Search

An ultra-sensitive photoelectrochemical (PEC) sensor based on perovskite composite was developed for the determination of alkaline phosphatase (ALP) in human serum. In contrast to CsPbBr3 or Y6 that generated anodic current, the heterojunction of CsPbBr3/Y6 promoted photocarriers to separate and generated cathodic photocurrent. Ascorbic acid (AA) was produced by ALP hydrolyzing L-ascorbic acid 2-phosphate trisodium salt (AAP), which can combine with the holes on the photoelectrode surface, accelerating the transmission of photogenerated carriers, leading to enhanced photocurrent intensity. Thus, the enhancement of PEC current was linked to ALP activity. The PEC sensor exhibits good sensitivity for detection of ALP owing to the unique photoelectric properties of the CsPbBr3/Y6 heterojunction. The detection limit of the sensor was 0.012 U·L−1 with a linear dynamic range of 0.02–2000 U·L−1. Therefore, this PEC sensing platform shows great potential for the development of different PEC sensors. [ABSTRACT FROM AUTHOR]

The detection of botulinum neurotoxin A (BoNT/A) endopeptidase activity by pregnancy test paper based on human chorionic gonadotropin (hCG)-functionalized peptide-modified magnetic nanoparticles (MNs) is described for the first time. HCG-functionalized SNAP-25 peptide substrate with hydrolysis recognition sites was optimally designed. HCG can be recognized by pregnancy test strips. BoNT/A light chain (BoNT-LcA) is the central part of the endopeptidase function in holotoxin, which can specifically hydrolyze SNAP-25 peptide to release the hCG-peptide probe, and the hCG-peptide probe released can be quantitatively detected by pregnancy test strips, achieving indirect determination of BoNT/A. By quantifying the T-line color intensity of test strips, the visual detection limit for BoNT-LcA is 12.5 pg/mL, and the linear range of detection for BoNT-LcA and BoNT/A holotoxin was 100 pg/mL to 1 ng/mL and 25 to 250 ng/mL. The ability of the method to quantify BoNT/A was validated in human serum samples. This method shows the potential for sensitive detecting BoNT/A and has prospects for the diagnosis and prognosis of clinical botulism. [ABSTRACT FROM AUTHOR]

Graphene@MXene composite nanomaterials were utilized to construct an electrochemical sensor for alanine aminotransferase (ALT) detection. The combination of graphene nanosheets with MXene avoids the self-stacking of MXene and graphene, and broadens the charge transfer channel. In addition, the composite nanomaterial provides increased loading sites for pyruvate oxidase. The principle of ALT detection is a two-step enzymatic reaction. l-Alanine was initially transferred to pyruvate catalyzed by ALT. The formed pyruvate was then oxidized by pyruvate oxidase, generating H2O2. Through the detection of the generated H2O2, ALT activity was measured. The linear range of the sensor to ALT was from 5 to 400 U·L−1 with a detection limit of 0.16 U·L−1 (S/N = 3). For real sample analysis, the spiked recovery test results of ALT in serum samples were between 96.89 and 103.93% with RSD < 5%, confirming the reliability of the sensor testing results and potential clinical application of the sensor. [ABSTRACT FROM AUTHOR]

An electrochemical sensor for the detection of uric acid was constructed using cobalt oxide-modified porous carbon@multi-walled carbon nanotube (MWCNTs) composite material for the modification of the electrode. Firstly, ZIF-67 is generated on carbon nanotubes using the surfactant cetylammonium bromide (CTAB) as template. The vesicles generated by CTAB act as nucleation sites for the in situ growth of ZIF-67. Then, cobalt oxide-modified porous carbon was obtained after high-temperature carbonization of ZIF-67, leading to the formation of cobalt oxide-modified porous carbon@MWCNT composite materials. Co-N and Co-O active sites on the composite material can improve the oxidation of uric acid on the electrode surface, leading to enhanced sensitivity and selectivity for uric acid detection. The sensor has a good linear range from 1 to 40 μM for uric acid detection with a detection limit of 0.09 μM. The sensor was utilized for determination of uric acid in actual serum samples. [ABSTRACT FROM AUTHOR]

The weak fluorescence efficiency of copper nanoclusters (Cu NCs) limits their wide applications in biosensing and bioimaging areas, while the aggregation-induced emission (AIE) effect is anticipated to increase their luminescence intensity. Herein, the weak red emission of Cu NCs is increased considerably by the addition of lanthanide Tb3+, ascribed to the AIE effect. Monitoring of spores contamination can be carried out by determining the level of 2, 6-dipicolinic acid (DPA), which is a marker of spores. Due to the stronger synergy between DPA and Tb3+ for its clamped configuration of adjacent pyridine nitrogen group with the carboxylic acid group, the addition of DPA leads Tb3+ to be taken away from Cu NCs through a stronger coordination effect, causing Cu NCs to return to the dispersed state and weakened fluorescence. Based on this, an "off–on-off" fluorescent probe for DPA sensing was built, in which Tb3+ was used as a bridge to achieve AIE enhanced fluorescence effect on Cu NCs as well as a specific recognizer of DPA. The detection range for DPA was 0.1–60 μM and the detection limit was 0.06 μM, which was much lower than the infectious dose of anthrax spores. Since DPA is a unique biomarker for bacterial spores, the method was applied to the detection of actual bacterial spores and satisfactory results were obtained with a detection limit of 4.9*103 CFU mL−1. [ABSTRACT FROM AUTHOR]

