Search

Inflammation, axonal loss and demyelinating plaques in the brain, which are the background of multiple sclerosis, very often cause changes in speech or dysarthria, in a range from mild to so severe that they impair comprehension of speech by the interlocutor. As a consequence of multiple sclerosis, dysphagia can also occur. The aim of this paper is to present the speech and swallowing difficulties that result from multiple sclerosis, and the importance of assessing the speech and swallowing in people with multiple sclerosis. Th is article is descriptive and provides a comprehensive overview of the literature dealing with this topic. Speech difficulties impede daily functioning and are often the first sign that other people notice. Swallowing difficulties not only complicate daily life but, if not given sufficient attention, are a possible life-threatening consequence of multiple sclerosis. Assessment of speech and swallowing difficulties should be part of the clinical assessment in each person with multiple sclerosis. As multiple sclerosis progresses, so do speech and swallowing difficulties, and it is of utmost importance to provide appropriate treatment that can alleviate these difficulties. Speech-language pathologists should be part of a team making the diagnosis and providing treatment for a person with multiple sclerosis.

Pulmonary aspiration in the perioperative period carries the risk of significant morbidity and mortality. As such, guidelines have been developed with the hopes of minimizing this risk by recommending fasting from solids and liquids over a specified amount of time. Point-of-care ultrasound has altered the landscape of perioperative medicine; specifically, gastric ultrasound plays a pivotal role in perioperative assessment. Further, the advent of glucagon-like-peptide-1 receptor agonists, the widespread use of cannabis, and Enhanced Recovery program carbohydrate beverage presents new challenges when attempting to standardize fasting guidelines. This review synthesizes the literature surrounding perioperative fasting guidelines specifically with regard to the use of point-of-care ultrasound in assessing for gastric contents and minimizing the risk of aspiration.

Abstract Background/aim The development of bronchopleural fistula (BPF) remains the most severe complication of lung resection, especially after pneumonectomy. Studies provide controversial reports regarding the benefits of flap reinforcement of the bronchial stump (FRBS) in preventing BPF’s occurrence. Methods This is a retrospective cohort study of 558 patients that underwent lung resection in a 12-year period (from 2007 to 2018). Ninety patients (16.1%) underwent pneumonectomy. Patient follow-up period varied from 1 to 12 years. Results Out of 558 patients in this study, 468 (83.9%) underwent lobectomy, and the remnant underwent pneumonectomy. In 114 cases with lobectomy, only 24.4% had FRBS, meanwhile in 56 cases with pneumonectomy only 62.2% had FRBS. BPF occurred in 8 patients with lobectomy (1.7%) and in 10 patients with pneumonectomy (11.1%). Among cases with post-pneumonectomy BPF, 6 (10.7%) had FRBS performed, while no FRBS was performed among patients with post-lobectomy BPF, although these data weren’t statistically (p > 0.05). In 24 patients (20 lobectomies and 4 pneumonectomies) with lung cancer (10.4%) neoadjuvant treatment was performed, in which 20 patients underwent chemotherapy and 4 underwent radiotherapy. FRBS was applied in each of the above 24 operative cases, but only in 4 of them the BPF was verified. Conclusion The idea of enhancing the blood supply through the FRBS for BPF prevention has gain traction. Although FRBS has been identified as valuable and effective method in BPF prevention following lung resection, our study results did not support this evidence.

Nearly half of all type 2 diabetes cases in the United States are among individuals aged 65 years or older. Management of diabetes in this population requires special considerations. This article reviews the pharmacologic management of type 2 diabetes with these considerations in mind. Increasing life expectancies have underscored the importance of preventing long-term diabetes complications within the overall management strategy for elderly diabetic patients. Aggressive glycemic control is central to preventing such complications and may prove cost-effective. To maintain glycemic control, patients usually progress from initial dietary therapy to one and then two or more oral hypoglycemic medications in a stepwise fashion. Adjunctive insulin is eventually often required as well. The initial oral agent is usually either a sulfonylurea or metformin, although meal schedules and the risk of postprandial hyperglycemia may necessitate other choices. Avoiding hypoglycemia is of particular concern in the elderly, whereas the need for weight loss is usually of less concern. Above all, treatment of the elderly patient must be individualized for optimal care. [ABSTRACT FROM AUTHOR]

