Search

Hyperproteinemia is a metabolic disorder associated with increased plasma protein concentration (PPC). It is often clinically complicated by malignant diseases or severe infections. Research on the molecular mechanism of High PPC (HPPC) is scant. Here, an animal model of primary hyperproteinemia was constructed in an invertebrate, Bombyx mori, to investigate the effect of HPPC on circulating blood cells. We showed that HPPC affected blood cell homeostasis and enhanced blood cell phagocytosis, leading to increased reactive oxygen species levels, and induced programmed cell death that depended on the endoplasmic reticulum-calcium ion signaling pathway. HPPC induced the proliferation of blood cells, mainly granulocytes, by activating the JAK/STAT signaling pathway. Supplementation with endocrine hormone active substance 20E significantly reduced the impact of HPPC on blood cell homeostasis. Herein, we reported a novel signaling pathway by which HPPC affected blood cell homeostasis, which was different from hyperglycemia, hyperlipidemia, and hypercholesterolemia. In addition, we showed that down-regulation of gene expression of the hematopoietic factor Gcm could be used as a potential early monitoring index for hyperproteinemia.Highlights•HPPC induced proliferation of circulating blood cells through the JAK/STAT pathway, leading to a significant increase in the proportion of granulocytes.•Supplementing endocrine hormone 20E improved hematopoietic function and restored the homeostasis of circulating blood cells through modulation of the JAK/STAT signaling pathway.•HPPC induced PCD in blood cells through the endoplasmic reticulum-calcium ion release signaling pathway.•Down-regulation of the gene expression of the hematopoietic factor Gcm could be used as a potential early monitoring index for hyperproteinemia.

The circadian clock plays a critical role in the regulation of host immune defense. However, the mechanistic basis for this regulation is largely unknown. Herein, the core clock gene cryptochrome1 (cry1) knockout line in Bombyx mori, an invertebrate animal model, was constructed to obtain the silkworm with dysfunctional molecular clock, and the dynamic regulation of the circadian clock on the immune responsiveness within 24 h of Staphylococcus aureus infection was analyzed. We found that deletion of cry1 decreased viability of silkworms and significantly reduced resistance of larvae to S. aureus. Time series RNA-seq analysis identified thousands of rhythmically expressed genes, including immune response genes, in the larval immune tissue, fat bodies. Uninfected cry1 knockout silkworms exhibited expression patterns of rhythmically expressed genes similar to wild-type (WT) silkworms infected with S. aureus. However, cry1 knockout silkworms exhibited a seriously weakened response to S. aureus infection. The immune response peaked at 6 and 24 h after infection, during which "transcription storms" occurred, and the expression levels of the immune response genes, PGRP and antimicrobial peptides (AMPs), were significantly upregulated in WT. In contrast, cry1 knockout did not effectively activate Toll, Imd, or NF-κB signaling pathways during the immune adjustment period from 12 to 18 h after infection, resulting in failure to initiate the immune responsiveness peak at 24 h after infection. This may be related to inhibited silkworm fat body energy metabolism. These results demonstrated the dynamic regulation of circadian clock on silkworm immune response to bacterial infection and provided important insights into host antimicrobial defense mechanisms.

Bombyx mori silk is a super-long natural protein fiber with a unique structure and excellent performance. Innovative silk structures with high performance are in great demand, thus resulting in an industrial bottleneck. Herein, a transgenic method was used in which the outer layer sericin SER3 in silk is secreted into the inner fibroin layer, thus generating a new structural fiber with non-fibrous sericin microsomes dispersed in fibroin fibrils. The water-soluble SER3 protein secreted by the posterior silk gland causes P25’s detachment from the fibroin unit of the Fib-H/Fib-L/P25 polymer and accumulation on the fibroin surface. Moreover, the water solubility and stability of the fibroin-colloid in the silk glandular cavity are increased, thus significantly improving the β-sheet content of fibroin, as well as the mechanical properties, moisture absorption and moisture liberation of the silk fiber. Our silkworm mutant system circumvents the problems of low vitality and abnormal silk gland development, and enables higher production efficiency of cocoon silk than that of the wild type. We describe a silk gland transgenic target protein selection strategy to alter the ancient silk fiber structure and to innovate the properties of silk protein materials. This study thus provides an efficient, green method to produce new silk fibers.

Acetaminophen (APAP) is an effective and widely used analgesic. However, APAP overdose is the principal cause of acute liver failure (ALF) in many countries. Here, we report the phenomenon of liver melanization which occurred before APAP-induced ALF in mice. A melanic surface induced by APAP which was time- and dose-dependent in the silkworm invertebrate model was observed. In addition, an APAP-induced acute tissue failure model (ATF) was established using a metabolic detoxification tissue fat body which simulated mouse liver. An investigation of the anabolic mechanism of melanin in experimental animals showed that dopaquinone and dopamine which were synthesized from tyrosine via dopa in silkworms were further metabolized to melanin, while in mice, epinephrine was synthesized via the dopamine branch and melanin was only synthesized via the dopaquinone branch. On this basis, it is proposed that melanin-metabolic levels in plasma could be used as an early diagnostic marker of APAP overdose and the black spots on insect epidermis could be used as a fast detection model of toxicity.

Biological modifications of the silk fibroin (silk) material have broad applications in textiles, biomedical materials and other industrial materials. It is economical to incorporate nanoparticles to the biosynthesis of silk fibroin by adding them to silkworm larval diets. This strategy may result in the rapid stable production of modified silk. Glucose-coated silver nanoparticles (AgNPs) were used to improve the AgNPs' biocompatibility, and the AgNPs were efficiently incorporated into silk by feeding. Larvae fed with AgNPs produced silk with significantly improved antibacterial properties and altered silk secondary structures. Both positive and negative effects on the growth and synthesis of silk proteins were observed after different AgNPs doses. Larvae feeding with low concentration of 0.02% and medium 0.20% AgNPs have greater transfer efficiencies of AgNPs to silk compared with feeding high concentration of 2.00% AgNPs. In addition, the elongation and tensile strength of the produced silk fibers were also significantly increased, with greater mammalian cell compatibility. The appropriate AgNPs concentration in the diet of silkworms can promote the synthesis of silk proteins, enhance their mechanical properties, improve their antibacterial property and inhibit the presence of Gram-negative bacteria.