A bovine serum albumin (BSA)-assisted ultrasonication strategy was developed for the synthesis of CsPbBr3 nanocrystals (NCs) with stable fluorescence properties in aqueous solution. Such a preparation method is simple, fast and does not require complex equipment. The results show that the synthesized CsPbBr3 NCs are homogeneous in particle size and have good solubility and stability in water. The CsPbBr3 NCs have been utilized as fluorescence probe for rapid detection of hydrogen sulfide (H2S) in human serum. The reaction of H2S with the lead sites on the surface of CsPbBr3 NCs produces lead sulfide (PbS), resulting in the decrease of fluorometric intensity of CsPbBr3 NCs. Our designed fluorescent assay has a linear S2− detecting range of 10 ~ 800 nM with a detection limit of 7.05 nM. The assay was used to determine H2S in human serum with spiked recoveries ranging from 94.98% to 102.69%. This work opens new avenues for the application of halide lead perovskite in different biosensing areas. [ABSTRACT FROM AUTHOR]

Adenosine as a potential tumor marker is of great value for clinical disease diagnosis. Since the CRISPR-cas12a system is only capable of recognizing nucleic acid targets we expanded the CRISPR-cas12a system to determine small molecules by designing a duplexed aptamer (DA) converting g-RNA recognition of adenosine to recognition of aptamer complementary DNA strands (ACD). To further improve the sensitivity of determination, we designed a molecule beacon (MB)/gold nanoparticle (AuNP)-based reporter, which has higher sensitivity than traditional ssDNA reporter. In addition, the AuNP-based reporter enables more efficient and fast determination. The determination of adenosine under 488-nm excitation can be realized within 7 min, which is more than 4 times faster than traditional ssDNA reporter. The linear determination range of the assay to adenosine was 0.5–100 μM with the determination limit of 15.67 nM. The assay was applied to recovery determination of adenosine in serum samples with satisfactory results. The recoveries were between 91 and 106% and the RSD values of different concertation were below 4.8%. This sensitive, highly selective, and stable sensing system is expected to play a role in the clinical determination of adenosine and other biomolecules. [ABSTRACT FROM AUTHOR]

A sandwiched photoelectrochemical (PEC) sensor was developed for sensitive detection of human epidermal growth factor receptor 2 (HER2) based on BiVO4-Bi2S3 heterojunction as the photoelectric material accompanied with magnetic nanoparticles for enrichment of HER2 and CdS for signal amplification. The in situ generation of Bi2S3 on the surface of BiVO4 forming a BiVO4-Bi2S3 heterojunction is more conducive to the transit of electron–hole pairs. Antibody-modified MNs are utilized to capture and separate HER2 from samples. After forming a sandwich immune structure, under illumination, the photocurrent shows an increasing trend with the increment of HER2 concentration. The PEC immunosensor displays a good linear concentration range between 1.00 and 1.00 × 103 pg·mL−1 and a low limit of detection down to 0.680 pg·mL−1 (S/N = 3) for HER2 under a bias voltage of 0.1 V (vs. Ag/AgCl electrode). Furthermore, the sensor was successfully applied to detect HER2 in serum samples with recoveries that ranged between 96.1 and 114% with RSDs between 1.3 and 5.9%. [ABSTRACT FROM AUTHOR]

A "signal-on" photoelectrochemical (PEC) immunosensor was successfully constructed for determination of human epidermal growth factor receptor 2 (HER2) based on organic–inorganic heterojunction Y6/CdS as photoactive material. Compared with single organic semiconductor, Y6, Y6/CdS exhibited higher photoelectric conversion efficiency due to the formation of heterojunction. In the presence of HER2, sandwich immune structure was formed between HER2 aptamer and anti-HER2 antibody (Ab) by specific recognition. The polydopamine (PDA) nanoparticles were used for signal amplification to enhance photocurrent intensity as PDA can act as electron donor to eliminate holes and promote electron–hole pairs separation. The developed PEC sensor displayed a wide detection range of 5–1000 pg mL−1 and a low detection limit of 2.2 pg mL−1 for HER2 (S/N = 3). The sensor was successfully used for the detection of HER2 in serum with recoveries between 94.8 and 104% and relative standard deviations (RSDs) in the range of 1.2–4.3%. Furthermore, the designed immunosensor possessed good stability, selectivity, and reproducibility, which can find potential clinical applications for disease diagnosis. A "signal-on" photoelectrochemical sensor was reported for human epidermal growth factor receptor 2 detection based on Y6/CdS organic–inorganic heterojunction [ABSTRACT FROM AUTHOR]

B-doped core–shell Fe@BC nanozyme was synthesized. The peroxidase (POD) like activity of Fe@BC nanozyme was studied and utilized for detecting the activity of alanine aminotransferase (ALT). In the presence of ALT as well as ALT co-substrates l-alanine and α-ketoglutarate, l-glutamate is generated. The following catalytic oxidation of l-glutamate by glutamate oxidase leads to the generation of H2O2. The POD-like activity of Fe@BC can oxidize 3,3′,5,5′-tetramethylbenzidine (TMB) to oxTMB in the presence of H2O2, generating a blue-colored compound. Through the detection of the amount of H2O2 generated, ALT activity can be determined through measuring the absorbance intensity variation at 450 nm. The limit of detection of the assay is 4 U/L, with a linear range from 10 to 1000 U/L. For human serum samples, the ALT levels determined by our assay are comparable to those determined by the hospital with a correlation coefficient of 0.991, demonstrating the reliability of our assay results. [ABSTRACT FROM AUTHOR]

A sensitive photoelectrochemical (PEC) sensor based on hexagonal carbon nitride tubes (HCNT) as photoactive material was prepared for the detection of human epidermal growth factor receptor 2 (HER2). Magnetic Fe3O4 nanospheres (MNs) modified with anti-HER2 antibodies were employed for highly efficient capture of HER2 from serum sample, and Co3O4 nanoparticles (Co3O4 NPs) modified with ascorbic acid oxidase (AAO) as well as HER2 aptamer were used for signal amplification. When the aptamer-Co3O4-AAO probe was captured onto the electrode surface through the specific binding of the aptamer with HER2, the photocurrent intensity decreased. This was because Co3O4 NPs competed with HCNT for consumption of the excitation energy. As a consequence AAO catalyzed the oxidation of the electron donor (AA), and the aptamer-Co3O4-AAO probe increased the steric hindrance at the electrode surface, leading to significant photocurrent intensity decrease, thus realizing multiple signal amplification. Based on this signal amplification strategy, at 0 V (vs Ag/AgCl), the PEC sensor shows a wide linear response ranging from 1 pg mL−1 to 1 ng mL−1 with a low detection limit of 0.026 pg mL−1 for HER2. Importantly, the prepared PEC sensor was applied for detection of HER2 in human serum samples with recoveries between 98.8 and 101%. [ABSTRACT FROM AUTHOR]