Dual-phase high-entropy alloys (DP-HEAs) with transformation induced plasticity (TRIP) have an excellent strength-ductility combination. To reveal their strain-rate sensitivity and hence further understand the corresponding deformation mechanisms, we investigated the tensile behavior and microstructural evolution of a typical TRIP-DP-HEA (Fe50Mn30Co10Cr10, at. %) under different strain rates (i.e., 5 × 10−3 s−1, 1 × 10−3 s−1, 5 × 10−4 s−1 and 1 × 10−4 s−1) at room temperature. The strain rate range was confined to this regime in order to apply the digital image correlation technique for probing the local strain evolution during tensile deformation at high resolution and to correlate it to the microstructure evolution. Grain size effects of the face-centered cubic (FCC) matrix and the volume fractions of the hexagonal-close packed (HCP) phase prior to deformation were also considered. The results show that within the explored strain rate regime the TRIP-DP-HEA has a fairly low strain rate sensitivity parameter within the range from 0.004 to 0.04, which is significantly lower than that of DP and TRIP steels. Samples with varying grain sizes (e.g., ~2.8 and 38 μm) and starting HCP phase fractions (e.g., ~25 and 72%) at different strain rates show similar deformation mechanisms, i.e., dislocation plasticity and strain-induced transformation from the FCC matrix to the HCP phase. The low strain rate sensitivity is attributed to the observed dominant displacive transformation mechanism. Also, the coarse-grained alloy samples with a very high starting HCP phase fraction (~72%) prior to deformation show very good ductility with a total elongation of ~60%, suggesting that both, the initial and the transformed HCP phase in the TRIP-DP-HEA are ductile and deform further via dislocation slip at the different strain rates which were probed.

Background: The incidence of proximal humerus fractures (PHFs) continues to increase with an aging population, and intramedullary nailing (IMN) and locking plate fixation are two commonly employed techniques for the surgical management of PHF. However, the optimal fixation method can be a source of ongoing controversy. Some influencing factors include the extent of humeral head involvement, fracture complexity, patient age, and surgeon preference. There are many studies that provide a mix of data either when comparing the two techniques or analyzing them in isolation. The aim of this review is to further elucidate the indications and technical considerations involved specifically in IMN vs. locking plate fixation for PHF to further aid orthopedic surgeons when choosing surgical management. Methods: A narrative approach was chosen for this review allowing for a comprehensive review of literature, including recent findings pertaining to the comparison of management options for PHF. A comprehensive literature search was conducted using the PubMed, Embase, and Cochrane Library databases. The inclusion criteria involved studies that discussed “proximal humerus fracture” and either “intramedullary nail” or “locking plate fixation.” Results: Complications such as avascular necrosis, hardware failure, additional surgical interventions, infection, fracture redisplacement, rotator cuff rupture, and nonunion did not show significant differences between the two groups. Newer generation humeral nails have minimized early complications. As both techniques undergo further refinement and utilization when specifically indicated, functional outcomes, potential complications, and postoperative pain continue to be improved. Conclusion: The available evidence suggests that both intramedullary nails and locking plates can effectively restore shoulder function in the treatment of displaced proximal humeral fractures, with unclear superiority of either method. The choice of technique should be tailored to patient factors such as fracture type, age, bone quality, and functional expectations. Surgeon experience also plays a role. While certain presentations may exhibit trends that favor one fixation, no specific technique can be universally recommended. Both IMN and LP have shown comparable and satisfactory outcomes, and the final fixation method chosen should take into account the unique characteristics of each patient.

JUSTIFICATIVA E OBJETIVOS: Alterações da mecânica pulmonar, diminuição da Capacidade Residual Funcional e formação de atelectasias têm sido descritas durante anestesia geral. O objetivo desta investigação foi avaliar de forma retrospectiva os padrões de ventilação mecânica adotados nas salas operatórias do Instituto Central do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HCFMUSP). MÉTODO: Foram registrados dados de 240 pacientes sob anestesia geral, curarizados em ventilação mecânica. Foram observados os padrões de ventilação aplicados: volume corrente em ml (VC), freqüência respiratória por minuto, pressões de vias aéreas em cmH2O e fluxo de gases frescos em L.min-1, SpO2 e P ET CO2. Dados demográficos: sexo, idade, peso, altura foram registrados e calculado o índice de massa corpórea (IMC). Os pacientes foram separados em grupos quanto ao IMC em: < 20; 20-25; 25-30; > 30 kg/m². RESULTADOS: Observou-se relação linear entre volume corrente (VC) e peso (r=0,640) e IMC (r=0,467). VC por peso corpóreo (ml.kg-1) mostrou-se inversamente relacionado ao IMC: IMC < 20 com 10,74 ± 1,39; IMC 20-25 em 9,67 ± 1,08; IMC 25-30 para 8,54 ± 1,09; IMC > 30 com 7,86 ± 1,26 (p < 0,001, ANOVA). Não houve diferença entre esses grupos para a freqüência respiratória instalada. No momento dos registros, homens (n = 123) e mulheres (n = 117) apresentaram semelhantes SpO2 e P ET CO2. O IMC foi semelhante em ambos os grupos. Utilizou-se pressão positiva no final da expiração (PEEP) em 78 dos procedimentos (33%). CONCLUSÕES: Estes dados descritivos permitem afirmar que os padrões de ventilação mecânica em anestesia no HCFMUSP adotam volume corrente próximo de 9 ml.kg-1, freqüência respiratória em 10 incursões por minuto. O uso de PEEP não é disseminado e, quando utilizado, está próximo de 4 cmH2O. Há correlação positiva para peso e IMC com VC. A relação entre VC por massa corpórea é inversamente relacionada ao IMC.

