Search

Four new yeast species belonging to the genus Apiotrichum and two new yeast species belonging to Cutaneotrichosporon are described for strains isolated from guano samples from bat-inhabited caves in Japan. In 2005, we reported these isolates as Trichosporon species based on sequence analyses of the D1/D2 domain of large subunit (LSU) rRNA genes according to available basidiomycetous yeast classification criteria; however, to date, they have not been officially published as new species with descriptions. Their phylogenetic positions have been reanalysed based on comparison of internal transcribed spacer (ITS) region sequences (including the 5.8S rRNA gene) and the D1/D2 domain of the LSU rRNA gene with those of known species; we confirmed clear separation from previously described species. Physiological and biochemical properties of the isolates also suggest their distinctiveness. Therefore, we describe Apiotrichum akiyoshidainum (holotype JCM 12595T), Apiotrichum chiropterorum (JCM 12594T), Apiotrichum coprophilum (JCM 12596T), Apiotrichum otae (JCM 12593T), Cutaneotrichosporon cavernicola (JCM 12590T) and Cutaneotrichosporon middelhovenii (JCM 12592T) as new species. C. cavernicola showed particularly distinctive morphology including large inflated anomalous cells on the hyphae and germination from the cells, although clear clamp connections on the hyphae were not confirmed. Further study is needed to elucidate the morph of this species.

The unambiguous application of fungal names is important to communicate scientific findings. Names are critical for (clinical) diagnostics, legal compliance, and regulatory controls, such as biosafety, food security, quarantine regulations, and industrial applications. Consequently, the stability of the taxonomic system and the traceability of nomenclatural changes is crucial for a broad range of users and taxonomists. The unambiguous application of names is assured by the preservation of nomenclatural history and the physical organisms representing a name. Fungi are extremely diverse in terms of ecology, lifestyle, and methods of study. Predominantly unicellular fungi known as yeasts are usually investigated as living cultures. Methods to characterize yeasts include physiological (growth) tests and experiments to induce a sexual morph; both methods require viable cultures. Thus, the preservation and availability of viable reference cultures are important, and cultures representing reference material are cited in species descriptions. Historical surveys revealed drawbacks and inconsistencies between past practices and modern requirements as stated in the International Code of Nomenclature for Algae, Fungi, and Plants (ICNafp). Improper typification of yeasts is a common problem, resulting in a large number invalid yeast species names. With this opinion letter, we address the problem that culturable microorganisms, notably some fungi and algae, require specific provisions under the ICNafp. We use yeasts as a prominent example of fungi known from cultures. But viable type material is important not only for yeasts, but also for other cultivable Fungi that are characterized by particular morphological structures (a specific type of spores), growth properties, and secondary metabolites. We summarize potential proposals which, in our opinion, will improve the stability of fungal names, in particular by protecting those names for which the reference material can be traced back to the original isolate.

Strains of yeast were isolated under a nitrogen-depleted culture condition from decaying tree bark (strain N-12.1) and from mangrove forest water (strain 1-7W.1) sampled at different locations within a mangrove forest site in Ranong province, Thailand. They were found to be genetically and phenotypically different from any currently recognised yeast species. Phylogenetic analysis of nucleotide sequence of three genes, the internal transcribed spacer region 1 and 2 plus 5.8S ribosomal RNA gene (ITS), D1/D2 domain of the large subunit ribosomal RNA gene (LSU D1/D2) and the small subunit of the ribosomal RNA gene (SSU), revealed that these two strains were related to but distinguished from Heterocephalacriaarrabidensis. Several distinct physiological characteristics of these two strains were detected, namely inability to assimilate glycerol, dl-lactic acid, succinic acid, citric acid, d-gluconic acid, and ability to grow well at 25 °C, which were different from those of H. arrabidensis. Accordingly, the name Heterocephalacria mucosa sp. nov., is proposed to accommodate this novel species. The MycoBank number is MB 828624.