Hyperproteinemia is a severe metabolic disease characterized by abnormally elevated plasma protein concentrations (PPC). However, there is currently no reliable animal model for PPC, and the pathological mechanism of hyperproteinemia thus remains unclear. In this study, we evaluated the effects of hyperproteinemia on reproductive development in an invertebrate silkworm model with a controllable PPC and no primary disease effects. High PPC inhibited the synthesis of vitellogenin and 30K protein essential for female ovarian development in the fat body of metabolic tissues, and inhibited their transport through the hemolymph to the ovary. High PPC also induced programmed cell death in testis and ovary cells, slowed the development of germ cells, and significantly reduced the reproductive coefficient. Furthermore, the intensities and mechanisms of high-PPC-induced reproductive toxicity differed between sexes in this silkworm model.

Vitamin C (VC) is an essential nutrient for many animals. However, whether insects, including Bombyx mori, can synthesize VC remains unclear. In this article, the optimized HPLC method was used to determine the content of l-ascorbic acid (AsA) in silkworm eggs, larvae and pupae, and the activity of l-gulono-1,4-lactone oxidase (GULO), a key enzyme in VC synthesis. The RNA interference method was used to determine the effect of the BmGulo-like gene on embryonic development and GULO activity in the pupal fat body. The AsA content increased significantly during E144 h-E168 h in the late embryonic stage and P48 h-P144 h in the middle-late pupal stage, in which exogenous VC was not ingested. Furthermore, the body AsA content in larvae fed VC-free feed also increased with larval stage. The GULO enzymatic activity was present in eggs and the fat bodies of larvae and pupae, even when the larvae were reared with fresh mulberry leaves. Moreover, the activity was higher in the later embryonic stages (E144 h-E168 h) and the early pupal stage (before P24 h). The GULO activity in the pupal fat body dramatically decreased when the screened BmGulo-like gene (BGIBMGA005735) was knocked down with small interfering RNA; in addition, the survival rate and hatching rate of eggs significantly decreased 21% and 44%, respectively, and embryonic development was delayed. Thus, Bombyx mori can synthesize AsA through the l-gulose pathway, albeit with low activity, and this synthesis ability varies with developmental stages.

Metabolic disorders of the circulatory system of animals (e.g., hyperglycemia and hyperlipidemia) can significantly affect immune function, however, since there is currently no reliable animal model for hyperproteinemia, its effects on immunity remain unclear. In this study, we established an animal model for hyperproteinemia in an invertebrate silkworm model, with a controllable plasma protein concentration (PPC) and no primary disease effects. We evaluated the influence of hyperproteinemia on innate immunity. The results showed that high PPC enhanced hemolymph phagocytosis via inducing a rapid increase in granulocytes. Moreover, while oenocytoids increased, the plasmacytes quickly dwindled. High PPC inhibited hemolymph melanization due to decreased phenoloxidase (PO) activity in the hemolymph via inhibiting the expression of the prophenoloxidase-encoding genes, PPO1 and PPO2. High PPC upregulated the gene expression of antimicrobial peptides via differential activation of the Toll and Imd signaling pathways associated with NF-κB signaling, followed by an induction of inconsistent antibacterial activity towards Gram-positive and Gram-negative bacteria in an animal model of high PPC. Therefore, high PPC has multiple significant effects on the innate immune function of the silkworm circulatory system.

Artificial diets for silkworms have many potential applications and they are important in sericulture. However, the challenges of weak larvae and low silk protein synthesis efficiency in silkworms reared on artificial diets have not been resolved. Here, we used high-throughput sequencing to analyse the differences between the gut microbiota of 5th-instar larvae reared on mulberry leaves and larvae reared on an artificial diet. The results showed that at the phylum level, Cyanobacteria, Firmicutes, Proteobacteria, Bacteroidetes and Actinobacteria are the dominant bacteria in the intestines of silkworm larvae of all the strains. But the abundance of dominant bacteria in the gut microbiota differed between the silkworm strains that were reared on mulberry leaves, as well as between the silkworm strains that were reared on the artificial diet, while the gut microbiota diversity was lower in the silkworm strains that were reared on the artificial diet. Prediction of the functions of the gut microbiota in the hosts indicated that there was no significant difference between the silkworm strains that were reared on mulberry leaves, while there were significant differences between silkworm strains reared on the artificial diet. When the silkworm diet changed from mulberry leaves to the artificial diet, changes in gut microbiota in the silkworms affected host nutrient metabolism and immune resistance. These changes may be related to the adaptation of silkworms to their long evolutionary history of eating mulberry leaves.

The habitat of Chinese mitten crabs (CMCs, Eriocheir sinensis) has significant impact on their flavor and market price, and the characteristic flavor of CMCs produced in Yangcheng Lake in the lower reach of the Yangtze River in China is the most sought after by consumers. In this study, the differences in the intestinal microbiome and flavor amino acids, nucleotides, and organic acids in CMCs cultivated in Yangcheng Lake and Gucheng Lake (also in the lower reach of the Yangtze River) using the same model were compared. The results showed that CMCs cultivated in different lakes contained specific microbiota, with significantly different composition and abundance of the dominant microbiota. Although remarkable differences were noted in the contents of flavor amino acids, nucleotides, and lactic acid among different tissues and genders of CMCs, only some of these indicators varied between CMCs of different habitats, with respect to the distinctive flavor of CMCs. Thus, the difference in the intestinal microbiota of CMCs from different habitats may be related to the variation in the distinctive flavor of CMCs.

