Search

Initiation of protein synthesis from the correct start codon of messenger RNA (mRNA) is crucial to translation fidelity. In bacteria, the start codon is usually preceded by a 4- to 6-mer adenosine/guanosine-rich Shine–Dalgarno (SD) sequence. Both the SD sequence and the start codon comprise the core ribosome-binding site (RBS), to which the 30S ribosomal subunit binds to initiate translation. How the rather short and degenerate information inside the RBS can be correctly accommodated by the ribosome is not well understood. Here, we used single-molecule techniques to tackle this long-standing issue. We found that the 30S subunit initially binds to mRNA through the SD sequence, whereas the downstream RBS undergoes dynamic motions, especially when it forms structures. The mRNA is either dissociated or stabilized by initiation factors, such as initiation factor 3 (IF3). The initiator transfer RNA (tRNA) further helps the 30S subunit accommodate mRNA and unwind up to 3 base pairs of the RBS structure. Meanwhile, the formed complex of the 30S subunit with structured mRNA is not stable and tends to disassociate. IF3 promotes dissociation by dismissing the bound initiator tRNA. Thus, initiation factors may accelerate the dynamic assembly–disassembly process of 30S–mRNA complexes such that the correct RBS can be preferentially selected. Our study provides insights into how the bacterial ribosome identifies a typical translation initiation site from mRNA.

Shine-Dalgarno (SD) sequences, the core element of prokaryotic ribosome-binding sites, facilitate mRNA translation by base-pair interaction with the anti-SD (aSD) sequence of 16S rRNA. In contrast to this paradigm, an inspection of thousands of prokaryotic species unravels tremendous SD sequence diversity both within and between genomes, whereas aSD sequences remain largely static. The pattern has led many to suggest unidentified mechanisms for translation initiation. Here we review known translation-initiation pathways in prokaryotes. Moreover, we seek to understand the cause and consequence of SD diversity through surveying recent advances in biochemistry, genomics, and high-throughput genetics. These findings collectively show: (1) SD:aSD base pairing is beneficial but nonessential to translation initiation. (2) The 5' untranslated region of mRNA evolves dynamically and correlates with organismal phylogeny and ecological niches. (3) Ribosomes have evolved distinct usage of translation-initiation pathways in different species. We propose a model portraying the SD diversity shaped by optimization of gene expression, adaptation to environments and growth demands, and the species-specific prerequisite of ribosomes to initiate translation. The model highlights the coevolution of ribosomes and mRNA features, leading to functional customization of the translation apparatus in each organism.

Mounting evidence has demonstrated the important role of long non-coding RNAs (lncRNAs) in the development and progression of lung cancer. In this study, we combined the methods of bioinformatics analysis and experimental validation, and aim to investigate the clinical significance and underlying mechanism of the novel lncRNA AC079630.4 in lung cancer. Finally, we found that AC079630.4 was significantly down-regulated in lung cancer tissues, including in its subtypes. Samples with low AC079630.4 expression had a more advanced pathological stage and a worse prognosis than those with high expression. In functional prediction, the KEGG pathway of apoptosis and the TRAIL signaling pathway were enriched in the samples with high AC079630.4 expression. In experimental validation, AC079630.4 over-expression could significantly inhibit the proliferation and clonality, and up-regulated the receptors of TRAIL (TRAIL-R1 and TRAIL-R2) in lung cancer cells. In conclusion, we adopted the methods of bioinformatics analysis and experimental validation, and identified a novel lncRNA of AC079630.4 as a tumor suppressor in lung cancer.