Genome hybridization is an important evolutionary event that gives rise to species with novel capabilities. However, the merging of distinct genomes also brings together incompatible regulatory networks that must be resolved during the course of evolution. Understanding of the early stages of post-hybridization evolution is particularly important because changes in these stages have long-term evolutionary consequences. Here, via comparative transcriptomic analyses of two closely related, recently hybridized Trichosporon fungi, T. coremiiforme and T. ovoides, and three extant relatives, we show that early post-hybridization evolutionary processes occur separately at the gene sequence and gene expression levels but together contribute to the stabilization of hybrid genome and transcriptome. Our findings also highlight lineage-specific consequences of genome hybridization, revealing that the transcriptional regulatory dynamics in these hybrids responded completely differently to gene loss events: one involving both subgenomes and another that is strictly subgenome-specific. Sira Sriswasdi et al. use comparative transcriptomics to study the resolution of genomic shock, particularly in transcriptional regulation, in closely related Trichosporon hybrids and their extant relatives. They show that early post-hybridization evolution occurs separately at the gene sequence and gene expression levels.

Two strains of yeast-like achlorophyllous alga belonging to the genus Prototheca were isolated from the water and soil, respectively, from a mangrove forest in Thailand. Cultures of both strains were achlorophyllous when grown under light and dark conditions, and they reproduced by release of sporangiospores. Phylogenetic analyses, based on the D1/D2 region of the large subunit ribosomal RNA gene and the small subunit ribosomal RNA gene nucleotide sequences, revealed these two strains were closely related to Prototheca cutis. The strains grew well at 25 °C, weakly or slowly at 30 °C, but not at 35 °C and higher, and were found to be susceptible to 50 μg/disk clotrimazole, as determined by the disk diffusion test. They assimilated a limited number of carbon/nitrogen compounds; glucose, galactose, trehalose, ethanol, glycerol, propylene glycol, lactic acid, fructose and mannose as sole sources of carbon, and ammonium, lysine and cadaverine as sole sources of nitrogen. The two strains are clearly distinguished from P. cutis by the abilities to assimilate polypropylene glycol and the inability to grow at 35 °C and higher. In this study, the ninth member of the genus Prototheca, Prototheca paracutis sp. nov. (ex-type strain YMTW3-1T = JCM 32112T = TBRC8745T), is proposed. The MycoBank number is MB 821626. In addition, P. paracutis sp. nov. was observed to accumulate lipid at up to 21% of the cell dry weight, characterizing it as an oleaginous microorganism.

Many nomenclatural changes, including proposals of new taxa, have been carried out in fungi to adapt to the "One fungus = One name" (1F=1N) principle. In yeasts, while some changes have been made in response to 1F=1N, most have resulted from two other factors: i) an improved understanding of biological diversity due to an increase in number of known species, and ii) progress in the methods for analyzing and evaluating biological diversity. The method for constructing a backbone tree, which is a basal tree used to infer phylogeny, has also progressed from single-gene trees to multi-locus trees and further, to genome trees. This paper describes recent advances related to the contribution of genomic data to taxonomy, using the order Trichosporonales as an example.

Here, we report draft genome sequences of oleaginous yeast strain Saitozyma sp. JCM 24511, which is phylogenetically closely related to Saitozyma podzolica. These data will have implications not only for the study of the oleaginous activities of yeasts but also for the study of the plant-microorganism microbiome., Here, we report draft genome sequence of oleaginous yeast strain Saitozyma sp. JCM 24511, which is phylogenetically closely related to Saitozyma podzolica. These data will have implications not only for the study of the oleaginous activities of yeasts but also for the study of the plant-microorganism microbiome.

Here, we report draft genome sequences of oleaginous yeast strain Saitozyma sp. JCM 24511, which is phylogenetically closely related to Saitozyma podzolica . These data will have implications not only for the study of the oleaginous activities of yeasts but also for the study of the plant-microorganism microbiome.

Four new yeast species belonging to the genus

During the last few decades, type strains of most yeast species have been barcoded using the D1/D2 domain of their LSU rRNA gene and internal transcribed spacer (ITS) region. Species identification using DNA sequences regarding conspecificity in yeasts has also been studied. Most yeast species can be identified according to the sequence divergence of their ITS region or a combination of the D1/D2 and ITS regions. Studies that have examined intraspecific diversity have used multilocus sequence analyses, whereas the marker regions used in this analysis vary depending upon taxa. D1/D2 domain and ITS region sequences have been used as barcodes to develop primers suitable for the detection of the biological diversity of environmental DNA and the microbiome. Using these barcode sequences, it is possible to identify relative lineages and infer their gene products and function, and how they adapt to their environment. If barcode sequence was not variable enough to identify a described species, one could investigate the other biological traits of these yeasts, considering geological distance, environmental circumstances and isolation of reproduction. This article is dedicated to late Dr Takashi Nakase (1939–2018).