Diapause is a developmental transition in insects based on seasonal adaptation to adversity, it is regulated by a circadian clock system and the endocrine system. However, the molecular node and its mechanism underlying the effects of these systems are still unclear. Here, a mutant of Bombyx mori with the circadian clock gene Period (Per) knocked out was constructed, which dramatically changed the classic diapause-destined pathway. Per-knockout silkworms powerfully attenuated, but could not completely block, the predetermined effects of temperature and photoperiod on diapause determination, and this effect depended on the diapause hormone (DH) pathway. The impaired transcription-translation feedback loop of the circadian clock system lacking the Per gene caused direct up-regulation of the expression of GRD, a receptor of γ-aminobutyric acid (GABA), by changing expression level of Cycle. The synthesis of GABA in the tissue complex of brain-suboesophageal ganglion then increased and restricted the decomposition, which continuously promoted the GABAergic signal to play a role, and finally inhibiting (delaying) the release of DH to the hemolymph, and reducing the diapause-inducing effect of DH. The results provided an example to explain the regulatory mechanism of the circadian clock on endocrine hormones in the silkworm.

The biological toxicity of nanomaterials is a concern because they have many potential applications in biomedical fields. In this study, silkworm hemolymph was exposed to high-dose cadmium telluride quantum dots (CdTe QDs), citric-acid–nitrogen-doped carbon dots (C–NCDs), or silicon nanoparticles (SiNPs) and the differences in the immune responses and programmed cell death induced in hemocytes were compared. Changes in the expression of innate-immunity-related genes and the occurrence of hemocytes in the hemolymph indicated that the three types of nanomaterials entered several types of hemocytes by endocytosis, but their toxicity differed significantly. C–NCDs only induced autophagy in the hemocytes, whereas SiNPs induced both hemocyte autophagy and the simultaneous apoptosis of a large number of cells. CdTe QD exposure rapidly induced hemocyte apoptosis and necrosis. The mechanisms of hemocyte apoptosis induced by the different nanomaterials differed significantly. The apoptosis induced by CdTe QDs was dependent on the lysosomal apoptotic pathway, whereas SiNPs also used the endoplasmic reticulum apoptotic pathway. The autophagy and even apoptosis that appeared in the hemocytes after SiNP exposure quickly self-repaired, whereas the autophagy induced in hemocytes by C–NCD exposure persisted.

Circadian clock system disorders can lead to uncontrolled cell proliferation, but the molecular mechanism remains unknown. We used a Bombyx mori animal model of single Period gene (BmPer) expression to investigate this mechanism. A slow growing developmental cell model (Per-KD) was isolated from a B. mori ovarian cell line (BmN) by continuous knock down of BmPer expression. The effects of BmPer expression knockdown (Per-KD) on cell proliferation and apoptosis were opposite to those of m/hPer1 and m/hPer2 in mammals. The knockdown of BmPer expression led to cell cycle deceleration with shrinking of the BmN cell nucleus, and significant inhibition of nuclear DNA synthesis and cell proliferation. It also promoted autophagy via the lysosomal pathway, and accelerated apoptosis via the caspase pathway.

The pathway of communication between endocrine hormones and ribosome biogenesis critical for physiological adaptation is largely unknown. Nucleolar essential protein 1 (Nep1) is an essential gene for ribosome biogenesis and is functionally conserved in many in vertebrate and invertebrate species. In this study, we cloned Bombyx mori Nep1 (BmNep1) due to its high expression in silk glands of silkworms on day 3 of the fifth instar. We found that BmNep1 mRNA and protein levels were upregulated in silk glands during fourth-instar ecdysis and larval-pupal metamorphosis. By immunoprecipitation with the anti-BmNep1 antibody and liquid chromatography-tandem mass spectrometry analyses, it was shown that BmNep1 probably interacts with proteins related to ribosome structure formation. Immunohistochemistry, biochemical fractionation and immunocytochemistry revealed that BmNep1 is localized to the nuclei in Bombyx cells. Using BmN cells originally derived from ovaries, we demonstrated that 20-hydroxyecdysone (20E) induced BmNep1 expression and stimulated nuclear accumulation of BmNep1. Under physiological conditions, BmNep1 was also upregulated in ovaries during larval-pupal metamorphosis. Overall, our results indicate that the endocrine hormone 20E facilitates nuclear accumulation of BmNep1, which is involved in nuclear ribosome biogenesis in Bombyx.

The silk gland in silkworm (Bombyx mori) is a highly specialized organ that specifically synthesizes silk proteins. A function shift to the synthesis of large quantities of 30K proteins occurs in the degenerating silk gland cells during larval-pupal metamorphosis. The posterior silk gland developmental mutant model of silkworm was used in this study and changes in the programmed cell death (PCD) regulatory signals and 30K protein synthesis during silk gland degeneration were investigated. The results showed that PCD induced by 20-hydroxyecdysone was initiated early during larval-pupal metamorphosis in the mutant, but PCD proceeded slowly, resulting in the degeneration process of the silk gland being extended and took almost twice the time compared with the wild type. Caspase-dependent pathway signals regulated by Dronc in the silk gland cells of the mutant were significantly reduced, while the PCD initiation signal regulated by the Atg family was not delayed or reduced, and PCD-related epigenetic modification such as lysine methylation, acetylation, and succinylation, and tyrosine phosphorylation changed significantly. During the degeneration process in the mutant, 30K proteins were efficiently synthesized in the silk gland cells in stage PP1 even when no caspase protein was detected. Degeneration of the silk gland is a PCD process in which autophagy and apoptosis may participate. The degeneration process was regulated by a caspase-dependent pathway, while the synthesis of 30K proteins along with silk gland degeneration may not be entirely dependent on caspase signals.