Programmed -1 ribosomal frameshifting is an essential regulation mechanism of translation in viruses and bacteria. It is stimulated by mRNA structures inside the coding region. As the structure is unfolded repeatedly by consecutive translating ribosomes, whether it can refold properly each time is important in performing its function. By using single-molecule approaches and molecular dynamics simulations, we found that a frameshift-stimulating RNA pseudoknot folds sequentially through its upstream stem S1 and downstream stem S2. In this pathway, S2 folds from the downstream side and tends to be trapped in intermediates. By masking the last few nucleotides to mimic their gradual emergence from translating ribosomes, S2 can be directed to fold from the upstream region. The results show that the intermediates are greatly suppressed, suggesting that mRNA refolding may be modulated by ribosomes. Moreover, masking the first few nucleotides of S1 favors the folding from S2 and yields native pseudoknots, which are stable enough to retrieve the masked nucleotides. We hypothesize that translating ribosomes can remodel an intermediate mRNA structure into a stable conformation, which may in turn stimulate backward slippage of the ribosome. This supports an interactive model of ribosomal frameshifting and gives an insightful account addressing previous experimental observations., (© The Author(s) 2021. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Programmed -1 ribosomal frameshifting (-1 PRF) is a translation mechanism that regulates the relative expression level of two proteins encoded on the same messenger RNA (mRNA). This regulation is commonly used by viruses such as coronaviruses and retroviruses but rarely by host human cells, and for this reason, it has long been considered as a therapeutic target for antiviral drug development. Understanding the molecular mechanism of -1 PRF is one step toward this goal. Minus-one PRF occurs with a certain efficiency when translating ribosomes encounter the specialized mRNA signal consisting of the frameshifting site and a downstream stimulatory structure, which impedes translocation of the ribosome. The impeded ribosome can still undergo profound conformational changes to proceed with translocation; however, some of these changes may be unique and essential to frameshifting. In addition, most stimulatory structures exhibit conformational dynamics and sufficient mechanical strength, which, when under the action of ribosomes, may in turn further promote -1 PRF efficiency. In this review, we discuss how the dynamic features of ribosomes and mRNA stimulatory structures may influence the occurrence of -1 PRF and propose a hypothetical frameshifting model that recapitulates the role of conformational dynamics., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2021 The Author(s).)

Shine-Dalgarno sequences (SD) in prokaryotic mRNA facilitate protein translation by pairing with rRNA in ribosomes. Although conventionally defined as AG-rich motifs, recent genomic surveys reveal great sequence diversity, questioning how SD functions. Here, we determined the molecular fitness (i.e., translation efficiency) of 4 9 synthetic 9-nt SD genotypes in three distinct mRNA contexts in Escherichia coli We uncovered generic principles governing the SD fitness landscapes: (1) Guanine contents, rather than canonical SD motifs, best predict the fitness of both synthetic and endogenous SD; (2) the genotype-fitness correlation of SD promotes its evolvability by steadily supplying beneficial mutations across fitness landscapes; and (3) the frequency and magnitude of deleterious mutations increase with background fitness, and adjacent nucleotides in SD show stronger epistasis. Epistasis results from disruption of the continuous base pairing between SD and rRNA. This "chain-breaking" epistasis creates sinkholes in SD fitness landscapes and may profoundly impact the evolution and function of prokaryotic translation initiation and other RNA-mediated processes. Collectively, our work yields functional insights into the SD sequence variation in prokaryotic genomes, identifies a simple design principle to guide bioengineering and bioinformatic analysis of SD, and illuminates the fundamentals of fitness landscapes and molecular evolution., (© 2020 Kuo et al.; Published by Cold Spring Harbor Laboratory Press.)

