic modifier of PSP phenotype and potentially adds further evidence for the UPS having a key role in tau pathology, therefore representing a target for disease modifying therapies.

ObjectiveIndividuals with Down syndrome (DS) have an extremely high genetic risk for Alzheimer’s disease (AD) however the course of cognitive decline associated with progression to dementia is ill-defined. Data-driven methods can estimate long-term trends from cross-sectional data while adjusting for variability in baseline ability, which complicates dementia assessment in those with DS.MethodsWe applied an event-based model to cognitive test data and informant-rated questionnaire data from 283 adults with DS (the largest study of cognitive functioning in DS to date) to estimate the sequence of cognitive decline and individuals’ disease stage.ResultsDecline in tests of memory, sustained attention / motor coordination, and verbal fluency occurred early, demonstrating that AD in DS follows a similar pattern of change to other forms of AD. Later decline was found for informant measures. Using the resulting staging model, we showed that adults with a clinical diagnosis of dementia and those with APOE 3:4 or 4:4 genotype were significantly more likely to be staged later, suggesting the model is valid.InterpretationOur results identify tests of memory and sustained attention may be particularly useful measures to track decline in the preclinical/prodromal stages of AD in DS whereas informant-measures may be useful in later stages (i.e. during conversion to dementia, or post-diagnosis). These results have implications for the selection of outcome measures of treatment trials to delay or prevent cognitive decline due to AD in DS. As clinical diagnoses are generally made late into AD progression, early assessment is essential.

Objective To describe 5 cases of Parkinson9s disease lacking any detectable histopathology. Background The diagnosis of Parkinson9s disease is supported histologically by the findings of α-synuclein immunopositive Lewy bodies and neurites and severe substantia nigra cell loss. Bradykinesia as defined by slowness of initiation of movement and a progressive reduction in speed and amplitude on finger tapping is a clinical correlate of pars compacta nigral degeneration. There are very few published cases of Parkinson9s disease in which no pathological abnormality was found, and some of these cases were in hindsight thought to have probably been cases of indeterminate senile tremor or dystonic tremor. Methods Retrospective case notes review of the Queen Square Brain Bank archival collection and detailed neuropathological analysis of the selected cases. Results 5 cases considered to have Parkinson9s disease by neurologists throughout the entirety of their illness that lacked any histopathological findings known to be associated with Parkinson9s syndromes were identified out of a total number of 773 brains with a final clinical diagnosis of Parkinson9s disease in the Queen Square Brain Bank. Retrospective case note analysis did not suggest dystonic tremor or indeterminate tremor in any of them. There was a reduction in tyrosine hydroxylase (TH) density in the striatum in these cases when compared with healthy controls, but not in the substantia nigra. Conclusions Striatal dopamine deficiency without nigral cell loss is the most likely explanation for the clinical findings; other possible explanations include slowness due to comorbidities misinterpreted as bradykinesia, a tardive syndrome related to undisclosed previous neuroleptic exposure, or ‘soft age-related’ parkinsonian signs. These cases emphasise the need to regularly review the diagnosis in cases of suspected Parkinson9s disease and highlight the need for precision in the neurological examination particularly of elderly patients. These cases may represent a distinct entity of diagnostic exclusion and may be considered one explanation for the radiological phenomenon of SWEDD (scans without evidence of dopaminergic deficit).