The physiology and metabolism of poikilothermic insects are under the control of environmental temperature. Temperature is the primary cue for the circadian rhythm. Reports on the timing mechanisms of temperature in lepidopterans are limited. This study used Bombyx mori BmN ovarian cells to investigate the effect of temperature on expression of the main circadian clock genes in a negative feedback loop. A 37°C, 30-min high-temperature stimulation induced transcription of the circadian clock genes Cry1, Cry2, Per, and Tim. The gene expression profiles showed rhythmic oscillations, with shortened oscillatory periods for Cry1 and altered oscillatory phases for Cry1 and Per. Cyclical increases in temperature of 2°C starting at 26°C, 5°C starting at 20 or 25°C, or 10°C starting at 20°C induced cyclical changes in expression and protein from the four circadian clock genes. Cyclical temperature changes with a difference of 10°C had the most influence. In conclusion, cyclical changes in temperature with differences from 2 to 10°C reset and synchronized the circadian clock of silkworm BmN cells. Transcription of the genes for and protein from Cry2 and Per showed a better reset and synchronization with cyclical temperature changes.

Artificial diets for silkworms have many potential applications and they are important in sericulture. However, the challenges of weak larvae and low silk protein synthesis efficiency in silkworms reared on artificial diets have not been resolved. Here, we used high-throughput sequencing to analyse the differences between the gut microbiota of 5th-instar larvae reared on mulberry leaves and larvae reared on an artificial diet. The results showed that at the phylum level, Cyanobacteria, Firmicutes, Proteobacteria, Bacteroidetes and Actinobacteria are the dominant bacteria in the intestines of silkworm larvae of all the strains. But the abundance of dominant bacteria in the gut microbiota differed between the silkworm strains that were reared on mulberry leaves, as well as between the silkworm strains that were reared on the artificial diet, while the gut microbiota diversity was lower in the silkworm strains that were reared on the artificial diet. Prediction of the functions of the gut microbiota in the hosts indicated that there was no significant difference between the silkworm strains that were reared on mulberry leaves, while there were significant differences between silkworm strains reared on the artificial diet. When the silkworm diet changed from mulberry leaves to the artificial diet, changes in gut microbiota in the silkworms affected host nutrient metabolism and immune resistance. These changes may be related to the adaptation of silkworms to their long evolutionary history of eating mulberry leaves.

Umbelliferone has potential value as it has an inhibitory effect on tumor cells; however, its impact on an animal's circulatory system and hematopoietic function has not been reported. In this study, 4-methylumbelliferon (4-MU), an umbelliferone derivative, was used as a model drug, and its potential toxicity on hemocytes and hematopoietic organs (HOs) was investigated using an invertebrate animal model, the silkworm, Bombyx mori. The results showed that the level of reactive oxygen species in HOs increased when larvae (third day of the fifth instar) were orally exposed to 4 mM 4-MU for 8 min, followed by the induction of improved antioxidative metabolism of coenzymes in hemolymph. Exposure to 4-MU also significantly upregulated the expression levels of several genes in the hemolymph and fat body (a detoxification tissue similar to the liver in mammals) including antimicrobial peptide gene cecropinA and moricin, and a phagocytosis-related gene, tetraspanin E, suggesting an increased antioxidant level and antimicrobial ability of the circulatory system. However, the percentage of dead hemocytes increased and hematopoiesis significantly decreased in HOs, indicating the toxic effect of 4-MU on hemocytes and hematopoiesis, despite it inducing enhanced antioxidant and antimicrobial activity in the circulatory system.

Bombyx mori L. larvae exposed to 4-n-nonylphenol (4-NP; 0.05, 0.1, 0.2, and 0.4 g per kg of nutrient) in the laboratory were studied with respect to superoxide dismutase, catalase, and corresponding mRNA levels in gonads during different developmental stages (larval, pupal, and adult). In addition, malondialdehyde contents were measured. An increase in malondialdehyde content was observed at the larval, pupal, and adult stages. In addition, an increase or decrease in superoxide dismutase, catalase, and the gene transcript level of superoxide dismutase and catalase was detected at the different stages. The changing trend in mRNA levels of these enzymes was not always consistent with that of enzyme activity. These results suggest a relationship between 4-NP and alterations in the levels of antioxidant enzymes in B. mori gonads.

Silkworms (Bombyx mori) reared on artificial diets have great potential applications in sericulture. However, the mechanisms underlying the enhancement of metabolic utilization by altering silkworm nutrition are unclear. The aim of this study was to investigate the mechanisms responsible for the poor development and low silk protein synthesis efficiency of silkworms fed artificial diets. After multi-generational selection of the ingestive behavior of silkworms to artificial diets, we obtained two strains, one of which developed well and another in which almost all its larvae starved to death on the artificial diets. Subsequently, we analyzed the metabolomics of larval hemolymph by gas chromatography/liquid chromatography–mass spectrometry, and the results showed that vitamins were in critically short supply, whereas the nitrogen metabolic end product of urea and uric acid were enriched substantially, in the hemolymph of the silkworms reared on the artificial diets. Meanwhile, amino acid metabolic disorders, as well as downregulation of carbohydrate metabolism, energy metabolism, and lipid metabolism, co-occurred. Furthermore, 10 male-dominant metabolites and 27 diet-related metabolites that differed between male and female silkworms were identified. These findings provide important insights into the regulation of silkworm metabolism and silk protein synthesis when silkworms adapt to an artificial diet.