To construct a backbone tree consisting of basidiomycetous yeasts, draft genome sequences from 25 species of Trichosporonales (Tremellomycetes, Basidiomycota) were generated. In addition to the hybrid genomes of Trichosporon coremiiforme and Trichosporon ovoides that we described previously, we identified an interspecies hybrid genome in Cutaneotrichosporon mucoides (formerly Trichosporon mucoides). This hybrid genome had a gene retention rate of ~55%, and its closest haploid relative was Cutaneotrichosporon dermatis. After constructing the C. mucoides subgenomes, we generated a phylogenetic tree using genome data from the 27 haploid species and the subgenome data from the three hybrid genome species. It was a high-quality tree with 100% bootstrap support for all of the branches. The genome-based tree provided superior resolution compared with previous multi-gene analyses. Although our backbone tree does not include all Trichosporonales genera (e.g. Cryptotrichosporon), it will be valuable for future analyses of genome data. Interest in interspecies hybrid fungal genomes has recently increased because they may provide a basis for new technologies. The three Trichosporonales hybrid genomes described in this study are different from well-characterized hybrid genomes (e.g. those of Saccharomyces pastorianus and Saccharomyces bayanus) because these hybridization events probably occurred in the distant evolutionary past. Hence, they will be useful for studying genome stability following hybridization and speciation events. Copyright © 2017 John Wiley & Sons, Ltd.

We report the draft genome sequences of type strains for Dioszegia crocea and its closely related species Dioszegia aurantiaca, which should improve our understanding of the epiphytic phylloplane yeasts. These data will also have implications for the plant microbiome, since Dioszegia is considered a microbial “hub” taxon.

Many nomenclatural changes, including proposals of new taxa, have been carried out in fungi to adapt to the "One fungus = One name" (1F=1N) principle. In yeasts, while some changes have been made in response to 1F=1N, most have resulted from two other factors: i) an improved understanding of biological diversity due to an increase in number of known species, and ii) progress in the methods for analyzing and evaluating biological diversity. The method for constructing a backbone tree, which is a basal tree used to infer phylogeny, has also progressed from single-gene trees to multi-locus trees and further, to genome trees. This paper describes recent advances related to the contribution of genomic data to taxonomy, using the order Trichosporonales as an example.

Delineation and characterization of genera in Trichosporonales (Agaricomycotina, Basidiomycota) was performed using 24 haploid and 3 naturally occurring hybrid genomes, with 3 Tremellales genomes used as outgroups. Orthologous group analysis of those genomes showed presence-absence patterns of orthologs that were consistent with the genus classifications. Many shared unique orthologs were identified in the well-supported lineages (genera Apiotrichum and Trichosporon), supporting the definitions of the genera Apiotrichum and Trichosporon from a genomic perspective. Specifically, we obtained 24 and 285 genus-specific genes from eight Apiotrichum and five Trichosporon species, respectively, and propose that these genus-specific genes can be used for delineation of those genera. On the other hand, the genus Cutaneotrichosporon shared only one genus-specific gene among eight genomes, indicating that this genus definition might require re-examination based on genomic data. In addition, taxonomic revisions are presented in this study, including the proposal of two genera, Pascua and Prillingera. Because genomic data can be systematically obtained and analyzed to compare species from a comprehensive viewpoint, they can be used not only to reconstruct reliable phylogenetic trees, but also to re-examine the definitions of taxonomic classifications. To our knowledge, this is the first report to discuss the 'natural system' of genus level classification in fungi based on genomic data.