IntroductionMadras motor neuron disease (MMND), MMND variant (MMNDV) and Familial MMND (FMMND) have a unique geographic distribution predominantly reported from Southern India. The characteristic features are onset in young, weakness and wasting of limbs, multiple lower cranial nerve palsies and sensorineural hearing loss. There is a considerable overlap in the phenotype of MMND with Brown–Vialetto–Van Laere syndrome (BVVL) Boltshauser syndrome, Nathalie syndrome and Fazio–Londe syndrome. Recently a number of BVVL cases and families have been described with mutations in two riboflavin transporter genes SLC52A2 and SLC52A3 (solute carrier family 52, riboflavin transporter, member 2 and 3 respectively).Methods and resultsWe describe six families and four sporadic MMND cases that have been clinically characterized in detail with history, examination, imaging and electrophysiological investigations. We sequenced the SLC52A1, SLC52A2 and SLC52A3 in affected probands and sporadic individuals from the MMND series as well as the C9ORF72 expansion. No genetic defects were identified and the C9ORF72 repeats were all less than 10.ConclusionsThese data suggest that MMND is a distinct clinical subgroup of childhood onset MND patients where the known genetic defects are so far negative. The clinico-genetic features of MMND in comparison with the BVVL group of childhood motor neuron diseases suggest that these diseases are likely to share a common defective biological pathway that may be a combination of genetic and environmental factors.

Mutations in TMEM230 have recently been associated to Parkinson's disease (PD). To further understand the role of this gene in the Caucasian population, we interrogated our large repository of next generation sequencing data from unrelated PD cases and controls, as well as multiplex families with autosomal dominant PD. We identified 2 heterozygous missense variants in 2 unrelated PD cases and not in our control database (p.Y106H and p.I162V), and a heterozygous missense variant in 2 PD cases from the same family (p.A163T). However, data presented herein is not sufficient to support the role of any of these variants in PD pathology. A series of unified sequence kernel association tests also failed to show a cumulative effect of rare variation in this gene on the risk of PD in the general Caucasian population. Further evaluation of genetic data from different populations is needed to understand the genetic role of TMEM230 in PD etiology.

A large expansion of the hexanucleotide repeat in the C9ORF72 gene is the most frequent identified genetic cause of ALS. It also causes other neurodegenerative diseases, especially frontotemporal dementia, and there may be clinical overlap in an individual and within families. Inheritance is autosomal dominant, although due to variable penetrance affected individuals may appear sporadic.

SEE KOBYLECKI AND MANN DOI101093/AWW267 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: Animal models have shown that tau seeding and propagation are strain- and neural network-specific. The study of preclinical cases is valuable to gain insights into early pathological features of corticobasal degeneration and its progression. Three preclinical corticobasal degeneration cases and six age-matched end-stage corticobasal degeneration cases were included in this study. Tau immunohistochemistry performed in 20 brain regions and quantitative assessment of regional tau load using image analysis were performed. Semi-quantitative grading of tau-positive cellular lesions and neuronal loss in the frontal, parietal and temporal cortices, striatum, substantia nigra and subthalamic nucleus were assessed. All preclinical cases were clinically asymptomatic but had widespread tau lesions in the typically affected regions in corticobasal degeneration and the pathognomonic astrocytic plaques were the most prominent lesion type in the anterior frontal and striatal regions. Mean total tau load (sum of all regional tau load) of end-stage corticobasal degeneration cases were nine times greater than that of the preclinical cases (P = 0.04) and less tau load was found in all regions of the preclinical cases. An anterior-to-posterior tau load ratio in the frontal cortex in preclinical cases was 12-fold greater than in end-stage corticobasal degeneration cases. Relatively greater tau burden in the anterior frontal cortex, striatum and subthalamic nucleus suggests the striatal afferent connection to the dorsolateral prefrontal cortex and basal ganglia circuitry are the earliest neural network connections affected by corticobasal degeneration-related tau pathology. Differential distribution of the tau pathology to selective cortical regions in these preclinical cases implies phenotypic presentation may be predetermined at a very early stage of the disease process. Neuronal loss of the substantia nigra was either absent or very mild in the preclinical cases and was moderate to severe in end-stage corticobasal degeneration cases (P < 0.05). Our findings suggest that a threshold of pathological burden in the 'right' anatomical regions needs to be reached before the onset of clinical symptoms. The early prominence of the astrocytic plaques in relation to sparse neuronal lesions leads one to speculate that corticobasal degeneration may begin as an astrogliopathy at a very early disease stage but neuronal lesions gradually take over as the predominant lesion type in advanced disease.

