Search

Announces that the third Colloquium on weed biology at the École Supériure Agronomique de Grignon was held on December 13, 1969. Number of sessions held; Scientific papers presented.

The article presents three classroom procedures for presenting the concept of "mechanism" in biology. The term "mechanism" used in this article refers to the biological phenomena that can be accounted for a series of cause-and-effect relationships. The basis of this paper is the prevalence of anthropomorphic and teleological explanations. Each of the three classroom procedures described includes a paper-and-pencil exercise. The author of this article discusses the importance of clarifying the concept of mechanism, especially pointing out the fallacy of teleological explanations.

Describes a device for preparing cell spreads. Steps involved in preparing a suitable cell suspension; Features of the apparatus used in the process; Instrument's use of centrifugal force to speed up the sedimentation of the cells.

The article discusses a bibliography for a seminar on evolution. Colleges and universities in the U.S. teach evolution as a seminar course. Since the field is broad, journals and other papers have appeared with discussions and other necessary data useful to students and instructors alike. Leading evolutionary biologists in America have been welcomed to participate with the recent papers. The contributors include Dean Amadon of he American Musesum of Natural History, George W. Beadle of the California, Alan A. Boyden of Rutgers University, Bayard H. Brattstrom of Adelphi College and others.

A technique for the application of small amounts of solution containing growth substances to the hypocotyl of pea seedlings is described. Small doses of 2,4-D applied in this way cause inhibition of root elongation and swellings of the roots. Washing of the roots counteracts the effect of 2,4-D. The growth response of pea roots to 2,4-D applied in continuously renewed solution and in a small amount of circulating solution has also been investigated. The sensitivity of the roots to a given concentration of 2.4-D was found to be greater in the circulating solution. This fact is taken as an indication that a leakable, growth-inhibitory substance is formed in the roots in the presence of 2.4-D. [ABSTRACT FROM AUTHOR]

With the help of an automatic protein sequenator, we have verified a prediction made by us in a recent paper, namely that residue 16 in Candida krusei cytochrome c is a glutamine and not a glutamic acid. Neurospora crassa cytochrome c now remains the only mitochondrial cytochrome c which apparently does not have a glutamine at this position. In the course of this investigation, from two strains of Candida krusei we isolated two cytochromes which differ in amino acid composition. One of them seems to correspond to that described in the literature. Two of the differences have been located. [ABSTRACT FROM AUTHOR]

Provides information on issues involving associations and institutions in weed research. Details on the Weed Science Society of America; Information on the International Award for Research in Pesticide Chemistry; Announcement of the Fourth International Symposium on Weed Biology.

Samples of chironomid pupal exuviae were collected by drift netting in the River Chew, Somerset, over a period of 4 years. The samples were analysed for percentage composition of types, and in some cases for numbers of exuviae per unit volume of water sampled. Surface samples were shown to contain many more exuviae per unit volume sampled than subsurface samples in the same place, and the catch taken by adjacent nets varied by up to four times. On the other hand, the percentage composition of exuvial types remained very consistent under all sampling conditions. Hourly samples from midday to midnight were made at four seasons in the year, showing that the variation in numbers and proportion of types remained approximately constant throughout the afternoon, but altered at the time of the evening emergence of adults. Samples taken from other rivers show both similarities and differences between themselves and the River Chew in percentage composition of types. In the River Biss, Wiltshire, a marked change in the exuvial types collected downstream from a sewage effluent outfall was shown after improvements had been made to the sewage works. Spring samples from the River Chew showed a change from Tanytarsini- to Orthocladiinae-dominated populations between 1970 and 1972. In the River Chew, exuviae suspended in the stream disintegrated after approximately 1–2 weeks. Coloured polystyrene balls were used to investigate the downstream movement of floating material in the River Chew. In August, balls released 400 m upstream of the sampling nets failed to reach them in 3 h sampling. The average stream flow rate was 0.36 m/s. Some evidence is presented to show that the exuviae float for only about 2 h in the River Chew before sinking. It is suggested that the area from which most of the sampled exuviae are derived is limited on the River Chew to, at most, 400 m upstream. Provisional identification to genus is given for those exuvial types mentioned in the paper. The possibility of using chironomid exuvial analysis as a method of characterizing streams is discussed. [ABSTRACT FROM AUTHOR]