Motivation: Programmed ribosomal frameshifting (PRF) is widely used by viruses and bacteria to produce different proteins from a single mRNA template. How steric hindrance of a PRF-stimulatory mRNA structure transiently modifies the conformational dynamics of the ribosome, and thereby allows tRNA slippage, remains elusive., Results: Here, we leverage linear response theories and resolution-exchanged simulations to construct a structural/dynamics model that connects and rationalizes existing structural, single-molecule and mutagenesis data by resolution-exchanged structural modelling and simulations. Our combined theoretical techniques provide a temporal and spatial description of PRF with unprecedented mechanistic details. We discover that ribosomal unfolding of the PRF-stimulating pseudoknot exerts resistant forces on the mRNA entrance of the ribosome, and thereby drives 30S subunit rolling. Such motion distorts tRNAs, leads to tRNA slippage, and in turn serves as a delicate control of cis-element's unwinding forces over PRF., Availability and Implementation: All the simulation scripts and computational implementations of our methods/analyses (including linear response theory) are included in the bioStructureM suite, provided through GitHub at https://github.com/Yuan-Yu/bioStructureM., Supplementary Information: Supplementary data are available at Bioinformatics online., (© The Author(s) 2018. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Frameshifting is an essential process that regulates protein synthesis in many viruses. The ribosome may slip backward when encountering a frameshift motif on the messenger RNA, which usually contains a pseudoknot structure involving tertiary base pair interactions. Due to the lack of detailed molecular explanations, previous studies investigating which features of the pseudoknot are important to stimulate frameshifting have presented diverse conclusions. Here we constructed a bimolecular pseudoknot to dissect the interior tertiary base pairs and used single-molecule approaches to assess the structure targeted by ribosomes. We found that the first ribosome target stem was resistant to unwinding when the neighboring loop was confined along the stem; such constrained conformation was dependent on the presence of consecutive adenosines in this loop. Mutations that disrupted the distal base triples abolished all remaining tertiary base pairs. Changes in frameshifting efficiency correlated with the stem unwinding resistance. Our results demonstrate that various tertiary base pairs are coordinated inside a highly efficient frameshift-stimulating RNA pseudoknot and suggest a mechanism by which mechanical resistance of the pseudoknot may persistently act on translocating ribosomes., (© The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.)

Programmed ribosomal frameshifting produces alternative proteins from a single transcript. -1 frameshifting occurs on Escherichia coli's dnaX mRNA containing a slippery sequence AAAAAAG and peripheral mRNA structural barriers. Here, we reveal hidden aspects of the frameshifting process, including its exact location on the mRNA and its timing within the translation cycle. Mass spectrometry of translated products shows that ribosomes enter the -1 frame from not one specific codon but various codons along the slippery sequence and slip by not just -1 but also -4 or +2 nucleotides. Single-ribosome translation trajectories detect distinctive codon-scale fluctuations in ribosome-mRNA displacement across the slippery sequence, representing multiple ribosomal translocation attempts during frameshifting. Flanking mRNA structural barriers mechanically stimulate the ribosome to undergo back-and-forth translocation excursions, broadly exploring reading frames. Both experiments reveal aborted translation around mutant slippery sequences, indicating that subsequent fidelity checks on newly adopted codon position base pairings lead to either resumed translation or early termination., (Copyright © 2015 Elsevier Inc. All rights reserved.)

Although the dynamic motions and peptidyl transferase activity seem to be embedded in the rRNAs, the ribosome contains more than 50 ribosomal proteins (r-proteins), whose functions remain largely elusive. Also, the precise forms of some of these r-proteins, as being part of the ribosome, are not structurally solved due to their high flexibility, which hinders the efforts in their functional elucidation. Owing to recent advances in cryo-electron microscopy, single-molecule techniques, and theoretical modeling, much has been learned about the dynamics of these r-proteins. Surprisingly, allosteric regulations have been found in between spatially separated components as distant as those in the opposite sides of the ribosome. Here, we focus on the functional roles and intricate regulations of the mobile L1 and L12 stalks and L9 and S1 proteins. Conformational flexibility also enables versatile functions for r-proteins beyond translation. The arrangement of r-proteins may be under evolutionary pressure that fine-tunes mass distributions for optimal structural dynamics and catalytic activity of the ribosome.

A detailed understanding of tRNA/mRNA translocation requires measurement of the forces generated by the ribosome during this movement. Such measurements have so far remained elusive and, thus, little is known about the relation between force and translocation and how this reflects on its mechanism and regulation. Here, we address these questions using optical tweezers to follow translation by individual ribosomes along single mRNA molecules, against an applied force. We find that translocation rates depend exponentially on the force, with a characteristic distance close to the one-codon step, ruling out the existence of sub-steps and showing that the ribosome likely functions as a Brownian ratchet. We show that the ribosome generates ∼13 pN of force, barely sufficient to unwind the most stable structures in mRNAs, thus providing a basis for their regulatory role. Our assay opens the way to characterizing the ribosome's full mechano-chemical cycle., (Copyright © 2014, Liu et al.)

