The Nucleotide Sequence of Methionine Transfer RNAM.

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNA_M, was purified from Escherichia coli strain CA265 labelled with ^32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNA_M by ribonucleic T₁ and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNA_M is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCA_OH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]