In this article, we first present a summary of the general assumptions about Down syndrome (DS) still to be found in the literature. We go on to show how new research has modified these assumptions, pointing to a wide range of individual differences at every level of description. We argue that, in the context of significant increases in DS life expectancy, a focus on individual differences in trisomy 21 at all levels—genetic, cellular, neural, cognitive, behavioral, and environmental—constitutes one of the best approaches for understanding genotype/phenotype relations in DS and for exploring risk and protective factors for Alzheimer’s disease in this high-risk population. Published version

To the Editor: Primary immunodeficiencies are a highly heterogeneous group of genetic disorders caused by Mendelian mutations in more than 150 immune-related genes1. Primary immunodeficiencies manifest as severe and/or disseminated recurrent infections and may also have autoimmune manifestations. We studied a female patient P1 of Pakistani origin who presented at the age of 4 years with a generalized lymphadenopathy, splenomegaly, neutropenia (0.05-0.28 ×109/L) and thrombocytopenia (platelet counts 20-40 ×109/L). A lymph node biopsy showed reactive changes, bone marrow aspirate was unremarkable and anti-neutrophil antibodies were present. She also had chronic diarrhea associated with an autoimmune enteropathy, characterized by duodenal villous atrophy and large bowel lymphocytic infiltration on biopsy. Her initial immunology work up revealed only raised IgG levels (22.6 g/L), raised inflammatory markers and a low number of NK cells (0.00-0.02). Lymphocyte subsets, double negative T-cells, T-cell proliferation assays, IgA (1.33 g/L), IgM (1.43 g/L), tetanus vaccine responses and a nitroblue tetrazolium (NBT) test were normal (Table 1). P1 had no significant history of infections except for a psoas abscess associated with chronic neutropenia. Over time she manifested growth failure and developed new autoimmune features including an episode of erythema nodosum, transient arthritis of both feet and recurrent haemolytic anaemia. As a result, she received several courses of steroids, rituximab (with prophylactic immunoglobulin replacement) and mycophenolate mofetil. Five years after initial presentation, following multiple courses of rituximab, she developed recurrent infections (Streptococcus pneumoniae facial cellulitis, Streptococcus pneumoniae sepsis and Haemophilus influenzae empyema) after withdrawal of immunoglobulin therapy. Although both her CD19+ B-cells and IgG level were normal, further investigation revealed a new-onset antibody deficiency with absent vaccine responses (Table 1). Due to further chest symptoms, despite recommencing immunoglobulin replacement, a chest CT scan was performed that showed extensive lung infiltration. Lung biopsy showed a florid diffuse lymphoid interstitial infiltrate consisting of a mixture of CD3+ T and CD20+ B cells, with scattered lymphoid follicles particularly around airways. No granulomata were seen and stains for bacteria, fungi and mycobacteria, as well as in-situ hybridisation for EBV, were negative. Table 1 Serial immunology assessments Patient P1 was born to a consanguineous marriage of first cousins. Therefore, we hypothesized that her disease is caused by a homozygous mutation. To identify the causative mutation we used exome sequencing. Patient’s blood sample was obtained with informed consent from the parents in accordance with the Declaration of Helsinki and with approval from the ethics committees (04/Q0501/119 and 06/Q0508/16). Library preparation, exome capture and sequencing have been done according to the manufacturers instructions. For exome target enrichment the Agilent SureSelect 38 Mb kit was used. Sequencing was done using Illumina HiSeq with 94 bp paired-end reads. In the exome data we found 17,280 single nucleotide variants and small insertions/deletions, including 424 very rare ones, i.e. those not seen in the 1000 Genomes database (May 2011 data release). However, we found no homozygous loss-of-function mutations. To identify larger deletions and duplications we used a new software tool, ExomeDepth2 (available to download at http://cran.r-project.org/web/packages/ExomeDepth/index.html). We found a large homozygous deletion that removed exons 1 to 30 of the 58-exon LPS-responsive vesicle trafficking, beach and anchor containing (LRBA) gene (Figure 1A). This deletion is novel and not present in the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation/). We validated it using a custom comparative genomic hybridization (CGH) array containing 270 probes in a 288 kb region defined around the LRBA gene (Figure 1B). We then sequenced the exact boundaries of this 252,396-nucleotide deletion (chr4: 151,748,856 - 152,001,251; Figure 1C). Figure 1 Homozygous deletion in the LRBA gene region We established an EBV-transformed B cell line of the patient and studied LRBA expression. We stimulated cells with 0, 1, 10 or 100 ng/ml of LPS for 16 hours. Then we extracted RNA, generated cDNA and amplified a part of the LRBA gene using primers 5′GCAGAAGTCATGCTTGGACA3′ and 5′TTTCGAAGTAGGGTCGCAAT3′. An expected 218 bp product from the LRBA exons 19-21 was present in control, but not in patient P1 (Figure 2A). From the LPS-stimulated cells we also extracted proteins and separated them using SDS PAGE. For Western blotting we used anti-LRBA (Sigma HPA019366) and anti-actin antibodies. We found the LRBA protein with the expected mass of approximately 319 kDa in control cells, but not in cells of patient P1 (Figure 2B). We also used immunofluorescence analysis and again found that LRBA protein is expressed in the cytoplasm of cells from a healthy control, but not from patient P1 (Figure 2C).. Figure 2 LRBA mRNA and protein are expressed in the EBV-transformed B cell line from a healthy control, but are absent in patient P1 The LRBA gene encodes a large broadly expressed protein of unknown function that is involved in intracellular vesicle trafficking3. Recently Lopez-Herrera et al. reported five patients with different homozygous mutations in the LRBA gene that also abolished its expression4. These patients had idiopathic thrombocytopenic purpura, lymphoid interstitial pneumonia and autoimmune enteropathy, as well as hypogammaglobulinemia. Reduced levels of IgG and IgA were found in all five patients and reduced IgM was recorded in four of those. Accordingly, all five patients have been diagnosed with childhood-onset common variable immunodeficiency (CVID). Patient P1 that we report here had many similar clinical features. However, hypogammaglobulinemia was not seen at presentation but occurred as a later event, and may have been secondary to rituximab therapy, as has previously been described5. Thus, our results show that deficiency caused by mutations in the LRBA gene may initially present as an autoimmune syndrome without CVID. Therefore, a possibility of LRBA gene mutations should be considered for a broad spectrum of patients with primary immunodeficiencies and autoimmunity.