Folding messenger RNA into specific structures is a common regulatory mechanism involved in translation. In Escherichia coli, the operator of the rpsO gene transcript folds into a pseudoknot or double-hairpin conformation. S15, the gene product, binds only to the pseudoknot, thereby repressing its own synthesis when it is present in excess in the cell. The two RNA conformations have been proposed to exist in equilibrium. However, it remained unclear how structural changes can be achieved between these two topologically distinct conformations. We used optical tweezers to study the structural dynamics and rearrangements of the rpsO operator RNA at the single-molecule level. We discovered that the two RNA structures can be interchanged spontaneously and the pseudoknot can exist in conformations that exhibit various levels of stability. Conversion from the double hairpin to a pseudoknot through potential hairpin-hairpin interactions favoured the high-stability conformation. By contrast, mutations that blocked the formation of a hairpin typically resulted in alternative low-stability pseudoknots. These results demonstrate that specific tertiary interactions of RNA can be established and modulated based on the interactions and rearrangements between secondary structural components. Our findings provide new insight into the RNA folding pathway that leads to a regulatory conformation for target protein binding.

The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs., (©2011 Macmillan Publishers Limited. All rights reserved)

In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation.

We have followed individual ribosomes as they translate single messenger RNA hairpins tethered by the ends to optical tweezers. Here we reveal that translation occurs through successive translocation--and-pause cycles. The distribution of pause lengths, with a median of 2.8 s, indicates that at least two rate-determining processes control each pause. Each translocation step measures three bases--one codon-and occurs in less than 0.1 s. Analysis of the times required for translocation reveals, surprisingly, that there are three substeps in each step. Pause lengths, and thus the overall rate of translation, depend on the secondary structure of the mRNA; the applied force destabilizes secondary structure and decreases pause durations, but does not affect translocation times. Translocation and RNA unwinding are strictly coupled ribosomal functions.

Circular dichroism (CD) spectroscopy is widely used to characterize the structures of DNA G-quadruplexes. CD bands at 200-300 nm have been empirically related to G-quadruplexes having parallel or antiparallel sugar-phosphate backbones. We propose that a more fundamental interpretation of the origin of the CD bands is in the stacking interactions of neighboring G-quartets, which can have the same or opposing polarities of hydrogen bond acceptors and donors. From an empirical summation of CD spectra of the d(G)5 G-quadruplex and of the thrombin binding aptamer that have neighboring G-quartets with the same and opposite polarities, respectively, the spectra of aptamers selected by the Ff gene 5 protein (g5p) appear to arise from a combination of the two types of polarities of neighboring G-quartets. The aptamer CD spectra resemble the spectrum of d(G3T4G3), in which two adjacent quartets have the same and two have opposite polarities. Quantum-chemical spectral calculations were performed using a matrix method, based on guanine chromophores oriented as in d(G3T4G3). The calculations show that the two types of G-quartet stacks have CD spectra with features resembling experimental spectra of the corresponding types of G-quadruplexes., ((c) 2007 Wiley-Liss, Inc.)

RNA unfolding and folding reactions in physiological conditions can be facilitated by mechanical force one molecule at a time. By using force-measuring optical tweezers, we studied the mechanical unfolding and folding of a hairpin-type pseudoknot in human telomerase RNA in a near-physiological solution, and at room temperature. Discrete two-state folding transitions of the pseudoknot are seen at approximately 10 and approximately 5 piconewtons (pN), with ensemble rate constants of approximately 0.1 sec(-1), by stepwise force-drop experiments. Folding studies of the isolated 5'-hairpin construct suggested that the 5'-hairpin within the pseudoknot forms first, followed by formation of the 3'-stem. Stepwise formation of the pseudoknot structure at low forces are in contrast with the one-step unfolding at high forces of approximately 46 pN, at an average rate of approximately 0.05 sec(-1). In the constant-force folding trajectories at approximately 10 pN and approximately 5 pN, transient formation of nonnative structures were observed, which is direct experimental evidence that folding of both the hairpin and pseudoknot takes complex pathways. Possible nonnative structures and folding pathways are discussed.