Hatching behavior is a key target in silkworm (Bombyx mori) rearing, especially for the control of Lepidoptera pests. According to previous research, hatching rhythms appear to be controlled by a clock mechanism that restricts or "gates" hatching to a particular time. However, the underlying mechanism remains elusive. Under 12-h light:12-h dark photoperiod (LD) conditions, the transcriptional levels of the chitinase5 (Cht5) and hatching enzyme-like (Hel) genes, as well as the enzymatic activities of their gene products, oscillated in time with ambient light cycles, as did the transcriptional levels of the cryptochrome 1, cryptochrome 2, period (per), and timeless genes, which are key components of the negative feedback loop of the circadian rhythm. These changes were related to the expression profile of the ecdysteroid receptor gene and the hatching behavior of B. mori eggs. However, under continuous light or dark conditions, the hatching behavior, the expression levels of Cht5 and Hel, as well as the enzymatic activities of their gene products, were not synchronized unlike under LD conditions. In addition, immunohistochemistry experiments showed that light promoted the translocation of PER from the cytoplasm to the nucleus. In conclusion, LD cycles regulate the hatching rhythm of B. mori via negative feedback loop of the circadian oscillator.

Parental transcript legacy plays an important role in fertilization and development of the early embryo. Parental environmental exposure affects the fertilization of eggs, but the underlying biochemical mechanism is largely unresolved. In this study, the parental environmental effects on fertilization of eggs were explored in the silkworm Bombyx mori (B. mori), an ideal lepidopteran animal model. The results showed that the rate of fertilization decreased after the parents were exposed to a poor environment at 32 °C with continuous illumination for 72 h on days 6-9 of the pupal stage, which is a key period for germ cell maturation. This was likely attributable to lower energy charge values, obstructed nicotinamide adenine dinucleotide (NAD(+)) regeneration and inactive tricarboxylic acid cycle (TCA), leading to accumulation of large amounts of pyruvic acid and lactic acid. This effect was related to energy metabolism via glycolysis; in particular disruption of pyruvate metabolism. In conclusion, this study showed parental exposure to an abnormal environment during germ cell maturation affected glycolysis and the subsequent fertilization of eggs via the parental transcript legacy in B. mori.

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.

Plant sources of umbelliferones have tumor-inhibitory effects at the cellular level. However, their physiological functions in animals are largely unresolved. In this study, we provide evidence to show that 4-methylumbelliferone (4-MU) participates in the regulation of antioxidative capacity in the fat body of Bombyx mori, a tissue similar to mammalian liver in this model invertebrate. Larvae (3rd day of the 5th instar) were orally exposed to 4 mM 4-MU, an umbelliferone, which swiftly induced the generation of a large number of ROS (e.g. H2O2 increased 6 to 8-fold), and 4-MU was detected in the fat body 8 min after administration. In addition, the activities of CAT and GPx were up-regulated 4 to 11-fold and 2 to 16-fold, respectively, and were helpful in defending fat body cells against oxidative injury in combination with NADPH. Furthermore, significant increases in the contents of T-AOC (up to approx. 2-fold), antioxidants of ASAFR (by 2 to 4-fold) and GSH were detected.

Abnormalities in the circadian clock system are known to affect the body’s metabolic functions, though the molecular mechanisms responsible remain uncertain. In this study, we achieved continuous knockdown of B. mori Period (BmPer) gene expression in the B. mori ovary cell line (BmN), and generated a Per-KD B. mori model with developmental disorders including small individual cells and slow growth. We conducted cell metabolomics assays by gas chromatography/liquid chromatography-mass spectrometry and showed that knockdown of BmPer gene expression resulted in significant inhibition of glycometabolism. Amino acids that used glucose metabolites as a source were also down-regulated, while lipid metabolism and nucleotide metabolism were significantly up-regulated. Metabolite correlation analysis showed that pyruvate and lactate were closely related to glycometabolism, as well as to metabolites such as aspartate, alanine, and xanthine in other pathways. Further validation experiments showed that the activities of the key enzymes of glucose metabolism, hexokinase, phosphofructokinase, and citrate synthase, were significantly decreased and transcription of their encoding genes, as well as that of pyruvate kinase, were also significantly down-regulated. We concluded that inhibition of the circadian clock gene BmPer repressed glycometabolism, and may be associated with changes in cellular amino acid metabolism, and in cell growth and development.

Chitin synthase (CHS) is the key regulatory enzyme in chitin synthesis and excretion in insects, and a specific target of insecticides. We cloned a CHS B gene of Bombyx mori (BmChsB) and showed it to be midgut specific, highly expressed during the feeding process in the larva. Knockdown of BmChsB expression in the third-instar larvae increased the number of nonmolting and abnormally molting larvae. Exposure to nikkomycin Z, a CHS inhibitor, reduced the amount of chitin in the peritrophic membrane of molted larvae, whereas abnormally elevated BmChsB mRNA levels were readily detected from the end of molting and in the newly molted larvae. Exogenous 20-hydroxyecdysone (20E) and methoprene, a juvenile hormone analogue, significantly upregulated the expression of BmChsB when the levels of endogenous molting hormone (MH) were low and the levels of endogenous juvenile hormone (JH) were high immediately after molting. When levels of endogenous MH were high and those of endogenous JH were low during the molting stage, exogenous 20E did not upregulate BmChsB expression and exogenous methoprene upregulated it negligibly. When the endogenous hormone levels were low during the mulberry-leaf intake process, BmChsB expression was upregulated by exogenous methoprene. We conclude that the expression of BmChsB is regulated by insect hormones, and directly affects the chitin-synthesis-dependent form of the peritrophic membrane and protects the food intake and molting process of silkworm larvae.