Budding yeasts (subphylum Saccharomycotina) are found in every biome and are as genetically diverse as plants or animals. To understand budding yeast evolution, we analyzed the genomes of 332 yeast species, including 220 newly sequenced ones, which represent nearly one-third of all known budding yeast diversity. Here, we establish a robust genus-level phylogeny comprising 12 major clades, infer the timescale of diversification from the Devonian period to the present, quantify horizontal gene transfer (HGT), and reconstruct the evolution of 45 metabolic traits and the metabolic toolkit of the budding yeast common ancestor (BYCA). We infer that BYCA was metabolically complex and chronicle the tempo and mode of genomic and phenotypic evolution across the subphylum, which is characterized by very low HGT levels and widespread losses of traits and the genes that control them. More generally, our results argue that reductive evolution is a major mode of evolutionary diversification. Fil: Shen, Xing-Xing. Vanderbilt University; Estados Unidos Fil: Opulente, Dana A.. University of Wisconsin; Estados Unidos Fil: Kominek, Jacek. University of Wisconsin; Estados Unidos Fil: Zhou, Xiaofan. Vanderbilt University; Estados Unidos. South China Agricultural University; China Fil: Steenwyk, Jacob L.. Vanderbilt University; Estados Unidos Fil: Buh, Kelly V.. University of Wisconsin; Estados Unidos Fil: Haase, Max A.B.. University of Wisconsin; Estados Unidos. University of New York. School of Medicine; Estados Unidos Fil: Wisecaver, Jennifer H.. Purdue University; Estados Unidos. Vanderbilt University; Estados Unidos Fil: Wang, Mingshuang. Vanderbilt University; Estados Unidos Fil: Doering, Drew T.. University of Wisconsin; Estados Unidos Fil: Boudouris, James T.. University of Wisconsin; Estados Unidos Fil: Schneider, Rachel M.. University of Wisconsin; Estados Unidos Fil: Langdon, Quinn K.. University of Wisconsin; Estados Unidos Fil: Ohkuma, Moriya. Riken BioResource Research Center. Japan Collection of Microorganisms; Japón Fil: Endoh, Rikiya. Riken BioResource Research Center. Japan Collection of Microorganisms; Japón Fil: Takashima, Masako. Riken BioResource Research Center. Japan Collection of Microorganisms; Japón Fil: Manabe, Ri-ichiroh. Riken Center for Integrative Medical Sciences; Japón. Riken Center For Life Science Technologies; Japón Fil: Čadež, Neža. University of Ljubljana; Eslovenia Fil: Libkind Frati, Diego. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Patagonia Norte. Instituto Andino Patagónico de Tecnologías Biológicas y Geoambientales. Universidad Nacional del Comahue. Instituto Andino Patagónico de Tecnologías Biológicas y Geoambientales.; Argentina. Universidad Nacional del Comahue. Centro Regional Universitario Bariloche; Argentina Fil: Rosa, Carlos A.. Universidade Federal de Minas Gerais; Brasil Fil: DeVirgilio, Jeremy. United States Department of Agriculture. Agricultural Research Service; Argentina. National Center For Agricultural; Estados Unidos Fil: Hulfachor, Amanda Beth. University of Wisconsin; Estados Unidos Fil: Groenewald, Marizeth. Westerdijk Fungal Biodiversity Institute; Países Bajos Fil: Kurtzman, Cletus P.. United States Department of Agriculture. Agricultural Research Service; Argentina. National Center For Agricultural; Estados Unidos Fil: Hittinger, Chris Todd. University of Wisconsin; Estados Unidos Fil: Rokas, Antonis. Vanderbilt University; Estados Unidos

The yeast strains IPM32-16, ISM28-8sT, and IPM46-17, isolated from plant and soil samples from Iriomote Island, Japan, were explored in terms of lipid production during growth in a mixture of glucose and xylose. Phylogenetically, the strains were most closely related to Cystobasidium slooffiae, based on the sequences of the ITS regions and the D1/D2 domain of the LSU rRNA gene. The strains were oleaginous, accumulating lipids to levels > 20% dry cell weight. Moreover, kinetic analysis of the sugar-to-lipid conversion of a 1:1 glucose/xylose mixture showed that the strains consumed the two sugars simultaneously. IPM46-17 attained the highest lipid content (33%), mostly C16 and C18 fatty acids. Thus, the yeasts efficiently converted lignocellulosic sugars to lipids, aiding in biofuel production (which benefits the environment, promotes rural jobs, and strengthens fuel security). The strains constituted a novel species of Cystobasidium, for which we propose the name Cystobasidium iriomotense (type strain ISM28-8sT = JCM 24594T = CBS 15015T)., バイオマスから油脂を生産する新種の酵母を発見 --油脂製造プロセスの効率化と低炭素社会の実現に貢献--. 京都大学プレスリリース. 2018-10-01.

