Search

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or β-L-2′-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Staphylococcusaureus is an important opportunistic pathogen that causes many infections in humans and animals. The inappropriate use of antibiotics has favored the diffusion of methicillin-resistant S. aureus (MRSA), nullifying the efforts undertaken in the discovery of antimicrobial agents. Oxadiazole heterocycles represent privileged scaffolds for the development of new drugs because of their unique bioisosteric properties, easy synthesis, and therapeutic potential. A vast number of oxadiazole-containing derivatives have been discovered as potent antibacterial agents against multidrug-resistant MRSA strains. Here, we investigate the ability of a new library of oxadiazoles to contrast the growth of Gram-positive and Gram-negative strains. The strongest antimicrobial activity was obtained with compounds 3 (4 µM) and 12 (2 µM). Compound 12, selected for further evaluation, was found to be noncytotoxic on the HaCaT cell line up to 25 µM, bactericidal, and was able to improve the activity of oxacillin against the MRSA. The highest synergistic interaction was obtained with the combination values of 0.78 μM for compound 12, and 0.06 μg/mL for oxacillin. The FIC index value of 0.396 confirms the synergistic effect of compound 12 and oxacillin. MRSA treatment with compound 12 reduced the expression of genes included in the mec operon. In conclusion, 12 inhibited the growth of the MRSA and restored the activity of oxacillin, thus resulting in a promising compound in the treatment of MRSA infection.

The multiple inhibition of biological targets involved in pro-inflammatory eicosanoid biosynthesis represents an innovative strategy for treating inflammatory disorders in light of higher efficacy and safety. Herein, following a multidisciplinary protocol involving virtual combinatorial screening, chemical synthesis, and in vitro and in vivo validation of the biological activities, we report the identification of 1,2,4-oxadiazole-based eicosanoid biosynthesis multi-target inhibitors. The multidisciplinary scientific approach led to the identification of three 1,2,4-oxadiazole hits (compounds 1, 2 and 5), all endowed with IC50 values in the low micromolar range, acting as 5-lipoxygenase-activating protein (FLAP) antagonists (compounds 1 and 2), and as a multi-target inhibitor (compound 5) of arachidonic acid cascade enzymes, namely cyclooxygenase-1 (COX-1), 5-lipoxygenase (5-LO) and microsomal prostaglandin E2 synthase-1 (mPGES-1). Moreover, our in vivo results demonstrate that compound 5 is able to attenuate leukocyte migration in a model of zymosan-induced peritonitis and to modulate the production of IL-1β and TNF-α. These results are of interest for further expanding the chemical diversity around the 1,2,4-oxadiazole central core, enabling the identification of novel anti-inflammatory agents characterized by a favorable pharmacological profile and considering that moderate interference with multiple targets might have advantages in re-adjusting homeostasis.

Staphylococcus aureus represents an important opportunistic pathogen able to cause many infections in humans and animals as skin or lung infections, endocarditis, toxic shock syndrome, and sepsis. The inappropriate use of antibiotics has favoured the diffusion of resistant- bacteria, as for beta-lactams and the selection of methicillin-resistant S. aureus (MRSA), that has nullified the efforts done in the discovery of antimicrobial agents. Thus, the discovery of new compounds potentially able to control diseases by resistant bacteria and restore the activity of existing antibiotics represents an urgent goal. Oxadiazole nucleus is a relevant scaffold in organic and medicinal chemistry for its elevated versatility to afford molecular diversity, and for therapeutic potential. Previously, a wide library of oxadiazole-containing derivatives was discovered as potent antibacterial agents against multidrug-resistent MRSA strains. Our study is aimed to further expand the structural diversity around the selected scaffold in order to define the antibacterial activity.

[Image: see text] GPBAR1 agonists have been identified as potential leads for the treatment of diseases related to colon inflammation such as Crohn’s and ulcerative colitis. In this paper, we report the discovery of a small library of hyodeoxycholane analogues, decorated at C-6 with different substituents, as potent and selective GPBAR1 agonists. In vitro pharmacological assays showed that compound 6 selectively activates GPBAR1 (EC(50) = 0.3 μM) and reduces the production of pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α) in THP1 cells. The binding mode of compound 6 in GPBAR1 was elucidated by docking calculations. Moreover, compound 6 protects against TNBS-induced colitis in Gpbar1(+/+) rodent model, representing an intriguing lead for the treatment of these inflammatory disorders.