Necessity of a thorough study of hybridization, following the breakdown of reproductive isolating mechanisms between naturally occurring populations, has been felt by biologists in general and ichthyologists in particular. In this connection a formula for ‘hybrid index’ developed mainly by Hubbs & Kuronuma (1942) and Hubbs, Hubbs & Johnson (1943) has widely been in use, to test the assumption of hybridity and to study the mode of inheritance. Misra, Bateson & Keenleyside (1970) gave statistical methods of analysing hybrid indices estimated for characters of the ‘continuous’ type, and also provided a numerical example. Recently Misra (1971) gave a method of doing similar analysis for hybrid indices estimated for meristic characters, but no example was provided, as data were not available to him. This paper presents a study of hybridization in the sunfishes (genus Lepomis) of Pinehurst Lake, Ontario, Canada, based on the number of scales below the lateral line; the primary purpose of the study is to show the complete computational procedure involved in the application of the method of Misra (1971), so that those users of the method who are mainly interested in the applied aspects of the method, can bypass the mathematics easily. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

The article studies the ecology of shingle beach plants. The author mentions some of the relevant papers on shingle beaches as a plant habitat, or on their vegetation. Each of the two principal factors, beach composition and shingle mobility, is continuously variable in itself as well as interacting with other factors such as local topography, climate and water supply, and the whole is influenced by time and by past history, according to the author. The author says that the material of shingle beaches consists of two components, the shingle or coarse fraction and the matrix or fine fraction.

In a follow-up of earlier studies, Biological Abstracts (BA), Chemical Abstracts (CA), Excerpta Medico (EM), Psychological Abstracts (PA) and Current List of Medical Literature (CL) were searched for 240 published articles that resulted from oral research reports given at bio-medical meetings in 1957 and 1958. Seventy per cent of the 240 papers appeared in at least one of the four abstracting services, and almost 90% were indexed in CL; however, no single abstracting service covered more than about one-half of all the papers in any of the three research fields. The average time-lag between primary and secondary publication for cardiovascular and endocrine papers was about four months in CL, four in CA, six in BA, and eight to ten months in EM. For psy-chopharmacologic papers, all of the services were slower. This "tracer" technique makes possible and practical a continuous assessment of how a given research field is being served by abstracting and indexing services. [ABSTRACT FROM AUTHOR]

1. Wild house mice have been bred at 18°C, 25°C, (partly at 70% R.H. and partly at 85% R.H.), and 32°C. From their birth to the age of 90 days the mice were regularly weighed, and from the age of 15 days the length of body and tail was measured. The age for attainment of fecundity was recorded. 2. Among the nestlings, the mice at 32° are a little heavier than at the other two temperatures — later on the mice at 18° are significantly heavier and have significantly longer bodies than at the other two temperatures. Already at the age of 15 days, viz., before the thermoregulation becomes functional, the tails area significantly longer at 32° than at 18°. At the age of 60 to 90 days the tails at 32° are about 45% longer than at 18°. That a lengthening of the tail may be caused by other factors than a higher temperature, is indicated by the fact that of the mice grown up at 25° those kept at 85% R.H. have significantly longer tails than those kept at 70% R.H. The lengthening of the tails is due to a lengthening of the individual vertebra, the number remaining the same. No difference in age for attainment of fecundity or in fertility was demonstrable. Nor was it possible to show a significant difference in litter size at the three temperatures. [ABSTRACT FROM AUTHOR]

The article focuses on how to avoid teleology in teaching science. Objective wording is available to replace most any animistic, anthropomorphic, or teleological statement, without "awkward circumlocution." Teleological expressions include "in other that," "so that," and several others. Adaptation that many writers in the field of biology let themselves slip into teleological phrases. Animistic and anthropomorphic expressions are also found in the physical sciences. When flowery figures of speech or even those without flowers are considered to enhance literary style, figurative language need not to become a way of thinking.