Abstract Background Rhizobium tropici CIAT 899 and Rhizobium sp. PRF 81 are α-Proteobacteria that establish nitrogen-fixing symbioses with a range of legume hosts. These strains are broadly used in commercial inoculants for application to common bean (Phaseolus vulgaris) in South America and Africa. Both strains display intrinsic resistance to several abiotic stressful conditions such as low soil pH and high temperatures, which are common in tropical environments, and to several antimicrobials, including pesticides. The genetic determinants of these interesting characteristics remain largely unknown. Results Genome sequencing revealed that CIAT 899 and PRF 81 share a highly-conserved symbiotic plasmid (pSym) that is present also in Rhizobium leucaenae CFN 299, a rhizobium displaying a similar host range. This pSym seems to have arisen by a co-integration event between two replicons. Remarkably, three distinct nodA genes were found in the pSym, a characteristic that may contribute to the broad host range of these rhizobia. Genes for biosynthesis and modulation of plant-hormone levels were also identified in the pSym. Analysis of genes involved in stress response showed that CIAT 899 and PRF 81 are well equipped to cope with low pH, high temperatures and also with oxidative and osmotic stresses. Interestingly, the genomes of CIAT 899 and PRF 81 had large numbers of genes encoding drug-efflux systems, which may explain their high resistance to antimicrobials. Genome analysis also revealed a wide array of traits that may allow these strains to be successful rhizosphere colonizers, including surface polysaccharides, uptake transporters and catabolic enzymes for nutrients, diverse iron-acquisition systems, cell wall-degrading enzymes, type I and IV pili, and novel T1SS and T5SS secreted adhesins. Conclusions Availability of the complete genome sequences of CIAT 899 and PRF 81 may be exploited in further efforts to understand the interaction of tropical rhizobia with common bean and other legume hosts.

Purpose: We assessed the sensibility, utility, and implementation considerations of the Short-Form HIV Disability Questionnaire (SF-HDQ) in community-based settings. Methods: We conducted a mixed-methods study with adults living with HIV and community providers in seven community sites in Canada. We administered the SF-HDQ, a sensibility questionnaire and conducted semi-structured interviews. The SF-HDQ was sensible if median scores were ≥5/7(adults living with HIV) and ≥4/7(community providers) for ≥80% of the sensibility questionnaire items. Qualitative interview data were analyzed using content analysis. Results: Median sensibility scores were ≥5 for adults living with HIV (n = 44) and ≥4 for community providers (n = 10) for 95% and 100% of items, respectively. The SF-HDQ is comprehensive, represented disability, captured its episodic nature, and was easy to complete. Community utility included: facilitating communication and engagement with community; taking a snapshot of disability and tracking changes over time; guiding referrals; fostering self-reflection; and informing community programs. Considerations for implementation included flexible, person-centered approaches to mode and processes of administration, and communicating scores based on personal preferences among persons living with HIV. Conclusion: The SF-HDQ possesses sensibility and utility for use in community-based settings.

Introduction: Cladribine was approved for Multiple Sclerosis (MS) in our country in 2018. A previous study by our group showed that its use among high efficacy therapies options has been increasing along the years., Objective: to analyze the cladribine use trend across time since its approval., Method: A retrospective cohort study was performed. People with MS (pwMS) treated with cladribine were included. Two periods were defined: P1 = 2018 - 2020 and P2 = 2021 - 2023. A comparative analysis was carry out between P1 and P2 to assess the trend of use, clinical/demographic characteristics, and effectiveness., Results: One hundred ninety- seven people with MS (pwMS) were included, mean EDSS: 2.2 ± 3.08, 72.6% female, mean age: 35.2 ± 9 years, mean disease duration: 6.6 ± 5.6 years, mean time lapse under cladribine: 26.1 ± 12.4 months. Regarding patient profile, we found significant differences between P1 and P2 in the MS evolution (p = 0.001) and EDSS ( p = 0.018) prior to initiation of cladribine. In the individualized analysis by year, we found a decrease in relapse number in the year prior to starting cladribine (p = 0.02). A higher proportion of No Evidence of Disease Activity (NEDA) was found in patients treated at P2 compared to those treated at P1 (p < 0.001)., Conclusion: An earlier use of cladribine achieved a significant increase in reaching NEDA. This learning curve in the use of cladribine allows a better identification of the candidate patient and influences the treatment effectiveness., Competing Interests: Declarations Ethics approval All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. The study was approved by the Ethics Committee of the institutions involved. Competing interests None of the authors present conflicts of interest in relation to this research., (© 2024. Fondazione Società Italiana di Neurologia.)