In recent years, interest has increased in obtaining drugs from those plants with high content of bioactive substances like triterpenes, alkaloids, tannins and flavonoids for their potential use in promoting wound healing. Sempervivum tectorum L. (Crassulaceae), known as houseleek, is a evergreen plant which grows in central and southern Europe. Fresh juice or squeezed leaves are used in folk medicine exclusively for external purposes in the treatment of the ear inflammation, for wound, sores and abscesses as refrigerant and astringent [1]. Antinociceptive and antioxidant [2] activity, in vivo and in vitro model, was also investigated. The present study was undertaken with the aim to explore the biological activity of the extracts and of the purified fractions of Sempervivum tectorum L. leaves. The extract is rich in free sugars with the rare sedoheptulose, organic acids such as malic acid, flavonoids and 2-C-methyerithritol. We analyzed the effects of Sempervivum tectorum purified fractions on cellular proliferation and migration [3] in HCT cells. We observed that treatment with the fractions with high level of sedoheptulose and malic acid of Sempervivum tectorum (SVT high fraction), significantly improved cellular migration and proliferation. We next investigated on the intracellular signaling cascades triggered by the incubation with the SVT high fraction and we observed that incubation with the SVT high fraction induces a significant phosphorylation of EGFR and Src. Furthermore, HCT cells stimulated with the SVT high fraction show a significant increase of STAT3 phosphorylation and this event was prevented by AG1478, an EGFR selective inhibitor. Taken together these data strongly suggest that the SVT high fraction significantly improve cellular proliferation and migration by inducing a Src-dependent EGFR activation and might represent a new proliferative and new wound healing therapeutic approaches.

We developed a general HPLC method for the discrimination of (D,L)-monosaccharide components from natural products. The reaction involves the preparation of L-cysteine (3-nitrophenyl) methyl ester hydrochloride, which reacts with aldoses leading to thiazolidine derivatives. Direct HPLC analysis with reversed-phase column and UV detection, discriminated enantiomeric D- and L-monosaccharides in a highly sensitive manner. This method was applied for the determination of the absolute configurations of monosaccharides in the natural poliumoside B, a tetraglycoside obtained from Teucrium polium.

The G-protein coupled receptor of bile acids GPBAR1 is a bile acid receptor that plays an important role in regulating innate immunity, glucose homeostasis and energy expenditure representing an interesting target for the treatment of metabolic and degenerative diseases. A selective control of its activity over the other bile acid-activated receptors is desirable to reduce unwanted effects due to activation of multiple downstream signals regulated by diverse receptors. Here, we report the design and the synthesis of a small series of bile acid derivatives with their side chains decorated with an epoxide ring. We demonstrate that all the compounds selectively activate GPBAR1 in cell-based assays and regulate the expression of pro-glucagon, a canonical GPBAR1 targeted gene in an intestinal endocrine cell line, while have no effect on FXR, LXRα and LXRβ. Finally, we elucidate the binding mode of the most potent compound of this family through molecular modeling studies. Our study contributes to increase the arsenal of bile acid derivatives serving as GPBAR1 modulators, widening the chemical space that can be exploited in drug design.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

Introduction Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. Objective To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. Methodology An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high-performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI-MS) data. By nuclear magnetic resonance (NMR) [1 H, 13 C and two-dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. Results In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2-C-methyl-D-erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c-Src-mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. Conclusions Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.

In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.

[Image: see text] Recent findings have shown that Farnesoid X Receptor (FXR) antagonists might be useful in the treatment of cholestasis and related metabolic disorders. In this paper, we report the discovery of a new chemotype of FXR antagonists featured by a 3,5-disubstituted oxadiazole core. In total, 35 new derivatives were designed and synthesized, and notably, compounds 3f and 13, containing a piperidine ring, displayed the best antagonistic activity against FXR with promising cellular potency (IC(50) = 0.58 ± 0.27 and 0.127 ± 0.02 μM, respectively). The excellent pharmacokinetic properties make compound 3f the most promising lead identified in this study.