Bombyx mori L. larvae were exposed to 4-n-nonylphenol (4-NP) in the laboratory, and their glutathione S-transferase, glutathione peroxidase, and corresponding mRNA levels in gonads during different developmental stages (larval, pupal, and adult) were evaluated. Developmental parameters and glutathione content were also measured. Altered patterns of pupation and adult emergence were observed after exposure to 0.05–0.4 g/kg 4-NP during the entire larval stage. When exposed to 0.4 g/kg 4-NP, the sex ratio (male/female) of the emerged adults increased rapidly from 0.91 ±0.09 to 1.96 ±0.26. A decrease in glutathione content was observed at the larval, pupal, and adult stages. In addition, at 0.05 g/kg 4-NP and higher concentrations, an increase in glutathione S-transferase, glutathione peroxidase activity, and the gene expression level of glutathione S-transferase d1 and glutathione peroxidase were detected in the larval stage, followed by a decline in glutathione S-transferase d1 and glutathione peroxidase transcript levels along with enzyme activity in the pupal and adult stages. The changing trend in mRNA levels of these enzymes was consistent with that of enzyme activity. The results suggest a relationship between 4-NP and alterations in the levels of glutathione-related detoxification enzymes in B. mori gonads.

The complete mitochondrial genome (mitogenome) of the Ailanthus silkmoth, Samia cynthia cynthia (Lepidoptera: Saturniidae) was determined. The circular genome is 15,345 bp long, and presents a typical gene organization and order for sequenced mitogenomes of Bombycidea species. The nucleotide composition of the genome is highly A+T biased, accounting for 79.86%. The AT skew of the genome is slightly negative, indicating the occurrence of more Ts than As, as found in other Saturniidae species. All protein-coding genes (PCGs) are initiated by ATN codons, except for COI and COII, which are tentatively designated by CGA and GTG, respectively, as observed in other insects. Four of 13 PCGs, including COI, COII, ATP6, and ND3, harbor the incomplete termination codons, T or TA. With an exception for tRNASer(AGN), all other tRNAs can form a typical clover-leaf structure of mitochondrial tRNA. The 359 bp A+T-rich region of S. c. cynthia contains non-repetitive sequences, but harbors several features common to the Bombycidea insects, including the motif ATAGA followed by a poly-T stretch of 19 bp, a microsatellite-like (AT)7 element preceded by the ATTTA motif, and a poly-A element upstream tRNAMet. The phylogenetic analyses support the morphology-based current hypothesis that Bombycidae and Saturniidae are monophyletic. Our result confirms that Saturniini and Attacini form a reciprocal monophyletic group within Saturniidae.

4-Nonylphenol (4-NP) a known endocrine disrupting chemical is a persistent environmental contaminant. However, the mechanism of reproductive toxicity caused by 4-NP is still largely unresolved in invertebrates. In this study, Bombyx mori larvae were constantly fed 4-NP at concentrations ranging from 0.05 to 0.4 g kg −1 , reproductive toxicity and induction of vitellogenin gene ( Vg ) expression were investigated in this organism which is an ideal lepidopteran model insect. The results showed that gonad development was retarded and maturity was decreased in both male and female pupae, while the sex ratio was unaffected by 4-NP exposure. In the 4-NP exposed animals, the corresponding egg yolk protein, vitellin, involved in energy reserves for embryonic development in oviparous animals, was present in the testis of male pupae, and the mRNA transcript of the Vg gene was detected in the fat body, a specific organ of Vg synthesis, which is normally silent in males. In addition, expression of the Vg gene was up-regulated in the fat body of female pupae and adults, while the protein was decreased in developing eggs. Furthermore, expression of the ecdysone receptor gene ( EcR ) in the ovaries of pupae was down-regulated, suggested that the transport of Vg from the fat body to developing oocytes was disturbed by 4-NP due to interference in the expression of EcR related to ecdysone activity.

Glaucocalyxin (Gla) A-C are major ent-kauranoid diterpenoids isolated from Rabdosia japonica var. glaucocalyx, a plant used in Chinese traditional medicine as an antitumor and anti-inflammatory agent. The present investigation was carried out to observe whether cellular reduced glutathione (GSH) plays important roles in Gla -induced cytotoxicity. Among major ent-kauranoid diterpenoids isolated, Gla A and B dose-dependently decreased the growth of HL-60 cells with an IC50 of approximately 6.15 and 5.86 µM at 24 h, respectively. Both Gla A and B could induce apoptosis, G2/M-phase cycle arrest, DNA damage and the accumulation of reactive oxygen species (ROS) in HL-60 cells. Moreover, Gla A, B caused rapid decrease of the intracellular GSH content, while inhibition of cellular GSH synthesis by buthionine sulfoximine (BSO) augmented the induced cytotoxicity and apoptosis in HL-60 cells. On the other hand, the administration of GSH or GSH precursor N-acetyl-cysteine (NAC) could rescue Gla A, B-depleted cellular GSH, and abrogate the induced cytotoxicity, G2/M-phase cycle arrest, DNA damage and ROS accumulation in HL-60 cells. Furthermore, Gla A, B decreased the activity of the GSH-related enzymes including glutathione reductase (GR) and glutathione peroxidase (GPX). These data suggest that the intracellular GSH redox system plays important roles in regulating the Gla A, B-induced cytotoxicity on HL-60 cells.

To explore whether glutathione regulates diapause determination and termination in the bivoltine silkworm Bombyx mori, we monitored the changes in glutathione redox cycle in the ovary of both diapause- and nondiapause-egg producers, as well as those in diapause eggs incubated at different temperatures. The activity of thioredoxin reductase (TrxR) was detected in ovaries but not in eggs, while neither ovaries nor eggs showed activity of glutathione peroxidase. A lower reduced glutathione/oxidized glutathione (GSH/GSSG) ratio was observed in the ovary of diapause-egg producers, due to weaker reduction of oxidized glutathione (GSSG) to the reduced glutathione (GSH) catalyzed by glutathione reductase (GR) and TrxR. This indicates an oxidative shift in the glutathione redox cycle during diapause determination. Compared with the 25°C-treated diapause eggs, the 5°C-treated diapause eggs showed lower GSH/GSSG ratio, a result of stronger oxidation of GSH catalyzed by thioredoxin peroxidase and weaker reduction of GSSG catalyzed by GR. Our study demonstrated the important regulatory role of glutathione in diapause determination and termination of the bivoltine silkworm.