The article highlights the importance of biological background for teachers, as this impacts the education process. Biological knowledge for teachers is important, as the child at the receiving end of the education process is a biological creature. Although it is evident that not all the teachers will teach biological sciences, but every teacher is required to deal with the biological phenomenon that is, the child. Therefore, she needs to know about a student's structure and functioning, and the interplay of biological forces in his development and behavior. Hence, the article insists for adequate general training in biological facts and principles, for every novice- teacher in every teacher-preparing institution. While planning a curriculum leading toward a teaching credential at any level of the education process, it is advisable to include biological materials and techniques which would provide an insight into the complex matter of the growth, development, and behavior of children.

The fact that many earlier works on the tetrapod limb question have failed seems not to depend upon the formality of their method, but upon the scarcity of the material on which their conclusions were founded. The purpose of this article is to set forth those facts which the article author considers of essential importance with regard to the extremity question of the tetrapod vertebrates. In an earlier article the author had pointed out that in selachians the rudiment of basals and endray develop first and that the rays then develop separately to join secondarily the stem elements.

The article reports on the acquisition of the journal "The Plant World" by the Ecological Society of America in the U.S. It says that the acquired journal bears the title "Ecology". The acquisition made the journal as the organ of the Society and will publish papers both on plant and animal ecology. Furthermore, the Plant World journal has always published several ecological papers, and its successor, the Ecology journal may now be expected to become one of the main outlets for American ecological work.

The neurohypophysial hormones of a chondrostean, the sturgeon (Acipenser sp.), have been purified by adsorption onto neurophysin, dissociation of the complex hormone-protein by trichloroacetic acid precipitation and isolation of active peptides, from the supernatant solution, by paper chromatoelectrophoresis. Arginine vasotocin has been characterized by amino acid composition, chromatographic and electrophoretic migrations and pharmacological properties as well. The amount of arginine vasotocin (about 50 nmol per g pituitary powder) is intermediary between those found for bony fishes about 1000 nmo]/g) and cartilaginous fishes (about 5 nmol/g). A second hormone, which can be classified in the oxytocin-likc type by its electrophoretic nigration and its pharmacological properties, has been disclosed. The very weak amount did not allow chemical identification. However the chromatographic behaviour and the pharmacological ‘profile’ indicate that this hormone differs from the six known oxytocin-like peptides. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

Plant roots and shoots respond to gravity and light source in a definite way. Thus, there are typical geotropic and phototropic responses for roots and shoots. When seedlings were grown in presence of morphactins, IT 3233 or IT 3456, on a vertical or a horizontal plane, the roots and shoots lost the capacity to respond to gravity or to unilateral light source. This was true for both monocots and dicots. This suggests that basic mechanism (s) of the two tropic responses are the same in the roots and shoots of the two plant groups. The site(s) of action of morphactins is unknown. The reaction (s) controlling geotropism and phototropism may be closely related as morphactins affected both geotropic and phototropic response of the same organ. Indoleacetic acid and gibberellic acid per se did not modify the effect of morphactins on geotropism. Growth retardation effect of morphactins appears to be controlled by another mechanism. [ABSTRACT FROM AUTHOR]

A method is described for the preparation of DNA polymerase purified about 800-fold from rat liver nuclei. The yield of enzyme is about 140-200 µg from 200 g liver. Sodium dodecylsulphate-polyacrylamide gel electrophoresis of the enzyme in the final step, shows a main band corresponding to a polypeptide of molecular weight of 29 000 ± 3%. Sephadex G-100 column chromatography indicates the enzyme to have an apparent molecular weight of approximately 60 000 ± 2% at an ionic strength of 0.15, suggesting that the enzyme is a dimer as isolated. In 2 M NaCl, the apparent molecular weight is 42 000. The enzyme prefers double-stranded DNA templates but utilises most efficiently those activated by deoxyribonuclease I. It has the ability to carry out limited synthesis using only one deoxynucleoside-5'-triphosphate in the assay. The final preparation of DNA polymerase has nucleoside diphosphate kinase associated with it. [ABSTRACT FROM AUTHOR]