A new polerovirus, named "arachis mottle-associated virus" (ArMoV), was identified by high-throughput sequencing in a Pinto peanut (Arachis pintoi) plant. The genome sequence was confirmed by Sanger sequencing and contains 5775 nucleotides and seven predicted open reading frames (ORFs), showing a typical polerovirus genome structure. All of the proteins encoded by ArMoV showed less than 90% amino acid sequence identity to those of other poleroviruses, the threshold to establish a new species in the genus. Phylogenetic analysis based on P1-P2 fusion protein and coat protein amino acid sequences showed that tobacco polerovirus 1 and chickpea chlorotic stunt virus, respectively, were the most closely related to ArMoV. These data suggest that ArMoV is a member of a new species of the genus Polerovirus, for which the binomial name "Polerovirus ARMOV " is proposed., Competing Interests: Declarations Conflict of interest The authors declare that they have no conflicts of interest. Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Introduction: There are no reports in LATAM related to longitudinal humoral and cellular response to adenovirus based COVID-19 vaccines in people with Multiple Sclerosis (pwMS) under different disease modifying therapies (DMTs) and neutralization of the Omicron and Wuhan variants of SARS-COV-2., Methods: IgG anti- SARS-COV-2 spike titer were measured in a cohort of 101 pwMS under fingolimod, dimethyl fumarate, cladribine and antiCD20, as well as 28 healthy controls (HC) were measured 6 weeks after vaccination with 2 nd dose (Sputnik V or AZD1222) and 3 nd dose (homologous or heterologous schedule). Neutralizing capacity was against Omicron (BA.1) and Wuhan (D614G) variants and pseudotyped particles and Cellular response were analyzed., Results: Multivariate regression analysis showed anti-cd20 (β= -,349, 95% CI: -3655.6 - -369.01, p=0.017) and fingolimod (β=-,399, 95% CI: -3363.8 - -250.9, p=0.023) treatments as an independent factor associated with low antibody response (r 2 adjusted=0.157). After the 2nd dose we found a correlation between total and neutralizing titers against D614G (rho=0.6; p<0.001; slope 0.8, 95%CI:0.4-1.3), with no differences between DMTs. Neutralization capacity was lower for BA.1 (slope 0.3, 95%CI:0.1-0.4). After the 3rd dose, neutralization of BA.1 improved (slope: 0.9 95%CI:0.6-1.2), without differences between DMTs. A fraction of pwMS generated anti-Spike CD4+ and CD8+ T cell response. In contrast, pwMS under antiCD20 generated CD8+TNF+IL2+ response without differences with HC, even in the absence of humoral response. The 3rd dose significantly increased the neutralization against the Omicron, as observed in the immunocompetent population., Discussion: Findings regarding humoral and cellular response are consistent with previous reports., Competing Interests: The authors declare that this study received funding from Novartis and donations from Merck Argentina and Synthon Bagó. The funders were not involved in the study design, collection, analysis, interpretation of data, the writing of this article or the decision to submit it for publication. Author Berenice Anabel Silva, as principal investigator, received a 2-year research grant from the Research Council of the Ministry of Health of the Government of the City of Buenos Aires, Argentina., (Copyright © 2024 Silva, Miglietta, Casabona, Wenker, Eizaguirre, Alonso, Casas, Lázaro, Man, Portuondo, Lopez Bisso, Zavala, Casales, Imhoff, Steinberg, López, Carnero Contentti, Deri, Sinay, Hryb, Chiganer, Leguizamon, Tkachuk, Bauer, Ferrandina, Giachello, Henestroza, Garcea, Pascuale, Heitrich, Podhajcer, Vinzón, D’Alotto-Moreno, Benatar, Rabinovich, Pitossi and Ferrari.)

Objective: The purpose of this study was to describe the factors related to dizziness in workers with noise-induced hearing loss in Brazil., Method: A cross-sectional study was carried out with a sample from noise-induced hearing loss reports (2007-2019). The dependent variable in this study was dizziness, and the independent variables were sociodemographic characteristics, comorbidities, symptoms, and noise characteristics in the work environment. Logistic regression analysis was performed., Results: A total of 3,824 individuals with noise-induced hearing loss in Brazil were analyzed. The prevalence of dizziness was 23.4% in the sample. Factors associated with dizziness were women (odds ratio [ OR ]: 2.10; 95% confidence interval [CI] [1.64, 2.69]), hypertension ( OR : 1.68; 95% CI [1.38, 2.06]), headache ( OR : 6.31; 95% CI [5.26, 7.57]), tinnitus ( OR : 3.46; 95% CI [2.82, 4.25]), and continuous noise at the work environment ( OR : 1.54; 95% CI [1.22, 1.94])., Conclusions: The factors associated with the outcome-dizziness-were gender (female), systemic arterial hypertension, headache, tinnitus, and continuous exposure to workplace noise. Such findings demonstrate the importance of promoting a multifactorial approach to understanding dizziness among workers exposed to occupational noise.