A sensing platform is presented for the determination of alkaline phosphatase (ALP) activity based on the cooperation of DNAzyme-Au spherical nucleic acid nanoprobe with the graphene-oxide–loaded hybridization chain reaction (HCR/GO) system to achieve good detection sensitivity and specificity. This assay takes advantage of the strong affinity of pyrophosphate (PPi) to Cu2+ ions and the fact that ALP can hydrolyze pyrophosphate (PPi) to release free Cu2+ ions. In the presence of ALP, the released Cu2+ can promote the Cu2+-dependent DNAzyme to cleave the substrate that generates a shorter DNA fragment, which is responsible for further triggering the HCR/GO system to form a long fluorescence dsDNA and thereby giving an amplified fluorescence signal. Linear calibration range was obtained from 0.2 to 10 U L−1, and the limit of detection (LOD) is about 0.14 U L−1. The feasibility of the proposed method was validated by spiking ALP standards in bovine serum. The recovery ranged from 97.2 to 104.6%, and a coefficient of variation (CV) of less than 8% (n = 3) was obtained. This assay strategy was also applied to evaluate the ALP inhibitor efficiency, which indicates that the assay has potential for drug screening. [ABSTRACT FROM AUTHOR]

A ratiometric fluorescence assay was designed for determination of dipicolinic acid (DPA), a spore-specific compound which is used as a biomarker for Bacillus anthracis spores for food and medical product safety analysis. The dual-channel fluorescence probe integrates two fluorescent materials, Eu3+ ion and gold nanocluster (Au NC). The Au NC is used as a reference channel to measure background noise and the Eu3+ ion as the DPA-specific response signal channel. The probe was prepared through simply combing bovine serum albumin (BSA)-scaffolded Eu3+ ion and Au NCs. When excited at 530 nm, in the presence of DPA, the fluorescence signals of Eu3+ ion at 595, 617, and 695 nm increased significantly while the 650 nm signal of Au NC reference remained relatively constant. This fluorescence probe has good photo-stability and also displays good selectivity and high sensitivity for DPA with a low detection limit of 0.8 μM. The linear range of the ratiometric probe for DPA is 1–50 μM. For determination of DPA released during the germination of Bacillus subtilis spores, the detection results were in agreement with measurements by conventional calorimetry assay. The method may have potential for measuring the level of contamination and germination by spores. [ABSTRACT FROM AUTHOR]

A universal strategy was developed for the analysis of circulating tumor cells (CTCs) based on reaction of DNA in the cells with molybdate. Initially, CTCs were enriched and isolated from samples by magnetic nanoparticles. Then, after killing the isolated cells by heat treatment, the cell membrane was raptured, and the DNA molecules contained in the cells were released. The following reaction of the released DNA molecules with molybdate can form redox molybdophosphate, resulting in electrochemical current. This electrochemical assay can be applied to the detection of different CTCs as long as the CTCs can be isolated from the samples, with a universal signal detection method, without additional signal amplification strategies. Breast cancer cell MCF-7 was chosen as a model CTC for this study. At a working potential of 0.2 V vs. Ag/AgCl electrode, the electrochemical current is linearly related to the MCF-7 cell concentration from 5 to 1000 cells mL−1 with a limit of detection of 2 cells mL−1. The assay was successfully applied for detection of MCF-7 in human blood samples. This electrochemical assay can be applied for detection of different CTCs and also for simultaneous detection of CTCs. [ABSTRACT FROM AUTHOR]

Gold nanoparticle (AuNP)–anchored BP nanosheets were synthesized through in situ growth of AuNPs onto BP. Due to the strong chelating ability of P or phosphorus oxides with AuNPs, the stability of BP is improved. As proof-of-concept demonstration of the functionalized BP, electrochemical detection of circulating tumor cells (CTCs) based on BP@AuNPs@aptamer as a probe combined with immunomagnetic separation is reported. The aptamer can specifically bind with CTCs, while the phosphorus oxides including phosphite ion and phosphate ion (PxOy species) on BP and aptamer can react with molybdate to generate an electrochemical current, leading to dual signal amplification. The biosensor is applied to MCF-7 cell detection and displays good analytical performance with a detection limit of 2 cell mL−1. Furthermore, the practicality of this biosensor was validated through sensitive determination of MCF-7 cells in human blood. Therefore, the reported biosensor could be applied to detect other biomarkers, offering an ultrasensitive strategy for clinical diagnostics. [ABSTRACT FROM AUTHOR]

A fluorescence off-on sensing platform was developed based on thioglycolic acid-stabilized cadmium sulfide quantum dots (CdS QDs) as fluorescence probe for the sensitive and selective detection of 2,6-pyridinedicarboxylic acid (DPA) in spores. The fluorescence emission intensity of the quantum dots at 650 nm when excited at 460 nm was first quenched by mixing with europium ions (Eu3+) and then recovered after the addition of DPA. The interaction of DPA with Eu3+ relieved the quenching effect of Eu3+ toward CdS QDs. As the DPA concentration increases, the color of the probe changes from colorless to red. The method exhibits a wide linear range from 1 to 120 μM for DPA determination, with a detection limit of 0.2 μM. The CdS QDs based nanoprobe was successfully applied for sensitive determination of DPA released from bacteria spores. In this case, the detection limit is 3.5 × 104 CFU·mL−1. [ABSTRACT FROM AUTHOR]