By exerting mechanical force, it is possible to unfold/refold RNA molecules one at a time. In a small range of forces, an RNA molecule can hop between the folded and the unfolded state with force-dependent kinetic rates. Here, we introduce a mesoscopic model to analyze the hopping kinetics of RNA hairpins in an optical tweezers setup. The model includes different elements of the experimental setup (beads, handles, and RNA sequence) and limitations of the instrument (time lag of the force-feedback mechanism and finite bandwidth of data acquisition). We investigated the influence of the instrument on the measured hopping rates. Results from the model are in good agreement with the experiments reported in the companion article. The comparison between theory and experiments allowed us to infer the values of the intrinsic molecular rates of the RNA hairpin alone and to search for the optimal experimental conditions to do the measurements. We conclude that the longest handles and softest traps that allow detection of the folding/unfolding signal (handles approximately 5-10 Kbp and traps approximately 0.03 pN/nm) represent the best conditions to obtain the intrinsic molecular rates. The methodology and rationale presented here can be applied to other experimental setups and other molecules.

Experimental variables of optical tweezers instrumentation that affect RNA folding/unfolding kinetics were investigated. A model RNA hairpin, P5ab, was attached to two micron-sized beads through hybrid RNA/DNA handles; one bead was trapped by dual-beam lasers and the other was held by a micropipette. Several experimental variables were changed while measuring the unfolding/refolding kinetics, including handle lengths, trap stiffness, and modes of force applied to the molecule. In constant-force mode where the tension applied to the RNA was maintained through feedback control, the measured rate coefficients varied within 40% when the handle lengths were changed by 10-fold (1.1-10.2 Kbp); they increased by two- to threefold when the trap stiffness was lowered to one-third (from 0.1 to 0.035 pN/nm). In the passive mode, without feedback control and where the force applied to the RNA varied in response to the end-to-end distance change of the tether, the RNA hopped between a high-force folded-state and a low-force unfolded-state. In this mode, the rates increased up to twofold with longer handles or softer traps. Overall, the measured rates remained with the same order-of-magnitude over the wide range of conditions studied. In the companion article on pages 3010-3021, we analyze how the measured kinetics parameters differ from the intrinsic molecular rates of the RNA, and thus how to obtain the molecular rates.

Single-stranded DNA or RNA libraries used in SELEX experiments usually include primer-annealing sequences for PCR amplification. In genomic SELEX, these fixed sequences may form base pairs with the central genomic fragments and interfere with the binding of target molecules to the genomic sequences. In this study, a method has been developed to circumvent these artificial effects. Primer-annealing sequences are removed from the genomic library before selection with the target protein and are then regenerated to allow amplification of the selected genomic fragments. A key step in the regeneration of primer-annealing sequences is to employ thermal cycles of hybridization-extension, using the sequences from unselected pools as templates. The genomic library was derived from the bacteriophage fd, and the gene 5 protein (g5p) from the phage was used as a target protein. After four rounds of primer-free genomic SELEX, most cloned sequences overlapped at a segment within gene 6 of the viral genome. This sequence segment was pyrimidine-rich and contained no stable secondary structures. Compared with a neighboring genomic fragment, a representative sequence from the family of selected sequences had about 23-fold higher g5p-binding affinity. Results from primer-free genomic SELEX were compared with the results from two other genomic SELEX protocols.

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.

The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.

We review CD studies of a single-stranded DNA binding protein, g5p, of the Ff group of bacterial viruses. The CD spectrum of the g5p is dominated by a positive tyrosine La band at 229 nm, to which all five of the protein tyrosines contribute. The La band becomes much less positive upon binding of g5p to nucleic acids. CD spectra of mutant proteins identified a single tyrosine, Y34, that is largely responsible for this CD perturbation. At >250 nm, CD perturbations of nucleic acids can be monitored during g5p binding, and CD titrations have identified two distinct modes of binding of the g5p at physiological ionic strength (0.2 M NaCl). SELEX selection of sequences bound preferentially by g5p yielded a G-rich sequence that is closely related to telomere sequences and has CD properties of a G-tetraplex. CD spectroscopy showed that the presumed G-quadruplex form is maintained within saturated g5p x DNA complexes.