A method is presented to measure the alkylation of phosphates in DNA after a treatment with an alkylating agent. Using this method, we have shown that phosphate alkylation represents 15% of total alkylation when DNA is alkylated with ethyl methanesulfonate and only 1% of total alkylation when DNA is alkylated with methyl methanesulfonate. Experiments are also presented which show that phosphate triesters resulting from the alkylation of DNA by ethyl methanesulfonate are very stable, most of them remaining intact after heating at 100 °C for 90 min at pH 7.0. [ABSTRACT FROM AUTHOR]

1. The action of insulin on [14C]glucosamine uptake and metabolism is analyzed in the isolated rat diaphragm. Various metabolites accumulating in the course of incubation are extracted, characterized and estimated by chromatographic, electrophoretic and colorimetric procedures. 2. Insulin greatly stimulates (up to three-fold) the uptake and time-dependent accumulation of metabolites derived from glucosamine. It is demonstrated that glycogen accounts but for a small part (less than 20%) of the accumulated material; the major part consists of glucosamine 6-phosphate, the level of which is increased up to six times by insulin in the cell. Hence the hormone affects glucosamine metabolism already at the level of its first steps: transport and phosphorylation. 3. The use of D-glucose and 3-O-methyl-D-glucose as competitive inhibitors of glucosamine metabolism shows that the mechanisms by which all three substrates are transported and by which two of them (glucose and glucosamine) are phosphorylated are essentially identical, both in the absence and in the presence of insulin. 4. The action of phlorizin as an inhibitor of sugar transport confirms this interpretation. 5. The results obtained are consistent with the hypothesis of an insulin-stimulated, facilitated diffusion step of glucosamine and of a bottle-neck reaction, which limits the deamination of glucosamine 6-phosphate and leads to its accumulation in the tissue. [ABSTRACT FROM AUTHOR]

Gonads of the male Holothuria tubulosa contain two families of lysine-rich histones. One of these families resembles the lysine-rich histones found in somatic tissues of higher organisms (e.g. calf and rabbit). The other family, which may be restricted to the male gonad, is recognizably related to the first family and yet is quite distinct. About 35% of the tryptic peptides differ between these families. These findings support the notion that a broad spectrum of structural variation may exist in lysine-rich histones, perhaps even merging into structures of the slightly lysine-rich class. [ABSTRACT FROM AUTHOR]

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNAM, was purified from Escherichia coli strain CA265 labelled with 32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]

The article offers information about several conventions of the British Ecological Society in Great Britain. The symposium titled "The Water Relations of Plants," organized by the Society on April 5-8, 1961, was attended by 112 members and overseas visitors. The meeting of the Tropical Ecology Group of the Society on April 6, 1961 in the Department of Botany was attended by 55 members which was arranged by P. W. Richards. The 1961 Summer Meeting was centered on the Departments of Botany and Zoology which was participated by 35 members who joined in the excursions by several local members. Various topics are also mentioned on each of the events.

The article examines the curriculum for the talented student in biology in the U.S. A curriculum for the talented student in biology is one that provides a variety of environments and learning experiences through which the student may explore his interests and be stimulated to capitalize on his native abilities. Talented students in biology require guidance and inspiration from well-trained, enthusiastic, dedicated biology teachers. The total curriculum for the talented biology student is one that is well-balanced in the humanities. The curriculum includes at least one year each of chemistry and physics, a minimum of three years of mathematics, some shop experience to acquire skills in the use of tools and machines, and training in mechanical drafting.

This article presents a study on the behavioral aspects of scientific thinking. Scientific thinking involves a number of elements. Some of the major elements outlined by Keeslar includes the ability to sense a problem, ability to state a problem, ability to delimit a problem, ability to recognize facts which are related to the problem, and many more. Meanwhile, according to Burke, critical thinking is an abstraction and can have concrete meaning only when applied to some subject matter. Therefore, the behavior which constitute the elements of critical thinking must be thought of in relation to some specific field, such as biology.