In this work, an aptamer-based photoelectrochemical (PEC) assay is reported for the determination of MCF-7 breast cancer cells using hexagonal carbon nitride tubes (HCNTs) as photoactive material. The aptamer immobilized on the HCNT surface can specifically bind with mucin 1 protein (MUC1) that is overexpressed on the surface of MCF-7 cell. Thus, the PEC assay has high specificity for the determination of MCF-7. The determination of MCF-7 is due to the binding of MCF-7 onto HCNT that suppressed the photocurrent intensity. The PEC assay displays good performances for MCF-7 determination with a linear range from 1 × 102 to 1 × 105 cell mL−1 and limit of detection down to 17 cells mL−1. Meanwhile, the PEC assay can distinguish MCF-7 from normal cells in blood samples, which may have potential applications in cancer diagnostics and therapeutics. [ABSTRACT FROM AUTHOR]

Electrochemical assay for analysis of cell surface glycan expression is reported. Mannose on human breast cancer cells (type MCF-7) is selected as the glycan model. Gold nanoparticles are modified with binding aptamer for MCF-7 cells and act as electrochemical probe. The analysis of cell surface glycan expression follows a traditional sandwich protocol. Concanavalin A that can specifically recognize mannose is immobilized onto MnO2 nanosheets modified electrode for the capture of MCF-7 cells. Then, the modified gold nanoparticles are immobilized onto the electrode via the binding between MCF-7 cell and aptamer on the gold nanoparticles. The aptamer on the gold nanoparticles reacts with molybdate. More specifically, the reaction of the phosphate backbone of aptamer with molybdate results in the formation of a redox-active molybdophosphate precipitate and generates an electrochemical current. The current intensity at 0.20 V (vs. Ag/AgCl) is recorded to test the linear range of the assay. The assay shows an obvious response to MCF-7 cells with a wide linear range from 1.0 × 103 to 1.0 × 106 cells mL−1 and a limit of detection down to 300 cells mL−1. The assay can be used to selectively monitor the change of mannose expression on cell surfaces upon the treatment with the N-glycan inhibitor. [ABSTRACT FROM AUTHOR]

A porous carbon nitride (PCN) modified with cobalt phosphides (CoP) was synthesized. In this nanocomposite, the CoP (in different weight fractions) serves (a) as the electron acceptor to accelerate the photoinduced charge separation, and (b) as the photosensitizer to increase the photoelectrochemical (PEC) response to visible light. Dissolved oxygen acts as the electron acceptor to generate PEC current. If glucose oxidase (GOx) catalyzes the oxidation of glucose, dissolved oxygen is consumed. This leads to the suppression of photocurrent. The photocathode biosensor has a linear response in the 0.05 to 0.7 mM glucose concentration range and a 1.1 μM limit of detection. [ABSTRACT FROM AUTHOR]

A highly sensitive electrochemical scheme for the detection of the cancer biomarker carcinoembryonic antigen (CEA) is reported. An aptamer-based formation of redox-active molybdophosphate is combined with rolling circle amplification (RCA). Gold nanoparticles (AuNPs) were utilized as supporting matrix for the aptamer and the primer to increase the primer/aptamer loading. The formation of a sandwich structure of anti-CEA/CEA/AuNP − aptamer-primer onto a glassy carbon electrode surface enabled an effective RCA reaction. Square wave voltammetry was applied to record the current signal at a peak potential of 0.18 V vs. Ag/AgCl. Compared to the immunosensor without RCA, the sensitivity of the immunosensor with RCA is increased by about a factor of 6. In the latter case, a wider linear range was obtained for the determination of CEA (from 0.5 pg mL to 1 ng mL) with a detection limit as low as 0.1 pg mL. The practical applicability of the method was studied by analyzing CEA in human serum samples. The results were found to be in good agreement with those obtained by a reference method. Conceivably, the method can be applied to other DNA amplifications and therefore has the potential of finding wide applications. [ABSTRACT FROM AUTHOR]

The authors describe a dual signal amplification strategy for improving the sensitivity of electrochemical aptasensor. Hydroxyapatite nanoparticles (HAP-NPs) serve as the support for deposition of the respective aptamer. Both the HAP-NPs and the aptamer contain phosphate groups which can react with molybdate to form a redox-active molybdophosphate precipitate on the surface of a glassy carbon electrode (GCE). On applying a relatively low voltage of 0.21 V (vs. Ag/AgCl), a current is generated whose intensity depends on the concentration of the analyte. The cancer biomarker platelet-derived growth factor BB (PDGF-BB) is chosen as a model antigen (analyte). The assay works by sequential deposition of antibody against PDGF-BB, analyte (PDGF-BB) and anti-PDGF-BB aptamer modified HAP-NPs on the GCE to form a sandwich structure. The amperometric signal is linear in the 0.1 pg.mL to 10 ng.mL PDGF-BB concentration range, with a detection limit as low as 50 fg.mL. The assay was successfully applied to the determination of PDGF-BB in serum samples. In our perception, this signal amplification strategy has a wide scope in that it can be adapted to the preparation of other aptasensors for biomarkers and related species. [ABSTRACT FROM AUTHOR]

The authors describe a method for signal amplification in electrochemical aptasensors. It is based on the induction of an increased electrochemical current by the aptamer captured on a glassy carbon electrode (GCE). The phosphate groups on the aptamer backbone are brought to reaction with added molybdate to form a redox-active molybdophosphate precipitate on the surface of the GCE that generates a strong electrochemical current. To further enhance sensitivity, gold nanorods (GNRs) were selected as a support for the immobilization of aptamers. The aptasensor was applied to the determination of the cancer biomarker carcinoembryonic antigen (CEA) in a sandwich format. Antibody against CEA, CEA (antigen) and GNRs modified with CEA aptamer were sequentially captured on the GCE. The resulting aptasensor, best operated at a voltage as low as 0.18 V vs. Ag/AgCl, is highly sensitive and has a wide linear range that extends from 0.1 pg·mL to 10 ng·mL of CEA. This amplification strategy uses an aptamer as both the recognition probe and signal probe and therefore simplifies signal transduction. Conceivably, this detection scheme may be adapted to numerous other electrochemical bioassays if respective antibodies and aptamers are available. [ABSTRACT FROM AUTHOR]