The Ff gene 5 protein (g5p) is a cooperative ssDNA-binding protein. SELEX was used to identify DNA sequences favorable for g5p binding at physiological ionic strength (200 mM NaCl) and 37 degrees C. Sequences were selected from a library of 58-mers that contained a central variable segment of 26 nucleotides. DNA sequences selected after eight rounds of SELEX were mostly G-rich, with multiple copies of CPuGGPy, TPuGGGPy, and/or PyPuPuGGGPy motifs. This was unexpected, since g5p has higher binding affinities for polypyrimidine than for polypurine sequences. The most recurrent G-rich sequence, named I-3, was found to have g5p-binding properties that were correlated with a structural transition. At 10 mM NaCl, I-3 existed in a single-stranded form that was saturated by g5p in an all-or-none fashion. At 200 mM NaCl, I-3 existed in a structured form that showed CD spectral features of G-quadruplexes. The g5p binding affinity for this structured form of I-3 was >100-fold higher than for the single-stranded form. Moreover, the structured I-3 was saturated by g5p in two steps, the first of which was the formation of an apparent initiation complex consisting of one I-3 strand and about three g5p dimers. Nuclease S1 footprinting and other experiments showed that g5p molecules in the initiation complex at 200 mM NaCl were bound directly to the G-rich variable segment and that the structure of I-3 was retained after saturation by g5p. Thus, G-rich motifs may form structures favorable for initiation of g5p binding and also provide the actual g5p-binding sites.

Aims/hypothesis: Several investigations have shown that the renal medulla has a greater capacity to generate nitric oxide than the renal cortex. To further evaluate the changes of nitric oxide synthesis in the kidney, particularly in the outer medulla, in disorders involving fluid and electrolyte imbalances, we sought to determine renal nitric oxide synthase expression in the diabetic rats., Methods: We determined renal nitric oxide synthase mRNA and urinary nitrite/nitrate excretion in 12 normal and 12 streptozotocin-induced diabetic rats by reverse transcription-polymerase chain reaction with Southern blot hybridization and with Griess reaction, respectively. Nitric oxide synthase immunoreactivity was detected by immunohistochemistry in four normal and four diabetic rats., Results: Neuronal and endothelial nitric oxide synthase mRNA were 3.5-fold and 1.8-fold increased in the outer medulla of 12 diabetic rats with no difference found in the cortex and inner medulla when compared with 12 normal rats. Urinary nitrite/nitrate excretion was significantly increased from the first week after diabetic induction. In normal rats, immunohistochemical studies showed positive neuronal and endothelial nitric oxide synthase immunostaining in almost all segments of renal tubules. Diabetic rats had the greatest enhancement of immunostaining for neuronal and endothelial nitric oxide synthase in the proximal straight tubule and medullary thick ascending limb., Conclusion/interpretation: Our results indicate that increases in neuronal and endothelial nitric oxide synthase synthesis in the kidney, particularly in the outer medulla, possibly play an important part in the adaptation of renal function to hyperglycaemia and hyperosmolality in diabetes.

Unlabelled: Increased nitric oxide synthase mRNA expression in the renal medulla of water-deprived rats., Background: Experiments were performed to investigate whether renal nitric oxide synthase (NOS) mRNA and protein expression are responsive to the alteration of body volume., Methods: Four days of water deprivation (WD) was initiated in 16 male Wistar rats, and 16 normal rats (NC) served as the control group. Neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS) mRNAs and immunoreactivity were measured by reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot hybridization and immunohistochemistry, respectively. Plasma angiotensin II, vasopressin, and atrial natriuretic peptide (ANP) concentrations were measured by radioimmunoassay., Results: The four-day WD increased plasma sodium and osmolality levels, but severely decreased daily urine sodium excretion and urine volume. Plasma angiotensin II and vasopressin concentrations were increased, but the plasma ANP level was significantly decreased in WD rats. nNOS, eNOS, and iNOS mRNA levels were increased by 5.2-, 3.3-, and 3. 4-fold in the outer medulla and 1.7-, 1.5-, and 1.8-fold in the inner medulla, whereas no significant difference was found in the renal cortex of WD rats as compared with NC rats. Additionally, immunohistochemistry revealed that the immunostaining intensity of nNOS, eNOS, and iNOS was clearly enhanced in the medullary thick ascending limb, proximal straight tubule, inner medullary collecting duct, and proximal convoluted tubule in WD rats. Kidney angiotensin II content as well as renin mRNA levels in renal cortex, outer medulla, and inner medulla in WD rats were apparently increased., Conclusions: Our results indicate that the increases of nNOS, eNOS, and iNOS synthesis in the kidney, particularly in the renal medulla, may have a role in the adaptation of renal function to volume depletion in the face of an increase of systemic and intrarenal vasoconstrictive substances.