Fungal taxonomy has been reconstructed on the basis of genome information, and new nomenclatural rules have been enacted from 2013. It has been proposed that Cryptococcus neoformans and Cryptococcus gattii be reclassified into two species (C. neoformans and Cryptococcus deneoformans) and five species (C. gattii, Cryptococcus bacillisporus, Cryptococcus deuterogattii, Cryptococcus tetragattii, and Cryptococcus decagattii), respectively. The genus Trichosporon has been reclassified into five genera. Trichosporon asahii, which is the causative agent of trichosporonosis, has been retained in the genus Trichosporon, while Trichosporon cutaneum has been transferred into a new genus, Cutaneotrichosporon.

Nine strains representing a single anamorphic novel yeast species in dispersed tropical and subtropical habitats were isolated from sugarcane leaf tissue (DMKU-SE24, DMKU-SE45T, DMKU-SE129 and DMKU-SE134) and corn leaf tissue (DMKU-CE36) in Thailand, phylloplane and rhizoplane of sugarcane in Brazil (IMUFRJ 52018 and IMUFRJ 52019), bromeliad leaf tissue in Brazil (IMUFRJ 51954) and plant leaf in Japan (IPM31-24). These strains showed identical or only 1 nt substitution in the sequences of the D1/D2 region of the LSU rRNA gene and 0–5 nt substitutions in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the eight of these strains represented a single species in the genus Occultifur that was distinct from related species. Occultifur kilbournensis was the most closely related species, but with 0.9–1.2 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 2.4–2.6 % nucleotide substitutions in the ITS region. They are therefore considered to represent a novel species of the genus Occultifur although the formation of basidia was not observed. The name Occultifur plantarum f.a., sp. nov. is proposed. The type strain is DMKU-SE45T (=CBS 14554T=TBRC 6561T).

Cryptococcosis is a major fungal disease caused by members of the Cryptococcus gattii and Cryptococcus neoformans species complexes. After more than 15 years of molecular genetic and phenotypic studies and much debate, a proposal for a taxonomic revision was made., Cryptococcosis is a major fungal disease caused by members of the Cryptococcus gattii and Cryptococcus neoformans species complexes. After more than 15 years of molecular genetic and phenotypic studies and much debate, a proposal for a taxonomic revision was made. The two varieties within C. neoformans were raised to species level, and the same was done for five genotypes within C. gattii. In a recent perspective (K. J. Kwon-Chung et al., mSphere 2:e00357-16, 2017, https://doi.org/10.1128/mSphere.00357-16), it was argued that this taxonomic proposal was premature and without consensus in the community. Although the authors of the perspective recognized the existence of genetic diversity, they preferred the use of the informal nomenclature “C. neoformans species complex” and “C. gattii species complex.” Here we highlight the advantage of recognizing these seven species, as ignoring these species will impede deciphering further biologically and clinically relevant differences between them, which may in turn delay future clinical advances.

To construct a backbone tree consisting of basidiomycetous yeasts, draft genome sequences from 25 species of Trichosporonales (Tremellomycetes, Basidiomycota) were generated. In addition to the hybrid genomes of Trichosporon coremiiforme and Trichosporon ovoides that we described previously, we identified an interspecies hybrid genome in Cutaneotrichosporon mucoides (formerly Trichosporon mucoides). This hybrid genome had a gene retention rate of ~55%, and its closest haploid relative was Cutaneotrichosporon dermatis. After constructing the C. mucoides subgenomes, we generated a phylogenetic tree using genome data from the 27 haploid species and the subgenome data from the three hybrid genome species. It was a high-quality tree with 100% bootstrap support for all of the branches. The genome-based tree provided superior resolution compared with previous multi-gene analyses. Although our backbone tree does not include all Trichosporonales genera (e.g. Cryptotrichosporon), it will be valuable for future analyses of genome data. Interest in interspecies hybrid fungal genomes has recently increased because they may provide a basis for new technologies. The three Trichosporonales hybrid genomes described in this study are different from well-characterized hybrid genomes (e.g. those of Saccharomyces pastorianus and Saccharomyces bayanus) because these hybridization events probably occurred in the distant evolutionary past. Hence, they will be useful for studying genome stability following hybridization and speciation events. Copyright © 2017 John WileySons, Ltd.