The paper describes a colorimetric sandwich enzyme-linked immunosorbent assay (ELISA) for the determination of human IgG. It is based on the use of an Fe(II) coordination complex as a signal amplifier and of mesoporous silica nanoparticles modified with glucose oxidase (GOx) and secondary antibodies (Ab). After formation of the immuno sandwich complex, the quantity of GOx is proportional to the quantity of IgG. On addition of Fe(II) and glucose, GOx catalyzes the oxidation of glucose to produce hydrogen peroxide which oxidizes Fe(II) to Fe(III). After adding a stop solution containing the complexing ligand 1,10-phenanthroline (Phen), un-reacted Fe(II) forms an orange-red complex with Phen which can be detected by plate reader and even seen with bare eyes. This sandwich ELISA has a linear response in the 1 pg.mL to 100 ng.mL human IgG concentration range and a 860 fg.mL detection limit. This is 20 times lower than the commercial ELISA for human IgG. The assay also is selective, stable, highly sensitive and cost-effective. [ABSTRACT FROM AUTHOR]

The authors describe a fluorometric assay for determination of the activity and inhibition of alkaline phosphatase (ALP). It is based on the use of silver nanoclusters (AgNCs) templated with dC strands and acting as a fluorescent probe. The fluorescence of such AgNCs is initially quenched by the addition of Cu(II) in low concentration, and then recovered by the subsequent addition of pyrophosphate (PPi) due to strong binding between PPi and Cu(II). In the presence of ALP, PPi will be hydrolyzed to form phosphate ion (Pi), and this decreases the concentration of bound Cu(II). As a result, the fluorescence of AgNCs is diminished again. The decrease in fluorescence intensity is proportional to the actual activity of ALP. The assay has a detection limit as low as 0.078 mU·mL. The method was applied to the determination of ALP activity in spiked human serum and gave recoveries that ranged from 96.2% to 105.9%. The inhibitory effect of L-phenylalanine on the activity of ALP was also evaluated. The assay is simple and inexpensive. In our perception, it simplifies clinical measurement, thereby improving the diagnosis of ALP-associated diseases and improving the screening for new drugs. [ABSTRACT FROM AUTHOR]

The authors describe a strategy for improving the sensitivity of electrochemical immunoassays that is based on the use of hydroxyapatite nanoparticles (HAP-NPs). Signal generation is based on the reaction of phosphate groups present in HAP-NPs with molybdate to form a redox-active molybdophosphate precipitate on the surface of the electrode that facilitates the generation of an electrochemical current. The cancer biomarker α-fetoprotein (AFP) was chosen as a model antigen (analyte). Antibodies against AFP (Ab) were immobilized on the HAP-NPs to obtain the signal probe. The reaction of HAP-NPs with molybdate and the performance of the immunoelectrode were characterized in detail. Based on this signal amplification approach, an immunoassay was worked out that has a linear range that extends from 0.1 pg·mL to 1 ng·mL and a detection limit as low as 50 fg·mL. The assay was successfully applied to the determination of AFP in serum samples. In our perception, this new signal amplification scheme can be adapted to numerous other immunoassays. [ABSTRACT FROM AUTHOR]

The authors describe a method for highly sensitive and selective determination of the activity of protein kinase (PKA). It is based on the finding that silver nanoclusters (AgNCs) can act as a nucleus to catalyze further deposition of silver nanoparticles. This causes the color of a solution to change from pale yellow to black. In the detection scheme presented here, the substrate peptide is phosphorylated by PKA in the presence of ATP. The resulting phosphopeptides bind to oligonucleotide-stabilized AgNCs in the presence of Zr(IV) ions due to electrostatic interactions between Zr(IV) and the phosphate groups, thereby capping the AgNCs. The silver enhancement process (leading to a color change to black) does not work if the AgNCs are capped. The degree of inhibition is proportional to the activity of the kinase. The color change can be detected visually or photographically in a microplate format by exploiting the changes in the grey values of the digital photos. In addition, the DNA-AgNCs display fluorescence emission at 635 nm when excited at 565 nm. Electrochemical assays were performed (at a working voltage as low as 38 mV vs. Ag/AgCl) by using a glassy carbon electrode modified with a solution containing AgNCs, Zr(IV) ions and the peptide, and immersing it into the silver enhancement solution. The assay is highly sensitive and selective. It was applied to the determination of PKA in lysates of HeLa cells. The detection limits typically are between 32 and 37 U⋅ L based on a signal-to-noise ratio of 3. [ABSTRACT FROM AUTHOR]

Copper nanoclusters (Cu-NCs) were prepared by reducing CuCl with ascorbic acid in the presence of the short peptide template Cys-Cys-Cys-Asp-Leu. They were characterized by UV-vis absorption and fluorescence spectroscopy, transmission electron microscopy and X-ray photoelectron spectroscopy. The Cu-NCs have a size of ~2 nm, can be well dispersed in water and are photostable. Their fluorescence (peaking at 425 nm under 365-nm excitation) is quenched by Fe(III) ions. Based on this finding, a sensitive and selective fluorescence assay for the detection of Fe(III) was developed. Under optimized conditions and a pH value of 2.0, the assay displays a linear response in the 0.05 to 30 μM Fe(III) concentration range, with a detection limit of 20 nM based on an S/N ratio of 3. The assay was successfully applied to the determination of Fe(III) in spiked human serum where is gave recoveries that ranged from 96.2 % to 98.3 %. [ABSTRACT FROM AUTHOR]