Summary Background Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of motor neurons that results in progressive weakness and death from respiratory failure, commonly within about 3 years. Previous studies have shown association of a locus on chromosome 9p with ALS and linkage with ALS–frontotemporal dementia. We aimed to test whether this genomic region is also associated with ALS in an independent set of UK samples, and to identify risk factors associated with ALS in a further genome-wide association study that combined data from the independent analysis with those from other countries. Methods We collected samples from patients with sporadic ALS from 20 UK hospitals and obtained UK control samples from the control groups of the Depression Case Control study, the Bipolar Affective Case Control Study, and the British 1958 birth cohort DNA collection. Genotyping of DNA in this independent analysis was done with Illumina HumanHap550 BeadChips. We then undertook a joint genome-wide analysis that combined data from the independent set with published data from the UK, USA, Netherlands, Ireland, Italy, France, Sweden, and Belgium. The threshold for significance was p=0·05 in the independent analysis, because we were interested in replicating a small number of previously reported associations, whereas the Bonferroni-corrected threshold for significance in the joint analysis was p=2·20×10 −7 Findings After quality control, samples were available from 599 patients and 4144 control individuals in the independent set. In this analysis, two single nucleotide polymorphisms in a locus on chromosome 9p21.2 were associated with ALS: rs3849942 (p=2·22×10 −6 ; odds ratio [OR] 1·39, 95% CI 1·21–1·59) and rs2814707 (p=3·32×10 −6 ; 1·38, 1·20–1·58). In the joint analysis, which included samples from 4312 patients with ALS and 8425 control individuals, rs3849942 (p=4·64×10 −10 ; OR 1·22, 95% CI 1·15–1·30) and rs2814707 (p=4·72×10 −10 ; 1·22, 1·15–1·30) were associated with ALS. Interpretation We have found strong evidence of a genetic association of two single nucleotide polymorphisms on chromosome 9 with sporadic ALS, in line with findings from previous independent GWAS of ALS and linkage studies of ALS–frontotemporal dementia. Our findings together with these earlier findings suggest that genetic variation at this locus on chromosome 9 causes sporadic ALS and familial ALS–frontotemporal dementia. Resequencing studies and then functional analysis should be done to identify the defective gene. Funding ALS Therapy Alliance, the Angel Fund, the Medical Research Council, the Motor Neurone Disease Association of Great Britain and Northern Ireland, the Wellcome Trust, and the National Institute for Health Research Dementias and Neurodegenerative Diseases Research Network (DeNDRoN).