BACKGROUND: Male-biased silkworm larva resistance is useful for sericulture and lepidopteran pest control. According to previous research, the mechanism underlying this resistance might be related to midgut-specific proteins. RESULTS: A midgut-specific and novel hypothetical cuticular protein-like (Cph-like) gene was cloned, based on sex-disparity serial analysis of gene expression (SAGE) libraries of theB.mori midgut. The complete cDNA contained 676 bp and encoded 165 amino acid residues. The gene was located on chromosome 19 and it had only one short 75 bp intron. The Cph-like expression level was downregulated by exogenous 20-hydroxyecdysone or starvation, but upregulated by exogenous methoprene or food intake. Knockdown (siRNA) of the Cph-like gene suppressed the appetite and delayed larval development, while it also degraded enterocytes and damaged the midgut morphology. Furthermore, the male-biased cytoplasmic polyhedrosis virus (BmCPV) resistance of larvae was decreased. CONCLUSION: The Cph-like gene is a midgut-specific novel gene in B. mori that may participate in histogenesis and midgut maintenance. c � 2013 Society of Chemical Industry Supportinginformationmaybefoundintheonlineversionofthisarticle.

The 30K proteins are involved with important functions in the growth and development of Bombyx mori. In this study, the synthesis and regulation of 30K proteins were examined during the degeneration of Bombyx silk glands. On day 3 of the fifth instar, the protein level of 30Kc19 was low, whereas the silk proteins were rapidly synthesized. However, synthesis and accumulation of the 30Kc19 protein significantly increased at the prepupal stage and on day 1 of the pupal stage. At this stage, the silk gland cells were filled with 30Kc19 and genomic DNA. Moreover, the transcript levels of the 30K-encoding genes, including 30Kc6, 30Kc12, 30Kc19 and 30Kc23 were up-regulated during the degeneration of the Bombyx silk glands. During the time that the levels of the 30Kc19 protein were significantly up-regulated, it is notable that the transcript levels of the BmAtg8, BmAtg6 and BmDronc genes dramatically increased to regulate the programmed cell death of this gland. On day 1 of the pupal stage, intense fragmentation of genomic DNA occurred in the silk gland cells, and the putative active form of caspase was detected in the cytoplasm, showing the complete degradation of the silk glands in one day. In conclusion, the 30K proteins are synthesized in high concentrations, while proteolysis mediates silk gland degeneration in Bombyx by a caspase-dependent pathway. We propose that the 30K proteins may be nutrients and energy vectors to be absorbed by the developing tissues of pupae or moths.

The dragline silk of orb-weaving spiders possesses extremely high tensile strength and elasticity. To date, full-length sequences of only two genes encoding major ampullate silk protein (MaSp) in Latrodectus hesperus have been determined. In order to further understand this gene family, we utilized in this study a variety of strategies to isolate full-length MaSp1 and MaSp2 cDNAs in the wasp spider Argiope bruennichi. A. bruennichi MaSp1 and MaSp2 are primarily composed of remarkably homogeneous ensemble repeats containing several complex motifs, and both have highly conserved C-termini and N-termini. Two novel amino acid motifs, GGF and SGR, were found in MaSp1 and MaSp2, respectively. Amino acid composition analysis of silk, luminal contents and predicted sequences indicates that MaSp1 and MaSp2 are two major components of major ampullate glands and that the ratio of MaSp1 to MaSp2 is approximately 3:2 in dragline silk. Furthermore, both the MaSp1:MaSp2 ratio and the conserved termini are closely linked with the production of high quality synthetic fibers. Our results make an important contribution to our understanding of major ampullate silk protein structure and provide a second blueprint for creating new composite silk which mimics natural spider dragline silk.

The glycosylation of UDP-glucosyltransferases (UGTs) is of great importance in the control and elimination of both endogenous and exogenous toxins. Bm-UGT10286 (UGT86) is the sole provider of UGT activity against the 5-O position of quercetin and directly influences the formation of green pigment in the Bombyx cocoon. To evaluate whether cocoon coloration evolved for mimetic purposes, we concentrated on the expression pattern of Ugt86 and the activities of the enzyme substrates. The expression of Ugt86 was not only detected in the cocoon absorbing and accumulating tissues such as the digestive tube and silk glands, but also in quantity in the detoxification tissues of the malpighian tubes and fat body, as well as in the gonads. As in the green cocoon strains, Ugt86 was clearly expressed in the yellow and white cocoon strains. In vitro, the fusion protein of UGT86 showed quercetin metabolic activity. Nevertheless, Ugt86 expression of 5th instar larvae was not up-regulated in the silk gland by exogenous quercetin. However, it was significantly up-regulated in the digestive tube and gonads (P0.05). A similar result was observed in experiments where larvae were exposed to rutin, an insect resistance inducer and growth inhibitor typically found in plants, and to 20-hydroxylecdysone (20E), an insect endocrine and plant source hormone. On the contrary, up-regulated Ugt86 expression was almost nil in larvae exposed to juvenile hormone III (P0.05). The results of HPLC revealed that a new substance was formed by mixing 20E with the recombinant UGT86 protein in vitro, indicating that the effect of Ugt86 on 20E was similar to that on exogenous quercetin derived from plant food, and that the effect probably initiated the detoxification reaction against rutin. The conclusion is that the reaction of Ugt86 on the silkworm cocoon pigment quercetin is not the result of active mimetic ecogenesis, but derives from the detoxification of UGTs.