Draft genome sequences of the type strain (NBRC 1983) and a thermotolerant isolate (ATY839) of the xylose-fermenting yeast Scheffersomyces shehatae were determined. The genome sizes and presumed open reading frames were highly similar between strains NBRC 1983 T and ATY839.

The lipid-accumulating ability of 500 yeast strains isolated in Japan was evaluated. Primary screening revealed that 31 strains were identified as potential lipid producers, from which 12 strains were cultivated in a medium containing 3% glucose. It was found that JCM 24511 accumulated the highest lipid content, up to 61.53%, while JCM 24512 grew the fastest. They were tentatively identified as Cryptococcus sp. and Cryptococcus musci, respectively. The maximum lipid concentration of 1.49g/L was achieved by JCM 24512. Similarly, JCM 24511 also achieved a high lipid production of 1.37g/L. High lipid productivity is the most important characteristic of oleaginous yeasts from the viewpoint of practical production. Among the strains tested here, JCM 24512 had the best lipid productivity, 0.37g/L/day. The results show that the isolated yeasts could be promising candidates for biodiesel production.

Three yeast isolates, G5-5(5)T, G5-9(3) and G5-9(4), were obtained from the sugar cane juice and waste from sugar production plant (Korach Industry Co., Ltd) in Korach province, Thailand. They were found to belong to the same species based on DNA sequence identity of the small subunit ribosomal RNA gene (SSU) and the D1/D2 region of the large subunit rRNA gene (LSU D1/D2). A blastn search of the GenBank database revealed they had 93 % nucleotide sequence identity to Dekkera bruxellensis for the SSU (1742 bp), but their LSU D1/D2 sequence (572 bp) showed less than 90 % identity to all available sequences in the database. Phylogenetic analyses with neighbour-joining and maximum-parsimony methods using the aligned LSU D1/D2 and SSU sequences (a total of 2072 positions after removal of gaps) inferred that the three isolates were separated from all known taxa in the Saccharomycetales, and that the neighbouring taxa were species of Dekkera/Brettanomyces. Physiological and biochemical characters revealed distinct differences between the three isolates and Dekkera/Brettanomyces species, including the ability to assimilate several carbon sources and inability to ferment glucose. Thus, isolates G5-5(5)T, G5-9(3) and G5-9(4) should be assigned to a novel taxon, for which the name Allodekkera sacchari gen. nov., sp. nov. is proposed. The type strain of the type species is G5-5(5)T (=CBS 14167T=JCM 18455T=TISTR 5950T), with MycoBank number MB815477 (for the genus) and MB817751 (for the species). Two additional strains of the species are G5-9(3) (=JCM 18456) and G5-9(4) (=JCM 18457).

Here, we report the draft genome sequence of Trichosporon domesticum JCM 9580, isolated from the house of a patient with summer-type hypersensitivity pneumonitis (SHP) in Japan. This genomic information will help elucidate the mechanisms of the development of SHP.

Polyploidization events such as whole-genome duplication and inter-species hybridization are major evolutionary forces that shape genomes. Although long-term effects of polyploidization have been well-characterized, early molecular evolutionary consequences of polyploidization remain largely unexplored. Here, we report the discovery of two recent and independent genome hybridizations within a single clade of a fungal genus, Trichosporon. Comparative genomic analyses revealed that redundant genes are experiencing decelerations, not accelerations, of evolutionary rates. We identified a relationship between gene conversion and decelerated evolution suggesting that gene conversion may improve the genome stability of young hybrids by restricting gene functional divergences. Furthermore, we detected large-scale gene losses from transcriptional and translational machineries that indicate a global compensatory mechanism against increased gene dosages. Overall, our findings illustrate counteracting mechanisms during an early phase of post-genome hybridization and fill a critical gap in existing theories on genome evolution.

Three basidiomycetous yeast strains, No. 3 (=MAFF 654001), No. 4 (=MAFF 654002), and No. 6 (=MAFF 654003), isolated from diseased leaves of Citrus unshiu and formerly identified as Sporobolomyces roseus, were reported to cause citrus pseudo greasy spot (PGS). In the course of investigating the causal agent of citrus PGS, we confirmed, using conventional and molecular phylogenetic methods, that these yeasts caused citrus PGS but did not belong to S. roseus. No. 3 (=MAFF 654001) and No. 4 (=MAFF 654002) were closely related to S. subbrunneus, and No. 6 (=MAFF 654003) to S. dimmenae, but each of them was distinctive from these species. We have proposed two new species, S. productus and S. corallinus, as the causal pathogens of citrus PGS.