The article presents information on the educational activities undertaken at a functional Demonstration Museum at the Biology Department of Kent State University in Ohio to teach students. To involve the students in individual laboratory work, and to develop freedom and initiative in students, a New Plan was adopted at Kent State University in 1936. The plan involved additional lectures for students in the University Auditorium. In the New Plan, a functional Demonstration Museum was set up for the efficient use of limited equipment. In the Museum, demonstrations, models, and audio-visuals related to classroom lectures are presented. Several preserved specimens and slides of different types are also available at the museum. Students show great interest in the demonstrations, and eventually the popularity of the museum has increased among students.

The article presents the background characteristics of the students enrolled in college physical science courses in the U.S. Examination reveals that physics science student were of great interest in the areas of social sciences, physical sciences, biology, and they were less interested in mathematics. Attitudes of students toward science were determined by the Scientific Attitude Inventory and by ten cluster scores of a semantic differential test and were used as criterion instruments. The areas of interests of students includes career plans, previous science training, and college status.

The article presents information on some of the substitutes for Paramoecium caudatum for studying biology. Paramoecium is a typical one-celled animal. Paramoecium can be cultured easily. But there are certain factors which make it unsuitable as an object of study. Some of other animals which can be used for study are Stentor coeruleus, Spirostomum ambignum and Blepharisma lateritia. Stentor is a blue trumpet-shaped animal about five times the size of Paramoecium. The animal when taken on the slide attaches itself to debris or to the bristle and remains stationary if undisturbed. The powerful adoral cilia, nucleus and the cytoplasmic inclusions are clearly visible. Spirostomumis another large animal about the same length as Stentor. He has a large worm-like shape. Its cilia, oral groove and the contractile vacuole is clearly visible even by the poorest of high-school microscopists. Blepharisma is a pink or red animal and is of the same size of Paramoecium. It has a slow movement which enables students to observe it closely.

The article discusses a study which investigated the species of Sargassum found along the coasts of the Danish West Indies with remarks upon the floating forms of the Sargasso Sea. The Sargassum species include Sargassum vulgare, found on both exposed and sheltered places. The second part of the study deals with the floating Sargassum found in the Sargasso Sea, which are referred to as Sargassum natans and a coarser form which the author called Sargassum hystrix. The biology, affinities and origin of the floating pelagic gulfweed forms are also discussed.

This article reports that two separate estimates of the world output of serial publications in the biological sciences give totals of approximately 20,000 titles, including its applications in agriculture, medicine and technology. Analysis of 5,000 journals has indicated that each number of a journal contains an average of eight articles and, by averaging weeklies, monthlies, quarterlies, and annuals, nine issues appear annually per title. An estimated total therefore of original research papers in biology is 144,000 per year. Biological Abstracts is limited because of facilities and finances to about 30,000 abstracts per year. The introductory pages of Biological Abstracts in the future will present, in brief form, information on new bibliographic services and techniques in biology.

The article discusses the right-or-left-handedness of human beings in terms of genetics and heredity. A vast area of biological theorizing and interpretation revolve around hereditary. Mendelian theory had detected genes and chromosomes to be responsible for various characteristics of human beings. The use of hand by a human being is decided by the difference in development of a portion of his brain. It has been experimentally established that the portion of brain which grows earlier in embryonic life dominates the actions of matured body. Also is the fact that what one does and the way of doing is dominated by the hand used.