Intronic expansion of the GGGGCC hexanucleotide repeat within the C9ORF72 gene causes frontotemporal dementia and amyotrophic lateral sclerosis/motor neuron disease in both familial and sporadic cases. Initial reports indicate that this variant within the frontotemporal dementia/amyotrophic lateral sclerosis spectrum is associated with transactive response DNA binding protein (TDP-43) proteinopathy. The amyotrophic lateral sclerosis/motor neuron disease phenotype is not yet well characterized. We report the clinical and pathological phenotypes associated with pathogenic C9ORF72 mutations in a cohort of 563 cases from Northern England, including 63 with a family history of amyotrophic lateral sclerosis. One hundred and fifty-eight cases from the cohort (21 familial, 137 sporadic) were post-mortem brain and spinal cord donors. We screened DNA for the C9ORF72 mutation, reviewed clinical case histories and undertook pathological evaluation of brain and spinal cord. Control DNA samples (n = 361) from the same population were also screened. The C9ORF72 intronic expansion was present in 62 cases [11% of the cohort; 27/63 (43%) familial, 35/500 (7%) cases with sporadic amyotrophic lateral sclerosis/motor neuron disease]. Disease duration was significantly shorter in cases with C9ORF72-related amyotrophic lateral sclerosis (30.5 months) compared with non-C9ORF72 amyotrophic lateral sclerosis/motor neuron disease (36.3 months, P

In the present study we aimed to determine the prevalence of C9ORF72 GGGGCC hexanucleotide expansion in our cohort of 53 frontotemporal lobar degeneration (FTLD) patients and 174 neurologically normal controls. We identified the hexanucleotide repeat, in the pathogenic range, in 4 (2 bv-frontotemporal dementia (FTD) and 2 FTD-amyotrophic lateral sclerosis [ALS]) out of 53 patients and 1 neurologically normal control. Interestingly, 2 of the C9ORF72 expansion carriers also carried 2 novel missense mutations in GRN (Y294C) and in PSEN-2(I146V). Further, 1 of the C9ORF72 expansion carriers, for whom pathology was available, showed amyloid plaques and tangles in addition to TAR (trans-activation response) DNA-binding protein (TDP)-43 pathology. In summary, our findings suggest that the hexanucleotide expansion is probably associated with ALS, FTD, or FTD-ALS and occasional comorbid conditions such as Alzheimer's disease. These findings are novel and need to be cautiously interpreted and most importantly replicated in larger numbers of samples.