The fluorescence intensity of gold nanoclusters (AuNCs) is inversely related to the length of a peptide immobilized on its surface. This finding has been exploited to design a turn-on fluorescent method for the determination of the activity of peptidase. The β-site amyloid precursor protein-cleaving enzyme 1 (BACE1) was chosen as a model peptidase. BACE1 cleaves the peptide substrates on AuNCs, and the fluorescence intensity of the AuNCs (at exCitation/emission wavelengths of 320/405 nm) carrying the rest of the cleaved peptide is significantly higher than that of the AuNCs with uncleaved peptide. Transmission electron microscopy revealed a decrease in the size of the AuNCs which is assumed cause fluorescence enhancement. The assay was applied to the determination of BACE1 activity in spiked cell lysates, and recoveries were between 96.9 and 104.0 %. [Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is overexpressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface. [Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

We report that the fluorescence of carbon dots (C-dots) in water is quenched by the addition of Cu ions, and that the subsequent addition of pyrophosphate (PPi) restores fluorescence. This is likely to be due to the coordination of Cu by PPi. This effect forms the basis for a method to determine the activity and inhibition of the enzyme alkaline phosphatase (ALP). If ALP is added to a system composed of C-dots, Cu and PPi, fluorescence will decrease over time because ALP catalyzes the hydrolysis of PPi to form orthophosphate (Pi). This results in a release of the quencher Cu. The decrease in fluorescence is related to the activity of ALP. The method is simple and displays good sensitivity (with a limit of detection of 1 units per L) and selectivity. The method was successfully applied to the determination of ALP in serum samples. We also have studied the inhibitory effect of Pi on the activity of ALP. We presume that this method holds a large potential in terms of diagnosis of ALP-related diseases, to evaluate the function of ALP in biological systems and in screening for potential inhibitors of ALP. [Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

We have developed a sensitive fluorescence assay for the protein biomarker mucin 1 (MUC1). It is based on the aggregation of functionalized carbon dots (CDs) in the presence of MUC1. The CDs with a size of ~2 nm display strong blue-green intrinsic fluorescence. Antibodies against MUC1 and the MUC1 aptamer were covalently conjugated to the CDs, and the immunoreaction between CD-labeled antibody to MUC1, and of the CD-labeled aptamer to MUC1 resulted in the formation of a sandwich structure that is accompanied by aggregation of CDs and quenching of fluorescence. The change in fluorescence is linearly related to the MUC1 concentration in the 5 to 100 nM range, with a detection limit at 2 nM. The assay was applied to the determination of MUC1 in (spiked) real serum samples, and good recoveries (ranging from 94.2 to 98.1 %) were obtained. This assay is cost-effective and convenient. It has a wide scope in that it, conceivably, can be extended to assays for other proteins and biomarkers of clinical interest. [Figure not available: see fulltext.] [ABSTRACT FROM AUTHOR]

Prussian Blue nanoparticles were deposited on g-C3N4 nanosheets. The resulting nanocomposite possesses peroxidase-like (POx) activity and can catalyze the oxidation of 3,3′,5,5′-tetramethylbenzidine at room temperature in the presence of H2O2. This leads to formation of a blue product with an absorption maximum at 650 nm. The formation of the Prussian Blue nanoparticles on the g-C3N4 nanosheets, and the POx-like activity of the composite were characterized in detail. The POx mimic was used for determination of L-lactic acid via detection of H2O2 that is produced by the enzyme lactate oxidase (LOx). The assay has a linear range that extends from 5 to 100 μM, and the detection limit is 2.2 μM. The method was successfully applied to the determination of L-lactic acid in spiked human serum. [ABSTRACT FROM AUTHOR]

Electrochemical sensing of L-ascorbic acid (AA) is reported based on the use of a redox-active molybdophosphate film on a glassy carbon electrode (GCE). Molybdophosphate is formed by reacting hydroxyapatite nanoparticles with sodium molybdate. The modified GCE can be utilized for detection of AA, typically at a working potential of 0.4 V (vs. Ag/AgCl). The GCE has a decreased overpotential and enhanced sensitivity (219 μA·mM−1·cm−2). Response is linear in the 1 μM to 1.5 mM AA concentration range, and the limit of detection is 4 nM. The selectivity of this sensor makes it a useful tool for accurate determination of AA in practical samples as shown for a vitamin C tablet and for spiked beverages. [ABSTRACT FROM AUTHOR]

Interleukin-2 receptor alpha chain (also called CD25) is a tumor biomarker that is frequently expressed on the surface of hematological tumor cells. The authors describe an electrochemical immunoassay for CD25 that involves (a) enrichment of CD25 from samples by using magnetic nanospheres, and (b) utilization of DNA modulated current as the detection signal. Primary anti-CD25 antibody was immobilized onto F3O4 magnetic nanospheres to capture CD25 from samples. A polycytosine DNA sequence (dC20) was conjugated to the secondary antibody through glutaric dialdehyde via the amino groups on both antibody and the end of the DNA sequence. This leads to the formation of a sandwich structure on the magnetic spheres. dC20 is then reacted with molybdate to form redox molybdophosphate and generate electrochemical current (best measured at 0.2 V vs. Ag/AgCl) that is proportional to the concentration of CD25. The method is sensitive, selective, and has a wide linear response that extends from 1 pg.mL−1 to 1 ng.mL−1. The immunoassay was applied in a recovery test for CD25 in spiked serum samples. [ABSTRACT FROM AUTHOR]