The agglutinating effects of Concanavalin A (Con A) on protoplasts isolated from cell suspensions of Daucus carota were studied. Con A was shown to agglutinate the plants proto-plants in a manner similar to the way some animal cells are agglutinated. The agglutination process is dependent on the Concanavalin A concentration, protoplast density, treatment time, the temperature, and the membrane condition. α-D-Methylgluco-pyranosid completely inhibited Con A induced agglutination. The results are discussed in relation to membrane structure and morphology. [ABSTRACT FROM AUTHOR]

Observations on the biology of carrot fly (Psila rosae (F.)) were made in the important carrot-growing areas of eastern England in the period 1948-72. Adults of the spring generation usually emerged in May and peak numbers were usually swept during the third and fourth weeks of May. Eggs were found from the end of May and larval damage was evident from late June. Calculations of accumulated day-degrees of air temperature above 42°F (5.6°C) showed that peak emergence could generally be associated with a total of 422 day-degrees commencing on 1 April. Both separate and combined totals of accumulated day-degrees for February and March were markedly different in years of early and late fly emergence. Adults of the second generation appeared from late July onwards and oviposition occurred mainly during August and September, although in some years eggs were found much later. Resulting larval damage was present by October and increased in severity until the crop was harvested. [ABSTRACT FROM AUTHOR]

In this article the author likes to show that a new epistomological situation has arisen within the field of social anthropology and that one of its consequences is to afford the possibility of a new and closer form of co-operation between the social sciences and biology. This epistemological situation is characterized by two complementary aspects: on the one hand, a theoretical problem is increasingly commanding attention in the front line of research and, on the other, this problem is being tackled in a new methodological context. The problem is that of the analysis of the conditions of reproduction and of non-reproduction of social systems, taking into account the constraints imposed by their internal structures and their ecological environments. These two lines of development have taken on this importance not only by virtue of their methodological innovations, but also because they both accorded particular attention to the roles of the economy in the logic governing the adaptation of societies to their environment and in the logic of their evolution.

The population variation of leaf and inflorescence characters of Stachys palustris L., S. sylvatica L. and the hybrid S. x ambigua Sm. in Britain has been studied and shows S. palustris and S. x ambigua to intergrade. S. palustris varies extensively both within and between populations and, from studies of the variation of leaf and rhizome characters in wet and dry soil, the 'dry-ground' form is shown to be an ecotype. S. sylvatica is less variable, both within and between the populations sampled. S. palustris outbreeds more readily than S. sylvatica and this difference in breeding system may be responsible for the patterns of variation exhibited by the parents. Attempts to backcross S. x ambigua to either S. palustris or S. sylvatica have been totally unsuccessful. The intergradation between S. palustris and S. x ambigua is unlikely to be the result of introgressive hybridization but is principally produced since first, S. palustris exhibits a much greater range of variation than S. sylratica and secondly, the F1 is not intermediate but closer to S. palustris. [ABSTRACT FROM AUTHOR]

Heteranthelium is a monotypic genus in the tribe Triticeae represented by an annual diploid species, H. piliferum. The spike of this species is quite different from other members of the tribe. In an attempt to elucidate the genetic relationships to other genera of the tribe, H. piliferum was crossed with various species of Aegilops, Agropyron, Eremopyrum, Henrardia and Hordeum. From these crosses F1 hybrids of (1) Heteranthelium piliferum (2x) × Eremopyrum bonaepartis (2x) and (2) Heteranthelium piliferum × Hordeum depressum (4x) were produced. At the same time F1 hybrids of (3) Eremopyrum bonaepartis × Hordeum depressum was also obtained. The hybrid under (1) showed subnormal growth and the shape of the spikes was of Eremopyrum-type, while the spikelets were intermediate. Growth of the hybrid under (2) was vigorous and the spike morphology was intermediate between the parents. A solitary spikelet with two glumes and a single spikelet at each rachis node like the Heteranthelium parent was observed but no rudimental spikelets which are the characteristic of Heteranthelium were found. Growth of the hybrid under (3) was very vigorous and the shape of the spikes was of Hordeum type. However, floral construction at each rachis node was very complicated. Rachis nodes with three glumes and a single spikelet were the most common. Sterility of all three combinations was complete. Average chromosome pairing per cell of the F1 hybrids was in (1) 0.04 bivalents and 13.93 univalents, in (2) 0.00 trivalents, 5.06 bivalents and 10.88 univalents, and in (3) 0.00 quadrivalents, 0.01 trivalents, 5.50 bivalents and 9.97 univalents. Judging from the chromosome pairing in (1), (2) and (3), a high bivalent formation in (2) and (3) is attributable to autosynthesis of chromosomes derived from the Hordeum parent. It is concluded that there is no homology among the genomes of those three species. Considering morphological features, geographical distribution, intergeneric cross-ability and genetic relationships of Heteranthelium piliferum, it is concluded that the monotypic genus Heteranthelium is a distinct entity in the tribe Triticeae. This taxon has evolved as an annual during the process of adaptation to rather dry habitats of the Mediterranean climatic regions in the course of generic differentiation of the tribe. [ABSTRACT FROM AUTHOR]