Objective: To evaluate the efficacy and safety of nonpharmacological topical interventions for treating breastfeeding nipple pain. Methods: Randomized clinical trials (RCTs) assessing lactating women suffering from breastfeeding painful nipples were included. Primary outcomes were pain, healing process, and adverse events. A comprehensive search was conducted on June 02, 2023, without date or language restrictions. Methodological quality was assessed using the Cochrane risk of bias tool and the certainty of the evidence, the GRADE approach. Results: Nineteen RCTs with unclear to high risk of bias were included. There was uncertain evidence regarding the effects of photobiomodulation versus placebo on pain reduction (mean difference [MD] -0.15; 95% confidence interval [95% CI] -1 0.49 to 1.19; 139 participants, 2 RCTs). There are uncertainties concerning the effects of lanolin versus breast milk on pain (MD -1.80; 95% CI -2.43 to -1.17; 1 RCT; 180 participants), wound healing (MD 0.10; 95% CI -0.26 to -0.46; 1 RCT; 180 participants), and any adverse events (zero events in both groups). Similar effects were observed by the other interventions assessed. Conclusion: The evidence of nonpharmacological topical interventions for painful nipples is imprecise, and future RCTs with higher methodological quality are needed to support recommendations. Considering the accessibility and low cost of these alternative treatments, the findings of this evidence synthesis could support clinical decision-making and guide future research. PROSPERO CRD42020170320.

Fonsecaea pedrosoi is a melanized fungus that causes chromoblastomycosis (CBM), a tropical neglected disease responsible for chronic and disability-related subcutaneous mycosis. Given the challenging nature of CBM treatment, the study of new targets and novel bioactive drugs capable of improving patient life quality is urgent. In the present work, we detected a calcineurin activity in F. pedrosoi conidial form, employing primarily colorimetric, immunoblotting and flow cytometry assays. Our findings reveal that the calcineurin activity of F. pedrosoi was stimulated by Ca 2+ /calmodulin, inhibited by EGTA and specific inhibitors, such as tacrolimus (FK506) and cyclosporine A (CsA), and proved to be insensitive to okadaic acid. In addition, FK506 and CsA were able to affect the cellular viability and the fungal proliferation. This effect was corroborated by transmission electron microscopy that showed both calcineurin inhibitors promoted profound changes in the ultrastructure of conidia, causing mainly cytoplasm condensation and intense vacuolization that are clear indication of cell death. Our data indicated that FK506 exhibited the highest effectiveness, with a minimum inhibitory concentration (MIC) of 3.12 mg/L, whereas CsA required 15.6 mg/L to inhibit 100% of conidial growth. Interestingly, when both were combined with itraconazole, they demonstrated anti-F. pedrosoi activity, exhibiting a synergistic effect. Moreover, the fungal filamentation was affected after treatment with both calcineurin inhibitors. These data corroborate with other calcineurin studies in fungal cells and open up further discussions aiming to establish the role of this enzyme as a potential target for antifungal therapy against CBM infections., (© 2024. The Author(s) under exclusive licence to Sociedade Brasileira de Microbiologia.)

This study evaluated the effects of broiler age (A) and levels of replacement (L) of control diet (CD) on the utilization of energy and nutrients of whole corn germ. 720 one-day-old broilers (b) were allocated at completely randomized design to six treatments and six replicates, in three assays: pre-starter (1-8 days, 10 b/cage), starter (15-22 days, 6 b/cage), and grower (28-35 days, 4 b/cage) phases. The treatments were: CD and four test diets (L): 100, 150, 200, 250, or 300 g kg-1 of the CD replaced by WCG levels. The data were adjusted to the response surface model. The stationary points for apparent energy metabolizable (AME) and AME corrected for nitrogen balance (AMEn) were: 4173 and 3591 kcal kg-1, respectively, and coefficients of gross energy (AMCGE), crude protein (AMCCP), dry matter (AMCDM), and ether extract (AMCEE) were: 49.3, 40.4, 72.6, and 61.3%, respectively; and Ileal digestibility coefficient of crude protein (IDCCP), dry matter (IDCDM), digestibility crude protein values (DCP), and digestibility dry matter value (DDM) were: 78.0, 57.96, 8.50, and 56.17%, respectively. The EP for AMEn was at 18 days of age, 28 g kg-1 WCG. There was a correlation between A and L on digestibility and metabolisability of nutrient's WCG.

Background: To outline the current evidence on root morphological changes after enlarging the apical foramen with NiTi instruments., Material and Methods: A search was performed in the Virtual Health Library, PubMed, EMBASE, Scopus, Web of Science, Science Direct and SciELO databases, in addition to a manual search in Google Scholar, between January 2017 and October 2023. Articles published in English that describe in vitro studies investigating root morphological changes after instrumentation 1 mm beyond the major apical foramen were included. The quality of evidence in the included studies was also analyzed., Results: The search retrieved 367 articles. Of these, four studies were eligible for data synthesis and analysis, all of them in vitro studies. Synthesis of the results of these in vitro studies showed a larger number of root morphological changes such as experimental dentinal microcraks in samples submitted to instrumentation beyond the apical foramen when compared to micro-CT images obtained before preparation., Conclusions: The in vitro studies analyzed in this scoping review indicate that instrumentation beyond the major foramen of the root canal, promotes morphological changes in this area and that the adoption of standardized methodologies would not only increase the accurate detection and characterization of these changes but also facilitate the application of these findings in clinical trials and patient care. Key words: Endodontics, apical morphology, root canal preparation., Competing Interests: The authors declares that there are no conflicts of interest regarding the publication of this scoping review., (Copyright: © 2024 Medicina Oral S.L.)

Watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2, both belonging to the genus Coguvirus (family Phenuiviridae), have been identified in watermelon plants in Brazil. To study tissue tropism and the potential for seed transmission of these viruses, we initially planned to produce specific antibodies. However, difficulties in isolating and propagating the virus in host plants hindered the purified virus preparations. To overcome this problem, the nucleocapsid (N) proteins of WCLaV-1 and -2 were produced using the pepper ringspot virus vector. The N protein genes and the vector backbone were prepared by (RT-)PCR and ligated by Gibson assembly. The constructs were agro-infiltrated in Nicotiana benthamiana plants. The expressed N proteins were purified and used for polyclonal antibody production. The specificity of both antibodies was confirmed by antigen-coating ELISA, tissue-blot immunobinding assay and Western blot. By antigen-coating ELISA demonstrated that WCLaV-1 showed 93.1% of seed-transmission, while WCLaV-2 showed only 17.8%. The N protein of WCLaV-1 was detected in the cytoplasm of the seed tissues. It was also found in the nuclei of the radicle, as confirmed by confocal microscopy. We concluded that the antibodies exhibited both a high titer and sufficient specificity for use in ELISA-based diagnostics and for subcellular localization study., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Background and Objectives: Primary-progressive multiple sclerosis (PPMS) is characterized by gradual neurological deterioration without relapses. This study aimed to investigate the clinical impact of gender and age at disease onset on disease progression and disability accumulation in patients with this disease phenotype., Methods: Secondary data from the RelevarEM registry, a longitudinal database in Argentina, were analyzed. The cohort comprised patients with PPMS who met inclusion criteria. Statistical analysis with multilevel Bayesian robust regression modeling was conducted to assess the associations between gender, age at onset, and Expanded Disability Status Scale (EDSS) score trajectories., Results: We identified 125 patients with a confirmed diagnosis of PPMS encompassing a total of 464 observations. We found no significant differences in EDSS scores after 10 years of disease progression between genders (-0.08; credible interval (CI): -0.60, 0.42). A 20-year difference in age at onset did not show significant differences in EDSS score after 10 years of disease progression (0.281; CI: -0.251, 0.814). Finally, we also did not find any clinically relevant difference between gender EDSS score with a difference of 20 years in age at onset (-0.021; CI: -0.371, 0.319)., Conclusion: Biological plausibility of gender and age effects does not correlate with clinical impact measured by EDSS score., Competing Interests: Declaration of Conflicting InterestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Oral diseases are one of the biggest public health problems worldwide, caused by opportunistic pathogens such as Streptococcus mutans and Enterococcus faecalis . Cyperus articulatus (priprioca) is a plant conventionally used in traditional medicine in the Amazon region. However, little is known about the possible dentistry-related uses of extracts from the rhizomes and solid waste generated by the extraction of essential oils from this vegetable. This study aimed to investigate the chemical composition of volatile compounds and antimicrobial activity through the Minimum Inhibitory Concentration test (MIC and assessment of the toxicity by Hens Egg Test-Chorion Allantoic Membrane (HET-CAM) of the ethanolic extracts from Cyperus articulatus intact rhizomes and solid waste. We identified sesquiterpenes as the main constituents, strong antimicrobial activity of the ethanolic extract of intact rhizomes against S. mutans (MIC = 0.29 mg/mL), moderate antimicrobial activity against E. faecalis of the extract obtained from the solid waste (MIC = 1.17 mg/mL), and absence of toxicity for both tested extracts. The absence of irritation and the antibacterial activity of the ethanolic extract from C. articulatus rhizomes and solid waste reveal its potential for use in the alternative control of bacteria that cause oral infections and may present economic viability as a raw material for dental products.

Objectives: The aim of this study was to assess the prevalence of Temporomandibular Disorders (TMD) in subjects with skeletal class II dentofacial deformity referred for orthognathic surgery, as well as to elucidate its association with sociodemographic and psychosocial features., Methods: This was a cross-sectional study using the Research Diagnostic Criteria for Temporomandibular Disorders. The sample comprised class II skeletal patients referred to an Oral and Maxillofacial Surgery center in the Brazilian Northeast., Results: Seventy-three subjects were enrolled and completed the data collection, which consisted of a physical examination according to Axis I of the Research Diagnostic Criteria for Temporomandibular Disorders and facial analysis. Women represented 82.2% of the sample. Among the assessed subjects, 68.5% were already undergoing orthodontic treatment, and the mean overjet of patients was 6.97 mm. The prevalence of TMD in this sample was 46.6%, with muscular disorders being the most common. Patients with an anteroposterior discrepancy greater than 7 mm showed a higher occurrence of TMD (p = 0.017)., Conclusion: This study demonstrated a high prevalence of TMD in skeletal class II patients referred for orthognathic surgery, especially in those with a pronounced overjet, being Group I (muscular disorders) and Group III (degenerative disorders) the most prevalent., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 Suassuna et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