The G-protein bile acid receptor 1 (GPBAR1) has emerged in the last decade as prominent target for the treatment of metabolic and inflammatory diseases including type 2 diabetes, obesity, and non-alcoholic steatohepatitis. To date numerous bile acid derivatives have been identified as GPBAR1 agonists, however their clinical application is hampered by the lack of selectivity toward the other bile acid receptors. Therefore, non-steroidal GPBAR1 ligands able to selectively activate the receptor are urgently needed. With this aim, we here designed, synthesized and biologically evaluated ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl) urea derivatives as novel potent GPBAR1 agonists. Particularly, compounds 9 and 10 induce the mRNA expression of the GPBAR1 target gene pro-glucagon and show high selectivity over the other bile acid receptors FXR, LXRα, LXRβ and PXR, and the related receptors PPARα and PPARγ. Computational studies elucidated the binding mode of 10 to GPBAR1, providing important structural insights for the design of non-steroidal GPBAR1 agonists. The pharmacokinetic properties of 9 and 10 suggest that the ((1,2,4-oxadiazol-5-yl)pyrrolidin-3-yl)ureydil scaffold might be exploited to achieve effective drug candidates to treat GPBAR1 related disorders.

The n-butanolic extract, from an Iranian specimen of Nepeta asterotricha Rech. f. (NABE), displayed anti-inflammatory effects on lipopolysaccharide (LPS)-stimulated J774A.1 macrophages, which reduced nitrites and cytokines production. Bioassay guided fractionation of the extract led to the isolation of four iridoid glycosides, including a new one known as nepetamoside (1), one hexenyl-diglycoside, and some polyphenol and flavonoid components. None of the isolated iridoid components displayed significant effects on nitrites formation in an in vitro LPS-induced model of inflammation, thus suggesting that the plant anti-inflammatory effect is probably due to a synergistic action among its constituents.

In questo studio viene riportata la sintesi e la valutazione farmacologica di una nuova famiglia di derivati degli acidi biliari caratterizzati dalla presenza di una funzione epossidica in catena laterale. I risultati farmacologici hanno mostrato che tali composti sono in grado di attivare il recettore GPBAR1.

Bile acid receptors represent well-defined targets for the development of novel therapeutic approaches to metabolic and inflammatory diseases. In the present study, we report the generation of novel C-3 modified 6-ethylcholane. The pharmacological characterization and molecular docking studies for the structure-activity rationalization, allowed the identification of 3-azido-6α-ethyl-7α-hydroxy-5β-cholan-24-oic acid (compound 2), a potent and selective FXR agonist with a nanomolar potency in transactivation assay and high efficacy in the recruitment of SRC-1 co-activator peptide in Alfa Screen assay. In vitro, compound 2 was completely inactive towards common off-targets such as the nuclear receptors PPAR, PPAR, LXR, and LXRand the membrane G-coupled bile acid receptor, GPBAR1. This compound when administered in vivo exerts a robust FXR agonistic activity increasing the liver expression of FXR-target genes including SHP, BSEP, OST and FgF21, while represses the expression of genes that are negatively regulated by FXR (CYP7A1), and collectively these effects result in a significant reshaping of bile acid pool in mouse. In summary, compound 2 could represent a promising candidate for drug development in liver metabolic disorders.