An ustilaginomycetous anamorphic yeast species isolated from the leaves of Saccharum officinarum (sugarcane) in Okinawa, Japan, was identified as a novel Pseudozyma species based on morphological and physiological aspects and molecular taxonomic analysis using the D1/D2 domains of the large subunit (26S) rRNA gene and the internal transcribed spacer 1 (ITS1)-5.8S-ITS2 regions. The name Pseudozyma churashimaensis sp. nov. was proposed for the novel species, with JCM 16988(T) as the type strain. Interestingly, P. churashimaensis was found to produce glycolipid biosurfactants, a mixture of mannosylerythritol lipids (MELs), including a novel tri-acetylated derivative (MEL-A2), from glucose. The observed critical micelle concentration (CMC) and the surface tension at CMC of MEL-A2 were 1.7 × 10⁻⁶ M and 29.2 mN/m, respectively. Moreover, on a water-penetration scan, MEL-A2 efficiently formed different lyotropic liquid crystalline phases, including the lamella phase at a wide range of concentrations, indicating its excellent surface-active and self-assembling properties. The novel strain of the genus Pseudozyma should thus facilitate the application of glycolipid biosurfactants in combination with other MEL producers.

Anamorphic basidiomycetous yeast strains RS090T and RS092 were isolated from a soil sample collected on Rishiri Island in the Rishiri, Rebun, Sarobetsu National Park, Hokkaido, Japan. As the sequences of the D1/D2 domains of their large-subunit rRNA genes were identical and those of the internal transcribed spacer regions differed in only four bases, we conclude that they belong to a single species with intraspecific diversity. Phylogenetically, this species was related to Dioszegia buhagiarii and Dioszegia hungarica, in the Tremellales, Tremellomycetes, Basidiomycota, but was clearly distinct from them. Based on the results of sequence analyses and phenotypic characteristics, we conclude that they belong to a novel species in the genus Dioszegia, for which the name Dioszegia rishiriensis sp. nov. is proposed, with the type strain RS090T ( = JCM 16282T = CBS 11844T).

In addition to rusts, the subphylum Pucciniomycotina (Basidiomycota) includes a large number of unicellular or dimorphic fungi which are usually studied as yeasts. Ribosomal DNA sequence analyses have shown that the current taxonomic system of the pucciniomycetous yeasts which is based on phenotypic criteria is not concordant with the molecular phylogeny and many genera are polyphyletic. Here we inferred the molecular phylogeny of 184 pucciniomycetous yeast species and related filamentous fungi using maximum likelihood, maximum parsimony and Bayesian inference analyses based on the sequences of seven genes, including the small subunit ribosomal DNA (rDNA), the large subunit rDNA D1/D2 domains, the internal transcribed spacer regions (ITS 1 and 2) of rDNA including the 5.8S rDNA gene; the nuclear protein-coding genes of the two subunits of DNA polymerase II (RPB1 and RPB2) and the translation elongation factor 1-α (TEF1); and the mitochondrial gene cytochrome b (CYTB). A total of 33 monophyletic clades and 18 single species lineages were recognised among the pucciniomycetous yeasts employed, which belonged to four major lineages corresponding to Agaricostilbomycetes, Cystobasidiomycetes, Microbotryomycetes and Mixiomycetes. These lineages remained independent from the classes Atractiellomycetes, Classiculomycetes, Pucciniomycetes and Tritirachiomycetes formed by filamentous taxa in Pucciniomycotina. An updated taxonomic system of pucciniomycetous yeasts implementing the ‘One fungus = One name’ principle will be proposed based on the phylogenetic framework presented here.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Two strains of xylose-containing and Q-10-having ballistoconidiogenous yeasts isolated from plant leaves collected in Taiwan were found to represent two new species of the genus Bullera. In the phylogenetic trees based on the sequence analysis of 18S rDNA and D1/D2 domain of 26S rDNA, these species are located in the Bullera variabilis (Bulleribasidum) cluster in Hymenomycetes. They are described as Bullera begoniae sp. nov. and Bullera setariae sp. nov., respectively.