The clinical aspects and lineages involved in Extraintestinal pathogenic Escherichia coli (ExPEC) infections in dogs remain largely unknown. In this study, we investigated the antimicrobial resistance and molecular structures of ExPECs isolated from infected dogs in Brazil. Samples were obtained from dogs (n = 42) with suspected extraintestinal bacterial infections. Phylogroup B2 was predominant (65.1%). No association was observed between the site of infection, phylogroups, or virulence factors. Almost half of the isolates (44.2%) were MDR, and 20.9% were extended-spectrum β-lactamase (ESBL)-positive. E. coli isolates that were resistant to fluoroquinolones (27.9%) were more likely to be MDR. The CTX-M-15 enzyme was predominant among the ESBL-producing strains, and seven sequence types were identified, including the high-risk clones ST44 and ST131. Single SNPs analysis confirmed the presence of two clonal transmissions. The present study showed a high frequency of ExPECs from phylogroup B2 infecting various sites and a high frequency of ESBL-producing strains that included STs frequently associated with human infection. This study also confirmed the nosocomial transmission of ESBL-producing E. coli, highlighting the need for further studies on the prevention and diagnosis of nosocomial infections in veterinary settings., Competing Interests: Declaration of Competing Interest The authors declare that they have no conflicts of interest., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

The Amazon has a wide variety of oilseeds that generate a huge amount of co-products with potential for use in animal nutrition. The objective was to use alternative resources (oilseed cakes) in the feeding of lambs to assign a sustainable destination to this biomass, and evaluate its influence on the quality and fatty acid (FA) profile of the meat. Twenty-four lambs, male, castrated, crossbred Dorper × Santa Inês, weighing 30 ± 1.3 kg of initial body weight, were distributed in a completely randomized design in 4 treatments (diets) with six replications (animals). The control diet (Control) contained corn and soybean meal as main ingredients, which were partially replaced in the other diets by cupuassu cake diet (Cup), palm kernel cake diet (Palm) and tucuma cake diet (Tuc). The inclusion of Amazon cakes influences the lipid (P = 0.02) and protein (P < 0.01) composition of meat (longissimus lumborum); reduces cooking losses (P < 0.01); influences the colors (L, a, b), chroma, and Hue Angle (P < 0.01); promotes changes in total FA composition and FA profile (P < 0.05); reduces hypocholesterolemic FA (h) (P = 0.01), but does not influence hypercholesterolemic (H) and indices h:H, AI and TI (P > 0.05). The inclusion of oilseed cakes influences the chemical composition, physical parameters, composition and fatty acid profile of the meat, but does not influence the indicators of atherogenicity, thrombogenicity and cholesterolemia., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2023 de Castro et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

Streptococcus agalactiae is a major health concern in tilapia farming worldwide. In contrast to the availability of susceptibility profile results, interpretative criteria for disk diffusion assays and the influence of serotypes on resistance profiles are not available. To address this, sixty isolates (thirty of each serotype, Ib and III) were evaluated using the disk diffusion assay against six antibiotics, and the epidemiological cut-off value (ECV) was calculated. All the isolates were classified as non-wild type (NWT) for sulfamethoxazole (SUT) and norfloxacin (NOR). The inhibition zones for oxytetracycline (OXY) and doxycycline (DOX) were largely distinct; all serotype Ib and III isolates were classified as wild-type (WT) and NWT, respectively. The results for serotype III of fish group B Streptococcus (GBS) were comparable to the NWT tetracycline profile of human GBS available in EUCAST, suggesting the presence of resistance mechanisms in these fish isolates. The calculation of the cut-off wild type (CO WT ) values for OXY and DOX was appropriate for both serotypes. Differences between the distribution of florfenicol (FLO) and amoxicillin (AMO) were found, and we attribute this to the faster growth rate of serotype III, which promotes smaller inhibition zones. Therefore, using separate CO WT for each serotype is necessary. In conclusion, the serotype of fish GBS affects its susceptibility profile, and it is recommended to use serotype-specific CO WT values as interpretative criteria for disk diffusion assays against FLO and AMO.

Scedosporium apiospermum is a widespread, emerging, and multidrug-resistant filamentous fungus that can cause localized and disseminated infections. The initial step in the infection process involves the adhesion of the fungus to host cells and/or extracellular matrix components. However, the mechanisms of adhesion involving surface molecules in S. apiospermum are not well understood. Previous studies have suggested that the binding of fungal receptors to fibronectin enhances its ability to attach to and infect host cells. The present study investigated the effects of fibronectin on adhesion events of S. apiospermum. The results revealed that conidial cells were able to bind to both immobilized and soluble human fibronectin in a typically dose-dependent manner. Moreover, fibronectin binding was virtually abolished in trypsin-treated conidia, suggesting the proteinaceous nature of the binding site. Western blotting assay, using fibronectin and anti-fibronectin antibody, evidenced 7 polypeptides with molecular masses ranging from 55 to 17 kDa in both conidial and mycelial extracts. Fibronectin-binding molecules were localized by immunofluorescence and immunocytochemistry microscopies at the cell wall and in intracellular compartments of S. apiospermum cells. Furthermore, a possible function for the fibronectin-like molecules of S. apiospermum in the interaction with host lung cells was assessed. Conidia pre-treated with soluble fibronectin showed a significant reduction in adhesion to either epithelial or fibroblast lung cells in a classically dose-dependent manner. Similarly, the pre-treatment of the lung cells with anti-fibronectin antibodies considerably diminished the adhesion. Collectively, the results demonstrated the presence of fibronectin-binding molecules in S. apiospermum cells and their role in adhesive events., (© 2023. The Author(s) under exclusive licence to Sociedade Brasileira de Microbiologia.)