Observationally induced concept acquisition and generalization were studied in 132 second graders, using a clustering task never correctly performed in baseline (or subsequently by untrained controls). Presenting the terminal clusters without demonstrating the process of cluster formation produced appreciable concept attainment, but less than did live modeling. Verbal coding that labeled the color and object class of stimuli was no more effective than a code alluding to each stimulus dimension, but both these combinations surpassed modeling with no, or a weak, verbal code. A group trained by a spoken summary of the concept performed as well as the stronger combinations of observation plus coding. [ABSTRACT FROM AUTHOR]

The article informs about the publication of the paper "Merger in Brooklyn: The Academy of Medicine and the Downstate Medical Center Libraries."

Light-photosynthesis curves for cells adapted to 3 Klux and 30 Klux respectively, were studied using the freshwater diatom Cyclotella Meneghiniana. The initial slope of the curves for the two light intensities was the same which is due to the same concentration of chlorophyll in cells grown at 3 and 30 Klux. The light saturated rate per cell was about 40 per cent higher in 30 Klux-cells than in 3 Klux-cells. The amplitude in light adaptation was found to be rather small in Cyclotella. Ik for the light-photosynthesis curves for 3 Klux- and for 30 Klux-cells was 9 Klux and 12 Klux, respectively. In Chlorella vulgaris a much wider amplitude is found. The corresponding IK-values are 4 Klux and 13 Klux. The light adaptation from one light intensity (3 Klux) to another (30 Klux) or back again was found to be a rather rapid process. Already after 24 hours the adaptation to the new light intensity was complete. Cells of Cyclotella were found to be able to withstand light of very high intensity. Cells adapted to 3 Klux and placed at 30 Klux for three hours did not exhibit any of the inhibition of the rate of photosynthesis shown by cells of Chlorella vulgaris. On the contrary the light saturated rate goes up to a level about 30 per cent higher than that for the 3 Klux and place at 30 Klux for three hours did not exhibit any of the inhibition of the rate of photosynthesis shown by cells of Chlorella vulgaris. On the contrary the light saturated rate goes up to a level about 30 per cent higher than that for the 3 Klux-cells. Towards light intensities of 60 or 100 Klux cells of Cyclotella react in a similar way. No inhibition of the rate of the photosynthesis was found at these very high light intensities either. [ABSTRACT FROM AUTHOR]

GS-1 can be taken up by the roots of beans and cucumbers and transported to the leaves. It penetrates readily into various seeds during a 24-hour soak in a 100 p.p.m. aqueous solution, and into orange rind from a 1000 p.p.m. aqueous solution after a four minute dip. However, inactivation of GS-1 takes place rapidly in expressed juice of bean and cucumber leaves, in bean and pea seeds, and in the flavedo part of the orange rind, while no or much less inactivation occurs in cucurbit and corn seeds and in Oxalis corniculata L. The inactivation is believed to be of the oxidation reduction type in which certain plant enzymes are involved, in the case of orange rind probably cytochrome oxidase. [ABSTRACT FROM AUTHOR]

1. The herbicide. 3-amino-1,2,4 triazole forms an adduct with glucose both in vitro and in vivo. Evidence presented indicates that this adduct is the amine glucoside. 2. Although 3-AT does not affect hexokinase activity, the glucose adduct acts as a substrate for this enzyme. The affinity of the adduct for hexokinase is considerably lower than glucose. 3. The possible physiological significance of the formation of the 3-AT-glucose adduct is discussed. [ABSTRACT FROM AUTHOR]