The pyr*pur.pyr type of nucleic acid triplex has a purine strand that is Hoogsteen-paired with a parallel pyrimidine strand (pyr*pur pair) and that is Watson-Crick-paired with an antiparallel pyrimidine strand (pur.pyr pair). In most cases, the Watson-Crick pair is more stable than the Hoogsteen pair, although stable formation of DNA Hoogsteen-paired duplexes has been reported. Using oligomer triplexes of repeating d(AG)12 and d(CT)12 or r(CU)12 sequences that were 24 nt long, we found that hybrid RNA*DNA as well as DNA*DNA Hoogsteen-paired strands of triplexes can be more stable than the Watson-Crick-paired strands at low pH. The structures and relative stabilities of these duplexes and triplexes were evaluated by circular dichroism (CD) spectroscopy and UV absorption melting studies of triplexes as a function of pH. The CD contributions of Hoogsteen-paired RNA*DNA and DNA*DNA duplexes were found to dominate the CD spectra of the corresponding pyr*pur.pyr triplexes.

Background: Experiments were performed to examine the effect of water deprivation and salt restriction on ANP synthesis in the kidneys and hearts of normal rats., Methods: A 4-day water deprivation (WD) and 7-day salt restriction (SR; 0.01% NaCl) were performed in 12 and 14 rats, respectively. Atrial natriuretic peptide (ANP) mRNA expression in the kidney was assessed with reverse transcription-polymerase chain reaction coupled with Southern blot hybridization, while the ANP mRNA in the hearts was measured by Northern blot hybridization. ANP and angiotensin II concentrations in the extracted plasma were measured by radioimmunoassay. The molecular form of renal ANP-like protein was characterized by reverse phase-high-performance liquid chromatography (RP-HPLC)., Results: Renal outer and inner medullary ANP mRNA showed a respective 11-fold and ninefold increase in WD rats, and an eightfold and fivefold increase in SR rats as compared to corresponding control groups. Inversely, cardiac atrial ANP mRNA and plasma ANP were decreased in WD rats, whereas they did not change in the SR group. Plasma angiotensin II concentration increased in conjunction with the decrease of urine sodium excretion in both groups. RP-HPLC analysis revealed a 45% extraction of ANP in the WD rat kidneys, whereas only 3% ANP in the control kidneys migrated in a molecular form similar to cardiac atrial proANP., Conclusions: Our results demonstrate that water deprivation and salt restriction markedly enhance renal ANP mRNA, whereas water deprivation suppresses cardiac atrial ANP mRNA and plasma ANP concentrations. The current study indicates that renal ANP and cardiac atrial ANP appear to be two distinct systems regulated by different mechanisms and possibly exhibiting different intra-renal paracrine and systemic endocrine functions.

Esculentoside A (EsA) is a saponin isolated from the roots of Phytolacca esculenta. Previous experiments showed that it had strong anti-inflammatory effects. Tumour necrosis factor (TNF) is an important inflammatory mediator. In order to study the mechanism of the anti-inflammatory effect of EsA, it was determined whether TNF production from macrophages was altered by EsA under lipopolysaccharide (LPS) stimulated conditions. EsA was found to decrease both extracellular and cell associated TNF production in a dose dependent manner at concentrations higher than 1 mumol/l EsA. Previous studies have showed that EsA reduced the releasing of platelet activating factor (PAF) from rat macrophages. The reducing effects of EsA on the release of TNF and PAF may explain its anti-inflammatory effect.