An expanded hexanucleotide repeat in the C9ORF72 gene has recently been identified as a major cause of familial frontotemporal lobar degeneration and motor neuron disease, including cases previously identified as linked to chromosome 9. Here we present a detailed retrospective clinical, neuroimaging and histopathological analysis of a C9ORF72 mutation case series in relation to other forms of genetically determined frontotemporal lobar degeneration ascertained at a specialist centre. Eighteen probands (19 cases in total) were identified, representing 35% of frontotemporal lobar degeneration cases with identified mutations, 36% of cases with clinical evidence of motor neuron disease and 7% of the entire cohort. Thirty-three per cent of these C9ORF72 cases had no identified relevant family history. Families showed wide variation in clinical onset (43-68 years) and duration (1.7-22 years). The most common presenting syndrome (comprising a half of cases) was behavioural variant frontotemporal dementia, however, there was substantial clinical heterogeneity across the C9ORF72 mutation cohort. Sixty per cent of cases developed clinical features consistent with motor neuron disease during the period of follow-up. Anxiety and agitation and memory impairment were prominent features (between a half to two-thirds of cases), and dominant parietal dysfunction was also frequent. Affected individuals showed variable magnetic resonance imaging findings; however, relative to healthy controls, the group as a whole showed extensive thinning of frontal, temporal and parietal cortices, subcortical grey matter atrophy including thalamus and cerebellum and involvement of long intrahemispheric, commissural and corticospinal tracts. The neuroimaging profile of the C9ORF72 expansion was significantly more symmetrical than progranulin mutations with significantly less temporal lobe involvement than microtubule-associated protein tau mutations. Neuropathological examination in six cases with C9ORF72 mutation from the frontotemporal lobar degeneration series identified histomorphological features consistent with either type A or B TAR DNA-binding protein-43 deposition; however, p62-positive (in excess of TAR DNA-binding protein-43 positive) neuronal cytoplasmic inclusions in hippocampus and cerebellum were a consistent feature of these cases, in contrast to the similar frequency of p62 and TAR DNA-binding protein-43 deposition in 53 control cases with frontotemporal lobar degeneration-TAR DNA-binding protein. These findings corroborate the clinical importance of the C9ORF72 mutation in frontotemporal lobar degeneration, delineate phenotypic and neuropathological features that could help to guide genetic testing, and suggest hypotheses for elucidating the neurobiology of a culprit subcortical network.

A hexanucleotide repeat expansion in the chromosome 9 open reading frame 72 gene (C9orf72) was recently identified as the most common genetic cause of frontotemporal dementia/amyotrophic lateral sclerosis. Here we describe the clinical, pathologic, and genetic features of a Finnish C9orf72 expansion carrier, who developed a dysplastic gangliocytoma (Lhermitte-Duclos disease), a rare hamartoma/overgrowth syndrome of cerebellar granule cells associated with mutations in the phosphatase and tensin homolog gene. In addition to the dysplastic gangliocytoma, the patient showed typical transactive response DNA-binding protein with Mr 43 kD (TDP-43) pathology mainly in the cortex and the substantia nigra and numerous p62-positive/TDP-43-negative inclusions in the cerebellar granule cells. His sister carried the same gene defect and showed a similar type of TDP-43/p62 pathology in her brain. Our findings confirm that the clinical and pathologic picture of C9orf72 mutation carriers is more heterogeneous than originally thought and warrants further studies on the possible involvement of phosphatase and tensin homolog gene pathway in the specific cerebellar granule cell pathology associated with C9orf72 expansion.

It is known that individuals with Down syndrome develop Alzheimer’s disease with an early age at onset, although associated genetic risk factors have not been widely studied. We tested whether genes that increase the risk of late-onset Alzheimer’s disease influence the age at onset in Down syndrome using genome-wide association data for age at onset of dementia in a small sample of individuals (N = 67) with Down syndrome. We tested for association with loci previously associated with Alzheimer’s disease risk and, despite the small size of the study, we detected associations with age at onset of Alzheimer’s disease in Down syndrome with PICALM (β = 3.31, p = 0.011) and the APOE loci (β = 3.58, p = 0.014). As dementia in people with Down syndrome is relatively understudied, we make all of these data publicly available to encourage further analyses of the problem of Alzheimer’s disease in Down syndrome.