Bile acids are extensively investigated for their potential in the treatment of human disorders. The liver X receptors (LXRs), activated by oxysterols and by a secondary bile acid named hyodeoxycholic acid (HDCA), have been found essential in the regulation of lipid homeostasis in mammals. Unfortunately, LXRα activates lipogenic enzymes causing accumulation of lipid in the liver. In addition to LXRs, HDCA has been also shown to function as ligand for GPBAR1, a G protein coupled receptor for secondary bile acids whose activation represents a promising approach to liver steatosis. In the present study, we report a library of HDCA derivatives endowed with modulatory activity on the two receptors. The lead optimization of HDCA moiety was rationally driven by the structural information on the binding site of the two targets and results from pharmacological characterization allowed the identification of hyodeoxycholane derivatives with selective agonistic activity toward LXRα and GPBAR1 and notably to the identification of the first example of potent dual LXRα/GPBAR1 agonists. The new chemical entities might hold utility in the treatment of dyslipidemic disorders.

Marine organisms and their metabolites represent a unique source of potential pharmaceutical substances. In this study, we examined marine-derived substances for their bioactive properties in a cell-based Chikungunya virus (CHIKV) replicon model and for in vitro anti-inflammatory activity. In the screening of a marine sample library, crude extracts from the Indian soft coral, Sinularia kavarattiensis, showed promising activity against the CHIKV replicon. Bioassay-guided chemical fractionation of S. kavarattiensis resulted in the isolation of six known norcembranoids (1-6) and one new compound, named kavaranolide (7). The structures were elucidated on the basis of NMR and MS spectroscopic data. Compounds 1-3 and 5-7 were evaluated for their replicon-inhibiting potential in the CHIKV model by using a luminescence-based detection technique and live cell imaging. Compounds 1 and 2 showed moderate inhibition of the CHIKV replicon, but imaging studies also revealed cytotoxic properties. Moreover, the effects of the isolated compounds on primary microglial cells, an experimental model for neuroinflammation, were evaluated. Compound 2 was shown to modulate the immune response in microglial cells and to possess potential anti-inflammatory properties by dose-dependently reducing the release of pro- and anti-inflammatory cytokines. © 2014 by the authors; licensee MDPI.

In recent years many sterols with unusual structures and promising biological profiles have been identified from marine sources. Here we report the isolation of a series of 24-alkylated-hydroxysteroids from the soft coral Sinularia kavarattiensis, acting as pregnane X receptor (PXR) modulators. Starting from this scaffold a number of derivatives were prepared and evaluated for their ability to activate the PXR by assessing transactivation and quantifying gene expression. Our study reveals that ergost-5-en-3β-ol (4) induces PXR transactivation in HepG2 cells and stimulates the expression of the PXR target gene CYP3A4. To shed light on the molecular basis of the interaction between these ligands and PXR, we investigated, through docking simulations, the binding mechanism of the most potent compound of the series, 4, to the PXR. Our findings provide useful functional and structural information to guide further investigations and drug design.

Plakortides R–U, four new polyketide endoperoxides, have been isolated from the marine sponge Plakinastrella mamillaris. Their structures were elucidated on the basis of extensive NMR spectroscopic (1H and 13C, COSY, HSQC, HMBC, and ROESY) and MS analyses and by chemical methods. In addition, a new method for the unambiguous stereochemical elucidation of 3,6-disubstituted 1,2-dioxines, frequently isolated from Plakinidae sponges, is reported. Pharmacological analysis demonstrated that plakortide U is endowed with in vitro antiplasmodial activity against a chloroquine-resistant strain.

Extracts of Ruscus aculeatus are a rich source of bioactive steroidal glycosides, such as ruscogenins which are reported to act against chronic venous disorders. Nowadays, several preparations of its roots, commonly used in traditional medicine, are on the market as food supplements for health care and maintenance. Although spirostanol deglucoruscin is one of the main metabolites in these extracts, literature reports about its pharmacological profile are scarce. In this paper, a multi-disciplinary approach, based on chemical proteomics, molecular modelling and bio-organic assays, has been used to disclose the whole interactome of deglucoruscin and the F0-F1 ATP synthase complex has been found as its main target.

International audience; In our ongoing search for new pharmacologically active leads from Solomon organisms, we have examined the sponge Theonella swinhoei. Herein we report the isolation and structure elucidation of swinholide A (1) and one new macrolide, swinholide J (2). Swinholide J is an unprecedented asymmetric 44-membered dilactone with an epoxide functionality in half of the molecule. The structural determination was based on extensive interpretation of high-field NMR spectra and HRESIMS data. Swinholide J displayed potent in vitro cytotoxicity against KB cells (human nasopharynx cancer) with an IC(50) value of 6 nM.