Lipophilic yeasts of the genus Malassezia are part of the normal cutaneous microflora and are considered one of the factors that trigger atopic dermatitis (AD). We isolated two strains of Malassezia from a healthy Japanese female. Analysis of the D1/D2 26S ribosomal DNA and internal transcribed spacer region sequences of the isolates suggested that they are new members of the genus Malassezia . We propose the name Malassezia japonica sp. nov. for the isolates. M . japonica is easily distinguished from the seven known lipophilic species by its ability to assimilate Tween 40 and Tween 60 and its inability to assimilate Tween 20 and Tween 80 and to grow at 40°C. Furthermore, by applying transparent dressings to the skin lesions of 36 patients with AD and the skin of 22 healthy subjects, M . japonica DNA was detected by a non-culture-based method consisting of nested PCR with M . japonica species-specific primers. M . japonica DNA was detected from 12 of the 36 patients (33.3%) and 3 of the 22 healthy subjects (13.6%). Although it is not known whether M . japonica plays a role in AD, this species was part of the microflora in both patients with AD and healthy subjects.

The genus Pseudozyma is ustilaginomycetous anamorphic yeasts, and are mainly isolated from plants. We isolated three Pseudozyma strains from the blood of patients in Thailand. While one isolate was identified as P. antarctica by rDNA sequence analysis, the other two were considered to be new species and were named P. parantarctica and P. thailandica. The three isolates proved to be resistant to 5-flucytosine, and P. thailandica was also resistant to fluconazole and itraconazole. As far as we know, this is the first isolation of Pseudozyma strains from humans. The two new species are described.

Two ballistoconidium-forming yeast strains, CH 2.504 and CH 2.509, were isolated from the wilting leaves of Parthenocissus sp. collected in Yunnan, China in 1996. These two strains were assigned to the genus Bullera Derx by the characteristics of forming rotationally symmetric ballistoconidia, containing xylose in the cell hydrolysates and having Q-10 as the major ubiquinone. Molecular phylogenetic analysis based on small subunit ribosomal RNA gene (18S rDNA) and internal transcribed spacer (ITS) region sequences revealed that CH 2.504 is closely related to B. variabilis Nakase & Suzuki, while CH 2.509 is located in a clearly separate clade among the described Bullera species and related taxa. The results indicated that CH 2.509 represents a new species, for which Bullera anomala sp. nov. is the proposed name (type strain AS 2.2094T). Further DNA-DNA reassociation data showed that CH 2.504 also represents a distinct species, for which the name Bullera pseudovariabilis sp. nov. is given (type strain AS 2.2092T).

More than 50 ballistoconidium-forming yeast strains, isolated from plant leaves collected in Yunnan, China, were identified as Sporobolomyces roseus Kluyver & van Niel by conventional methods. However, comparison of the internal transcribed spacer (ITS) region and 265 rDNA D1/D2 domain sequences indicated that these strains represented more than one species. Type or authentic strains of the synonyms of Sporobolomyces roseus and the closely related species Sporidiobolus pararoseus Fell & Tallman were employed in the rDNA sequence comparison. Sporobolomyces boleticola Ramirez, Sporobolomyces pollaccii Verona & Ciferri, Sporobolomyces roseus var. madurae Janke and Torulopsis somala Verona were confirmed to be conspecific with Sporobolomyces roseus. Another synonym of this species, Sporobolomyces salmoneus Derx, was located together with Sporobolomyces marcillae Santa Maria in a separate clade. Two synonyms of Sporidiobolus pararoseus, Sporobolomyces carnicolor Yamasaki & Fujii (nom. inval.) and Sporobolomyces japonicus Iizuka & Goto, were revealed to represent two distinct species. The name Sporobolomyces carnicolor is validated, with strain CBS 4215(T) as the type strain. A novel species represented by five of the selected Yunnan strains was confirmed, for which the name Sporobolomyces phaffii sp. nov. is proposed (type strain CH 2.052(T) = AS 2.2137(T) = JCM 11491(T) = CBS 9129(T)). This study also indicates that yeast species with similar ITS sequences may have quite different D1/D2 sequences.