1. Auxin-induced cell wall loosening is dependent upon the osmotic concentration of the external solution. The tissues are auxin-insensitive whenever OPe is greater than some critical value. If OPe is lowered below the critical value, auxin-induced plastic stretching occurs. The tissue again becomes auxin-insensitive If OPe exceeds the critical value. The critical value (0.1-0.15 M mannitol) bears no apparent relation to the isotonic value, and its position is unaffected by the auxin concentration. The rate of plastic stretching in the region of low OPe is proportional to OPe. The proportionality constant is dependent upon the auxin concentration. 2. The elastic stretching-OPe curve shows a critical point both in the presence and absence of auxin. Under conditions of high OPe, elasticity is low and auxin-insensitive, while with low OPe, elasticity is higher and is auxin-sensitive. 3. A rapid increase in irreversible elongation causes a concomitant increase in ES. The magnitude of the increase in ES is dependent upon the concentration of auxin rather than the rapidity of IE. 4. When IE is limited by a high OPe, there is an auxin-insensitive conversion of ES into IE. 5. Auxin causes a reduction in wall pressure in Avena coleoptiles only when turgor pressure exceeds some critical value. [ABSTRACT FROM AUTHOR]

1. The elongation of roots and the germination percentage of the seeds of Lepidium sativum L. have been studied in the presence of stereoisomeric sodium tartrates and sodium salts of some other dicarboxylic acids. 2. The inhibitory action of DL tartrate upon the elongation of roots is tentatively ascribed to the precipitation of calcium or other metals inside the roots. 3. The inhibition of root elongation brought about by L (-) tartrate can be partially reversed by the addition of malates. It is indicated that L (-) malate is more effective in this respect than D (+) malate. 4. Mesotartrate also inhibits the elongation of roots, but this inhibition is not reversed either by malates, fumarate, malonate, or succinate. 5. The effect of potassium tartrates versus sodium tartrates was studied. No difference was observed expect for 0.01 M DLtartrate. Potassium DLtartrate was more inhibitory than the corresponding sodium salt. 6. The mechanisms of action of these inhibitory tartrates are tentatively discussed. [ABSTRACT FROM AUTHOR]

An X-ray induced pyridoxamine-deficient mutant in Ophiostoma has been studied, and comparisons are made with two previously described pyridoxamine-less strains as regards its genetical and physiological characteristics. [ABSTRACT FROM AUTHOR]

The pectin methylesterase of Avena coleoptiles is shown to be located in the free space. When coleoptiles are placed in dilute salt solutions some of the enzyme diffuses from the tissue. Estimations made from diffusion data and from fractionation in non-aqueous medium indicate that more than 90 % of the pectin methylesterase is adsorbed in vivo. It is suggested that the cell wall may contain a group of enzymes functional in cell wall metabolism. [ABSTRACT FROM AUTHOR]

The rigidity (or further Young's modulus) of potato tuber parenchyma and its dependence on turgor pressure is investigated theoretically on the basis of a simple model. In the model the cells of the parenchyma are approximated by more regular geometrical cell-forms (spheres or polyhedra), each cell being bounded by an elastic membrane (cell wall) and filled with an incompressible fluid (cell sap). It is shown that this model yields the correct dependence of cell diameter on turgor pressure and that certain cell-wall constants can be determined using this relation. If a stress is applied to this model of the parenchyma, each cell is elongated in the direction of the stress, its volume remaining constant because of the incompressible cell rigid. In such a deformation the area of the cell surface will increase which is possible by a stretching of the elastic cell walls. According to the model, this is the general mechanism behind the elasticity and rigidity of the tissue. A mathematical theory elaborating this conception yields results for Young's modulus E and its dependence on turgor pressure that are in good agreement with the experimental values, both qualitatively and quantitatively. (Certain apparent deviations of the behaviour of the parenchyma from Hooke's law are briefly discussed. [ABSTRACT FROM AUTHOR]