Imbricatolic acid was isolated from the methanolic extract of the fresh ripe berries of Juniperus communis (Cupressaceae) together with sixteen known compounds and a new dihydrobenzofuran lignan glycoside named juniperoside A. Their structures were determined by spectroscopic methods and by comparison with the spectral data reported in literature. Imbricatolic acid was evaluated for its ability to prevent cell cycle progression in p53-null CaLu-6 cells. This compound induces the upregulation of cyclin-dependent kinase inhibitors and their accumulation in the G1 phase of the cell cycle, as well as the degradation of cyclins A, D1, and E1. Furthermore, no significant imbricatolic acid-induced apoptosis was observed. Therefore, this plant-derived compound may play a role in the control of cell cycle.

Malignant melanoma is a highly aggressive tumor that frequently resists chemotherapy, so the search for new agents for its treatment is of great importance. In the present study, the antiproliferative propensity against human melanoma cell lines of lauroside B (1), a megastigmane glycoside isolated from Laurus nobilis (bay laurel) leaves, was investigated. This compound suppressed the proliferation of three human melanoma cell lines, namely, A375, WM115, and SK-Mel-28. The 1-induced inhibition of human melanoma cell proliferation was due to the induction of apoptosis, as demonstrated by FACS analysis with annexin V/PI staining and confirmed by activation of caspase-3 and by the cleavage of poly(ADP-ribose) polymerase (PARP). Growing evidence implicates NF-κB as an important contributor to metastasis and increased chemoresistance of melanoma. Thus, it was hypothesized that 1-induced apoptosis could be associated with suppression of NF-κB activation. The results showed that exposure of human melanoma cells to 1 inhibited IκB-α degradation and constitutive NF-κB DNA-binding activity as well as the expression, regulated by NF-κB, of two antiapoptotic genes, XIAP and c-FLIP. Induction of apoptosis by 1 in human aggressive melanoma cell lines has a potential high biological value.

Four new jaspamide derivs. (e.g. I, jaspamide M) with antimicrofilament activity were isolated from the marine sponge Jaspis splendans. Their structures were elucidated by NMR and MS analalysis. A structure-activity relationship analalysis on all natural jaspamides is also reported

Dragon’s blood (Sangre de drago), a viscous red sap derived from Croton lechleri Muell-Arg (Euphorbiaceae), is extensively used by indigenous cultures of the Amazonian basin for its wound healing properties. The aim of this study was to identify the minor secondary metabolites and test the antioxidant activity of this sustance. A bioguided fractionation of the n-hexane, chloroform, n-butanol, and aqueous extracts led to the isolation of 15 compounds: three megastigmanes, four flavan-3-ols, three phenylpropanoids, three lignans, a clerodane, and the alkaloid taspine. In addition to these known molecules, six compounds were isolated and identified for the first time in the latex: blumenol B, blumenol C, 4,5-dihydroblumenol A, erythro-guaiacyl-glyceryl-β-O-4’- dihydroconiferyl ether, 2-[4-(3-hydroxypropyl)-2-methoxyphenoxy]-propane-1,3-diol and floribundic acid glucoside. Combinations of spectroscopic methods (1H-, 13C- NMR and 2D-NMR experiments), ESI-MS, and literature comparisons were used for compound identification. In vitro antioxidant activities were assessed by DPPH, total antioxidant capacity and lipid peroxidation assays. Flavan-3-ols derivatives (as major phenolic compounds in the latex) exhibited the highest antioxidant activity.