Background A hexanucleotide repeat expansion, in the chromosome 9 open reading frame 72 gene (C9orf72), has been identified the most common genetic cause of FTD/ALS. Here we describe the clinical, pathologic and genetic features of a Finnish C9orf72 expansion carrier, who developed a dysplastic gangliocytoma, a rare hamartoma of cerebellar granule cells, associated with PTEN mutations. In addition to the dysplastic gangliocytoma, the patient showed TDP43-pathology in the cortex and in the substantia nigra, and p62-positive/TDP43-negative inclusions in the cerebellar granule cells. His sister carried the same gene defect and showed similar type of TDP43/p62-pathology in her brain. Our findings confirm the clinical and pathological picture of C9orf72 mutation carriers is more heterogeneous than originally thought and warrant further studies on the possible involvement of PTEN pathway in the specific cerebellar granule cell pathology associated with C9orf72 expansion.

An intronic expansion of a hexanucleotide GGGGCC repeat in the C9ORF72 gene has recently been shown to be an important cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) in familial and sporadic cases. The frequency has only been defined in a small number of populations where the highest sporadic rate was identified in Finland (21.1%) and the lowest in mainland Italy (4.1%). We examined the C9ORF72 expansion in a series of 146 Greek ALS cases, 10.95% (n = 16) of cases carried the pathological expansion defined as greater than 30 repeats. In the 10 familial ALS probands, 50% (n = 5) of them carried a pathologically large expansion. In the remaining 136 sporadic ALS cases, 11 were carriers (8.2%). None of the 228 Greek controls carried an expanded repeat. The phenotype of our cases was spinal (13/16) or bulbar (3/16) ALS, the familial cases were all spinal ALS and none of our cases had behavioral frontotemporal dementia. Expansions in the C9ORF72 gene therefore represent a common cause of ALS in Greece and this test will be diagnostically very important to implement in the Greek population. The frequency is higher than other populations with the exception of Finland and this may be due to Greece being a relatively isolated population.

Frontotemporal dementia (FTD) as an important clinical entity was rediscovered in Lund and Manchester in the early 1990s. Here we show that the large Lund pedigree with behavioral variant of frontotemporal dementia previously described with this disorder has an expansion in the recently described C9ORF72 locus on chromosome 9.

INTRODUCTIONDown syndrome (DS) may be considered a genetic form of Alzheimer’s disease (AD) due to universal development of AD neuropathology, but diagnosis and treatment trials are hampered by a lack of reliable blood biomarkers. A potential biomarker is neurofilament light (NF-L), due to its association with axonal damage in neurodegenerative conditions.METHODSWe measured blood NF-L concentration in 100 adults with DS using Simoa NF-light® assays, and examined relationships with age, and cross-sectional and longitudinal dementia diagnosis.RESULTSNF-L levels increased with age (Spearman’s rho = 0.789, pDISCUSSIONNF-L is a biomarker for neurodegeneration in DS, with potential for use in future clinical trials to prevent or delay dementia.Research in contextSystematic reviewThe authors reviewed the literature using PubMed searches supplemented with our knowledge of pending papers in this research area. While blood NF-L has been associated with clinical features of progression in a number of neurodegenerative conditions, we have not identified any reports of NF-L associated with cognitive decline in DS, a genetic form of AD.InterpretationOur findings demonstrate the potential utility of NF-L as a blood biomarker of neurodegeneration in DS, a population that may not be able to tolerate more invasive procedures such as neuroimaging and lumbar punctures to track progression.Future directionsThe association between NF-L and other markers of longitudinal AD progression should be explored further in future work.

We and others have recently reported an association between amyotrophic lateral sclerosis (ALS) and single nucleotide polymorphisms on chromosome 9p21 in several populations. Here we show that the associated haplotype is the same in all populations and that several families previously shown to have genetic linkage to this region also share this haplotype. The most parsimonious explanation of these data are that there is a single founder for this form of disease. (C) 2012 Elsevier Inc. All rights reserved.