Silicon nanoparticles (SiNPs) have attractive potential applications in biological and medical fields, and yet their impact on animals is still controversial, and there have been no reports of their effects on hematopoiesis. In this study, the effects of SiNPs on hemocytes and hematopoiesis were investigated by administering SiNPs via a vascular injection into an invertebrate model, the silkworm. Our results show that the ability of SiNPs to enter different types of circulating hemocytes and their impact on those hemocytes differed significantly. Rapid accumulation of SiNPs was observed in granulocytes, oenocytoids, and spherulocytes, which have immune functions in the circulating hemolymph, whereas SiNPs did not easily enter prohemocytes, which can differentiate into granulocytes, oenocytoids, and spherulocytes and replenish them. The SiNPs that entered the hemocytes initiated autophagy and apoptosis via the lysosomal/mitochondrial pathway. High-dose SiNPs weakly stimulated lysosomal activity in hematopoietic organs, but did not lead to a significant increase in reactive oxygen species or severe autophagy or apoptosis in the organ tissues. We suggest that the damage caused by high-dose SiNPs to hematopoiesis is self-healing, because few SiNPs entered the hematopoietic stem cells in the circulating hemolymph, so the damage to the hematopoietic tissues was limited.

KK-42 is an imidazole insect growth regulator. A (KK-42)-binding protein (KK-42BP) has been shown to be associated with diapause termination in pharate first instars of Antheraea yamamai (Guérin-Méneville) (Lepidoptera: Saturniidae). In this study, the (KK-42)-binding protein gene (ApKK-42BP) was characterized from Antheraea pernyi (Guérin-Méneville) (Lepidoptera: Saturniidae) undergoing a winter diapause as a pupa. Homologous comparison revealed that KK-42BPs from A.pernyi and A.yamamai were closely related to the known minor yolk proteins from the lepidopterans Bombyx mori L., Plodia interpunctella (Hübner), and Galleria mellonella L. The two KK-42BPs also contained a lipase-like region, as observed in the known lepidopteran yolk proteins. Phylogenetic analysis suggested that KK-42BP is a new member of the minor yolk proteins. Reverse transcription-polymerase chain reaction analyses showed that ApKK-42BP mRNA was expressed in all of the tissues tested, throughout four developmental stages, and in both female and male. Both in the brain and hemolymph, expression of ApKK-42BP mRNA level was similar between nondiapause-destined and diapause-destined larval individuals. ApKK-42BP mRNA was expressed in the predia-pause period of diapause-destined pupae, disappeared in early diapause and diapause stage, and reappeared in the postdiapause stage. These expression patterns stated that a lack of KK-42BP is associated with pupal diapause and its expression may be critical to nondiapausing individuals. Our results suggested that the KK-42BP gene is likely involved in a function other than as a yolk protein.

Diapause in Bombyx mori eggs is induced by temperature and photoperiod at the stage of embryonic development in the maternal generation. In those diapause eggs, Esterase-A4 is suggested to serve as a diapause-termination timer (TIME-EA4), because its ATPase activity shows an interval-timer elevation after acid treatment or chilling of eggs to break diapause. To clarify whether the timed ATPase activity of TIME-EA4 is related to its gene (Ea4) expression, we analyzed Ea4 mRNA of eggs in diapause-inducing environmental conditions. Reverse transcription PCR (RT-PCR) analysis showed that the level of Ea4 mRNA was lower in 15DD than in 25LL (P 0.05). Furthermore, expressed sequence tag profile and gene microarray analysis demonstrated that Ea4 showed stage-specific and tissue-specific expression during postembryonic stages, high Ea4 mRNA in the spinning and eclosion stages, and in integument and head, but low in gonads of fifth-instar day-3 larvae. Then we analyzed the relationship between TIME-EA4 ATPase activities and Ea4 gene expression. The ATPase activities in diapause eggs laid by the resultant adults transiently elevated after treatments to break diapause, that is, at 1.5 h after common-acid treatment and day 13 after chilling at 5°C. However, these elevations of enzyme activities were not accompanied by any increases in Ea4 mRNA levels. In conclusion, the termination of the Bombyx embryonic diapause is related to TIME-EA4 but not to its gene expression.

The type IV collagen is a heterotrimer of two α1 (IV) and one α2 (IV) chains, which are encoded by emb-9 and let-2 genes in Caenorhabditis elegans, respectively, and the amino acid mutations in Gly-X-Y repeat region can cause temperature-sensitive lethality during late embryogenesis. Here, we introduced a way to quickly and effectively do research on Bmlet-2 (BmColIVα1) gene from Bombyx mori, a central model for Lepidoptera. BmColIVα1 gene is 6.583 kbp in full length, containing four exons, and its cDNA is 3.847 kbp, which contains an ORF for a protein of 819 amino acids with a molecular weight of 82.1 kDa and an isoelectric point of 6.43. The predicted protein sequence has closer relationship with α1 (IV) collagen chain of other species, and contains two conserved regions of collagen and nine PFAM domains of collagen triple helix repeat regions. Moreover, transmembrane region analysis and subcellular localization analysis reveal that this protein belongs to extracellular secreted protein. The experimental expression profile demonstrated that the expression level of BmColIVα1 was obviously higher in head and fat body on day 3 of the fifth instar. The mutations of BmColIVα1 gene located in exon 2 and exon 3 were identified in temperature-sensitive lethal strain sch and wild stain Dazao. Seven mutations ― namely, 242(T/A), 279(T/A), 556(T/C), 675(C/T), 1343(T/C), 1463(A/G), and 1574(T/C) ― were novel, and five of them would modify the encoded amino acids, namely, 81(L/Q), 186(S/P), 448(L/S), 488(Q/R), and 525(V/A). The results of molecular modelling showed that the five amino acids mutations were located in four regions of 3-helixs repetitive element sequence of ColIVα1 protein. BmColIVα1 protein is a member of the collagen family, and its gene might be a temperature-sensitive lethality-related gene.