Objective To explore anti-inflammatory activities of organic extract and its semi-purified fractions (ethanol, acetone, methanol/dichloromethane) from the Mediterranean gorgonian Eunicella singularis. Methods The anti-inflammatory and analgesic activities were evaluated, using the carrageenan-induced rat paw edema model and the acetic acid writhing test in mice. The gastroprotective activity was determined using HCl/EtOH induced gastric ulcers in rats. The purification and structure elucidation of compound(s) from the more effective fraction were determined by chromatographic and spectroscopic methods and in comparison with data reported in the literature. Results The fraction F–EtOH showed an important anti-inflammatory activity associated with significant analgesic and gastroprotective properties. The purification and structure elucidation of compound(s) from this fraction lead to the identification of one diterpenoid and four sterols. Conclusions These results suggested that components from the active fraction can be used to treat various anti-inflammatory diseases.

Four new triterpenoids, 2α,3α,20β,23-tetrahydroxy-ursa-12,19(29)-dien-28-oic acid (1), 2α,3α,20β,23-tetrahydroxy-ursa-12,19(29)-dien-28,20β-lactone (2), 2α,3α-dihydroxy-ursa-12,19-dien-28-oic acid 28-O-β- d -glucopyranoside (3) and 2α,3α,23-trihydroxy-ursa-12,19(29)-dien-28-oic acid (4) together with six known compounds (5–10), were isolated from the aerial parts of Oenothera maritima Nutt. Their structures were elucidated on the basis of spectroscopic data and chemical methods. Compounds 1, 3–10 were evaluated for their in vitro thrombin inhibitory activity and their selectivity against factor Xa and trypsin.

An investigation of the polar extracts from two starfish, Luidia quinaria and Psilaster cassiope, led to the isolation of five sulfated "asterosaponins". Two of them, named luidiaquinoside (1) and psilasteroside (2), are new compounds. Luidiaquinoside (1) contains a novel pentasaccharide chain composed of d-glucose, d-quinovose, and d-fucose, with the d-glucose unit being the branching point. Psilasteroside (2) contains a hexasaccharide chain in which an arabinose residue is detectable in the furanose form. Both of these compounds possess a Delta(9(11)),3beta,6alpha-dihydroxysteroidal nucleus with a 20-hydroxy, 23-oxo functionality. The structures of the new asterosaponins were elucidated by a combination of NMR techniques including (1)H-(1)H (COSY, TOCSY, and ROESY) and (1)H-(13)C (HMQC and HMBC) spectroscopy, ESIMS and HRFABMS spectrometry, and GC analyses. The new asterosaponins show marginal in vitro cytotoxicity against RBL-2H3 (rat basophilic leukemia) cell lines.

Three new furostanol saponins named capsicoside E (1), capsicoside F (2), and capsicoside G (5) were obtained from the seeds of Capsicum annuum L. var. acuminatum along with known oligoglycosides (3, 4, and 6-10). On the basis of chemical and spectroscopic analyses, the structures of these new furostanol oligoglycosides were elucidated as 26-O-beta-D-glucopyranosyl-22-O-methyl-5alpha-furost-25(27)-en-2alpha,3beta,22xi,26-tetraol-3-O-beta-D-glucopyranosyl(1-->3)-beta-D-glucopyranosyl(1-->2)-[beta-D-glucopyranosyl(1-->3)]-beta-D-glucopyranosyl(1-->4)-beta-D-galactopyranoside (1), 26-O-beta-D-glucopyranosyl-(25R)-5alpha-furost-20(22)-en-2alpha,3beta,26-triol-3-O-beta-D-glucopyranosyl (1-->3)-beta-D-glucopyranosyl(1-->2)-[beta-D-glucopyranosyl(1-->3)]-beta-D-glucopyranosyl(1-->4)-beta-D-galactopyranoside (2), and 26-O-beta-D-gluco-pyranosyl-(25R)-5alpha-furosta-3beta,22xi,26-triol-3-O-beta-D-glucopyranosyl(1-->3)-beta-D-glucopyranosyl(1-->2)-[beta-D-glucopyranosyl(1-->3)]-beta-D-glucopyranosyl(1-->4)-beta-D-galactopyranoside (5). The isolated saponins showed higher antimicrobial activity against yeasts than against common fungi. Data indicated that the antiyeast activity was related to the combination of the oligosaccharide chain (S1, S2, or S3) with an O-methyl group at R(3) and the presence of a hydroxyl group at the C-2 position.