The authors report a sensitive electrochemical aptamer-based assay for the cancer biomarker human epidermal growth factor receptor-2 (HER2). It is based on the use of MnO2 nanosheets that were functionalized with phosphate and a HER2 binding aptamer and serve as the electrochemical probe. The assay follows a sandwich protocol. A peptide that can specifically recognize HER2 was immobilized on a gold electrode for the capture of HER2. Then, the functionalized MnO2 nanosheets were linked to the electrode via the binding between HER2 and HER2 aptamer on the MnO2 nanosheets. The reaction of phosphate and aptamer on the MnO2 nanosheets with molybdate leads to the formation of redox-active molybdophosphate. This results in dual signal amplification. The generated electrochemical current was measured at 0.22 V (vs. Ag/AgCl). The assay allows HER2 to be determined in the 0.1 to 500 pg·mL−1 concentration range, and the detection limit is as low as 0.05 pg·mL−1. The assay was successfully applied for the detection of HER2 in spiked human serum samples. [ABSTRACT FROM AUTHOR]

Hierarchical Co3O4@NiMoO4 core-shell nanowires (NWs) were synthesized utilizing a two-step hydrothermal method. The NWs show a high chemiresistive response (at a temperature of 255 °C) to xylene, with an Rgas/Rair ratio of 24.6 at 100 ppm xylene, while the response towards toluene, benzene, ethanol, and acetone, CO, H2S and NO2 is much weaker. In contrast, pure Co3O4 nanowires exhibit weak responses to all the vapors/gases and poor selectivity. The new NW sensor displays an almost linear response (1–100 ppm) to xylene and a lower detection limit of 424 ppb. The remarkable gas sensing characteristics are attributed to the synergistic catalytic effect and the formation of a heterostructure between Co3O4 and NiMoO4. Graphical abstract Schematic presentation of a xylene vapor chemiresistive sensor based on Co3O4@NiMoO4 core-shell nanowires. The Co3O4@NiMoO4 core-shell nanowires-based sensor exhibits a high response (24.6) to 100 ppm xylene at 255 °C and high response/recovery speed (13–15 and 25–29 s). [ABSTRACT FROM AUTHOR]

A series of dual-emission fluorescent probes was prepared from copper nanoclusters (Cu NCs) and carbon dots (CDs). They show two emission peaks (blue at 469 nm and red at 622 nm) when photoexcited at 365 nm. Upon exposure to sulfide, the Cu NCs will be deteriorated because they react with sulfide to form CuS. This results in the quenching of the red fluorescence of the Cu NCs, while the blue fluorescence of the CDs remains constant. Thus, the color of the nanocomposite changes from red to blue. The ratio of the fluorescences at the two wavelengths decreases linearly in the 2–10 ppb (26–128 nM) sulfide concentration range, and the limit of detection is 0.33 ppb (4.3 nM). The nanocomposite also was placed in an agar gel and then incorporated into a paper strip for fluorometric monitoring of gaseous hydrogen sulfide. Graphical abstract Schematic presentation of the synthesis of Cu NCs (copper nanoclusters)-CDs (carbon dots) dual-emission nano-assembly, Cu NCs-CDs-agar fluorescent film and their application for the detection of sulfide and H2S. [ABSTRACT FROM AUTHOR]

This study reports on a simple approach for the fabrication of an electrode modified with biocompatible C-dot wrapped ZnO nanoparticles for selective photoelectrochemical monitoring of H2O2 released from living cells. The biocompatibility of the ZnO nanoparticles was confirmed through in-vitro cellular testing using the MTT assay on Huh7 cell lines. The ZnO nanoparticles wrapped with dopamine-derived C-dots possess numerous catalytically active sites, excessive surface defects, good electrical conductivity, and efficient separation ability of photo-induced electrons and holes. These properties offer highly sensitive and selective non-enzymatic photo-electrochemical monitoring of H2O2 released from HeLa cells after stimulation with N-formylmethionyl-leucyl-phenylalanine. The sensor has a wide linear range (20-800 nM), low detection limit (2.4 nM), and reliable reproducibility, this implying its suitability for biological and biomedical applications.Schematic of the fabrication of ZnO nanoparticles by using a plant extract as a reducing agent. Wrapping of ZnO with C-dots enhances the photoelectrocatalytic efficacy. Sensitive and selective photoelectrochemical monitoring of H2O2 released from cancer cells is demonstrated. [ABSTRACT FROM AUTHOR]

An ultrasensitive electrochemical sensor is described for the determination of the activity of telomerase. It is based on a DNA-generated current that is due to the reaction of the phosphate groups on DNA with molybdate to form a redox-active molybdophosphate. A telomerase substrate primer was first immobilized on a gold electrode. In the presence of telomerase and deoxyribonucleoside triphosphates (dNTPs), the primer can be extended with repetitive nucleotide sequences (TTAGGG). The subsequent reaction of the sensor with molybdate results in the enhancement of electrochemical current intensity due to an increased amount of nucleotides on the electrode. Sensitivity can be further improved by introducing a hairpin probe that partially hybridizes with the repetitive TTAGGG sequence and further enhances the amount of DNA on the electrode. The biosensor, best operated at 0.2 V (vs. Ag/AgCl) shows a linear response to telomerase activity from 1×102 to 107 Hela cells mL−1. The assay was applied to the detection of telomerase activity in HeLa cancer cells treated with the anticancer drug epigallocatechin gallate, and the results indicate that it holds great potential in anticancer drug screening.Schematic presentation of an ultrasensitive electrochemical sensor for the determination of telomerase activity based on DNA generated electrochemical current. dNTPs in the scheme represents deoxyribonucleoside triphosphates. [ABSTRACT FROM AUTHOR]

The intrinsic peroxidase-like activity of hollow Prussian Blue nanoparticle-loaded with gold nanoparticles (Au@HMPB NPs) were applied to oxidize the substrate 3,3′,5,5′-tetramethylbenzidine (TMB) in the presence of H2O2 to give a blue-green coloration. The morphology of the Au@HMPB NPs and its peroxidase-mimicking activity was characterized in detail. The catalytic activity follows Michaelis-Menten kinetics and is higher than that of HMPB NPs not loaded with gold nanoparticles. The NPs were employed to detect L-lactic acid colorimetrically (at 450 nm) via detection of H2O2 that is generated during enzymatic oxidation by L-lactate oxidase (LOx). The limit of detection is 4.2 μM. The assay was successfully applied to the quantitation of L-lactic acid in spiker human serum samples.Gold nanoparticle-loaded hollow Prussian Blue nanoparticles (Au@HMPB NPs) with peroxidase-like catalytic activity can oxidize the substrate 3,3′,5,5′-tetramethylbenzidine (TMB) in the presence of H2O2. The nanoparticles were applied for the detection of L-lactic acid through detection of H2O2 that is generated by L-lactate oxidase (LOx) catalyzed oxidation of L-lactic acid. [ABSTRACT FROM AUTHOR]