The individual chemical components of commercial extract of Gymnema sylvestre, a medicinal plant used in the traditional systems of the Indian medicine for its antidiabetic and hypolipidemic properties, were isolated and evaluated for their capability to act as modulators of nuclear and membrane receptors involved in glucose and lipid homeostasis. The study disclosed for the first time that individual gymnemic acids are potent and selective antagonists for the beta isoform of LXR. Indeed the above activity was shared by the most abundant aglycone gymnemagenin (10) whereas gymnestrogenin (11) was endowed with a dual LXRalfa/beta antagonistic profile. Deep pharmacological investigation demonstrated that gymnestrogenin, reducing the expression of SREBP1c and ABCA1 in vitro, is able to decrease lipid accumulation in HepG2 cells. The results of this study substantiate the use of Gymnema sylvestre extract in LXR mediated dislypidemic diseases

Background Gorgonians of the genus Eunicella are known for possessing a wide range of pharmacological activities such as antiproliferative and antibacterial effect. The aim of this study was to evaluate the anti-inflammatory and gastroprotective effect of the organic extract and its semi-purified fractions from the white gorgonian Eunicella singularis and the isolation and identification of pure compound(s) from the more effective fraction. Methods Anti-inflammatory activity was evaluated, using the carrageenan-induced rat paw edema test and in comparison to the reference drug Acetylsalicylate of Lysine. The gastroprotective activity was determined using HCl/EtOH induced gastric ulcers in rats. The purification of compound(s) from the more effective fraction was done by two chromatographic methods (HPLC and MPLC). The structure elucidation was determined by extensive spectroscopic analysis (1H and 13C NMR, COSY, HMBC, HMQC and NOESY) and by comparison with data reported in the literature. Results The evaluation of the anti-inflammatory activity of different fractions from Eunicella singularis showed in a dependent dose manner an important anti-inflammatory activity of the ethanol fraction, the percentage of inhibition of edema, 3 h after carrageenan injection was 66.12%, more effective than the reference drug (56.32%). In addition, this ethanolic fraction showed an interesting gastroprotective effect compared to the reference drugs, ranitidine and omeprazol. The percentage of inhibition of gastric ulcer induced by HCl/ethanol in rats was 70.27%. The percentage of the reference drugs (ranitidine and omeprazol) were 65 and 87.53%, respectively. The purification and structure elucidation of compound(s) from this ethanolic fraction were leading to the isolation of five sterols: cholesterol (5α-cholest-5-en-3β-ol) (1); ergosterol (ergosta-5,22-dien-3β-ol) (2); stigmasterol (24-ethylcholesta-5,22-dien-3b-ol) (3); 5α,8α-epidioxyergosta 6,22-dien-3β-ol (4) and 3β-hydroxy-5α,8α-epidioxyergosta-6-ene (5); and one diterpenoid: palmonine D (6). Conclusion Based on data presented here, we concluded that diterpenoids and sterols detected in the ethanolic fraction can be responsible for its pharmacological activity. Electronic supplementary material The online version of this article (doi:10.1186/s40199-014-0064-7) contains supplementary material, which is available to authorized users.

Nuclear and G-protein coupled receptors are considered major targets for drug discovery. FXR and GP-BAR1, two bile acid-activated receptors, have gained increasing consideration as druggable receptors. Because endogenous bile acids often target both receptor families, the development of selective ligands has been proven difficult, exposing patients to side effects linked to an unwanted activation of one of the two receptors. In the present study, we describe a novel library of semisynthetic bile acid derivatives obtained by modifications on the cholane scaffold. The pharmacological characterization of this library led to the discovery of 7α-hydroxy-5β-cholan-24-sulfate (7), 6β-ethyl-3α,7β-dihydroxy-5β-cholan-24-ol (EUDCOH, 26), and 6α-ethyl-3α, 7α-dihydroxy-24-nor-5β-cholan-23-ol (NorECDCOH, 30) as novel ligands for FXR and GP-BAR1 that might hold utility in the treatment of FXR and GP-BAR1 mediated disorders.