Both pure and Mn(II)-doped ZnO hollow structures were synthesized by a solvothermal reaction, and their phase structures, morphologies and elemental composition were characterized. SEM and TEM observations show the pure ZnO and the Mn(II)-doped ZnO balls to possess similar hollow structure with a particle size of about 1.5 μm. Their sensing properties were investigated, and the composite containing 1 atom% of Mn(II) (1% Mn-ZnO) is found be display the highest selectivity for acetone. The detection limit is 100 ppm acetone at 234 °C which is 4.6 times lower than that of the pure ZnO. In addition, the response time is shorter.ZnO and Mn-doped ZnO hollow balls were prepared by a hydrothermal method, and their gas-sensing properties were investigated. Zinc(II) oxide doped with 1 atom% Mn(II) demonstrated an outstanding sensing behavior towards acetone vapors. [ABSTRACT FROM AUTHOR]

The authors describe an adapted rolling circle amplification (RCA) method for the determination of human epidermal growth factor receptor 2 (HER2). This method (which is termed immunoRCA) combines an immunoreaction with DNA based signal amplification. Gold nanoparticles (AuNPs) were loaded with antibodies against HER2 and DNA, and then fulfill the functions of recognizing HER2 and achieving signal amplification. The DNA serves as a primer to trigger RCA. This results in formation of a long DNA containing hundreds of copies of circular DNA sequence on the electrode surface. Then, molybdate is added which reacts with the phosphate group of the long DNA to generate the redox-active molybdophosphate. This, in turn, results in an increased current and, thus, in strongly increased sensitivity of the immunoassay. A linear response is linear relationship between the change of current intensity and the logarithm of the concentration in the range from 1 to 200 pg·mL−1 of HER2, and the detection limit is 90 fg·mL−1 (at an S/N ratio of 3). The method was applied to the determination of HER2 in breast cancer patients serum samples, and the results correlated well with those obtained by an ELISA. The method was further successfully applied to the determination of HER2 in HER2-expressed mouse breast cancer 4 T1 cells. Conceivably, this strategy may be adapted to other DNA amplification methods and also may be used for the determination of other proteins and biomarkers by using the appropriate antibodies.Schematic presentation of an adapted rolling circle amplification (RCA) strategy for the electrochemical detection of human epidermal growth factor receptor 2 (HER2), termed "immunoRCA" utilizing gold nanoparticles (AuNPs). Ab stands for antibody, Phi29 is an E.coli DNA polymerase, dNTP represents deoxynucleotides, and SWV stands for square wave voltammetry. [ABSTRACT FROM AUTHOR]

The authors describe a sensitive electrochemical immunoassay for the cancer biomarker α-fetoprotein (AFP). It is based on a combination of an immunoassay with DNA-based signal amplification. Two-dimensional MnO2 nanosheets modified with gold nanoclusters (AuNC-MnO2) were synthesized through one-pot process and utilized as an electrochemical probe. Bovine serum albumin served as templating agent to guide the formation and assembly of the modified sheets. The detection antibody against AFP and a polycytosine DNA sequence (dC20) were immobilized onto the modified nanosheets. The electrochemical assay follows the usual sandwich protocol. The antibodies on the nanosheets then bind to AFP, while dC20 causes signal amplification. The reaction of the phosphate backbone of dC20 with molybdate leads to the formation of redox-active molybdophosphate which generates an electrochemical current, typically measured at 0.20 V (vs. Ag/AgCl). The method allows AFP to be determined in the 0.01 to 10 ng·mL−1 concentration range, and the detection limit is as low as 5 pg·mL−1. This strategy overcomes the drawbacks of conventional immunoassays whose sensitivity is often limited because many immunoassays are rather difficult to amplify. The method has a wide scope in that various other DNA signal amplification methods such as rolling circle amplification and hybridization chain reactions may also be applied.Schematic of an electrochemical immunosensor for the detection of alpha fetoprotein (AFP) by combining an antibody based immunoassay with DNA based signal amplification utilizing gold clusters anchored 2D MnO2 (Au NCs-MnO2) nanosheets as electrochemical probe. [ABSTRACT FROM AUTHOR]

Fluorescent hydroxyapatite nanoparticles (HAP-NPs) were prepared by reacting calcium ion with phosphate in the presence of Eu(III) ion. The HAP-NPs display large Stokes’ shift and two strong fluorescence emissions with peaks at 590 nm and 615 nm when excited at 250 nm. The HAP-NPs also have good photostability and water solubility. The HAP-NPs combined with Cu(II) were applied to fluorometric determination of cysteine and homocysteine in biological samples and in living cells. In this detection scheme, the fluorescence of HAP-NPs is initially quenched by Cu(II). The addition of biothiols results in the formation of Cu(II)-thiol complexes and leads to fluorescence recovery. The assay allows cysteine to be detected with a 110 nM detection limit, and homocysteine with a 160 nM detection limit. The assay was successfully applied to the analysis of cysteine in spiked human serum samples and to imaging of cysteine in HeLa cells, and this demonstrates its potential for clinical testing and in biomedical research.Fluorescent hydroxyapatite nanoparticles were synthesized and combined with Cu2+ for fluorescence sensing of biothiols (cysteine and homocysteine) in complex biological samples and in living cells. [ABSTRACT FROM AUTHOR]