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

Edwardsiella tarda is a crucial pathogenic bacterium in tropical aquaculture. This bacterium was recently isolated from tambaqui ( Colossoma macropomum ), a commercially important fish species in Brazil. This study assessed the antimicrobial susceptibility, pathogenicity, and genetic diversity of the tambaqui-derived E. tarda isolates. Fourteen bacterial isolates isolated from tambaqui were identified as E. tarda by using matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry and dnaJ gene sequencing. Antimicrobial susceptibility tests were conducted against seven drugs using the disc diffusion assay. The pathogenicity test conducted by intraperitoneal injection of 2.4 × 10 7 colony-forming units (CFU) fish -1 of E. tarda (ED38-17) into tambaqui juveniles eventually revealed that neither clinical signs nor death were present. However, splenomegaly and whitish areas in the spleen and kidneys were observed. The histological investigation also revealed granulomatous splenitis, nephritis, and hepatitis occurring internally. Repetitive extragenic palindromic-PCR fingerprinting separated the 14 isolates into three genetic groups. The antibiogram revealed that all E. tarda isolates were wild-type (WT) to florfenicol (FLO), norfloxacin (NOR), neomycin (NEO), erythromycin (ERY), and oxytetracycline (OXY); however, some were non-wild-type to sulfamethoxazole/trimethoprim (7.1%) and amoxicillin (21.4%). Therefore, through experimental infection, E. tarda ED38-17 could induce pathogenic effects in C. macropomum . Additionally, three distinct genetic types were found, and the E. tarda isolates were WT to FLO, NOR, NEO, ERY, and OXY. These findings raise awareness of a bacteria causing unseen lesions, a pathogen that will potentially impact tambaqui aquaculture in the future.

Introduction: The emergence of several therapeutic options in multiple sclerosis (MS), which significantly modify the immune system functioning, has led to the need for the consideration of additional factors, such as risk of infections, in the decision-making process. The aim of these consensus recommendations was to discuss and perform a practical guide to Latin American neurologists on the risk of infections at diagnosis, follow-up and prior to initiation of DMDs., Methods: A panel of Latin American neurologists, experts in demyelinating diseases and dedicated to management and care of MS patients, gathered during 2021 and 2022 to make consensus recommendations on the risk of infections in PwMS treated with DMDs in Latin America. The RAND/UCLA methodology was developed to synthesize the scientific evidence and expert opinions on health care topics and was used for reaching a formal agreement., Results: Recommendations were established based on relevant published evidence and expert opinion, focusing on: 1- baseline infection disease and vaccination status; 2- opportunistic infections; 3- progressive multifocal leukoencephalopathy; 4- genitourinary system infections; 5- respiratory tract infections; 6- digestive system infections, 7-others local infections and 8- COVID-19., Conclusion: The recommendations of this consensus seek to optimize the care, management and treatment of PwMS in Latin America. The standardized evidence-based care of pwMS infections will allow better outcomes., Competing Interests: Declaration of Competing Interest BAS has received personal compensation for consulting, congresses, serving on a scientific advisory board, speaking, or other research activities with Biogen-Idec, Genzyme, Merck-Serono, Novartis, Teva, Roche, Bristol Myers Squibb, LACTRIMS, International Society For Neurochemistry, International Brain and Research Organization. ECC has received personal compensation for consulting, serving on a scientific advisory board, speaking, or other activities with Biogen-Idec, Genzyme, Merck-Serono, Novartis, Teva, Roche, LACTRIMS and the Guthy-Jackson Charitable Foundation. RA has received personal compensation for consulting, serving on a scientific advisory board, speaking, or other activities with Biogen-Idec, Genzyme, Merck-Serono, Novartis, Bristol Myers Squibb, Janssen, Roche and LACTRIMS. PAL has received personal compensation for consulting, serving on a scientific advisory board, speaking, or other activities with Biogen-Idec, Genzyme, Merck-Serono, Novartis, Bristol Myers Squibb, Raffo, Roche, Teva, and LACTRIMS. MFF has received personal compensation for consulting, serving on a scientific advisory board, speaking, or other activities with Biogen-Idec, Merck-Serono, Novartis, Teva. MFF is CEO and co-founder of Entelai LLC. OG has received personal compensation for consulting, congresses, serving on a scientific advisory board, speaking, or other research activities with Biogen-Idec, Merck-Serono, Novartis, Roche, Bristol Myers Squibb, LACTRIMS, Synthon Bago, Raffo. Rest of the authors had nothing to disclose., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Fear responses are functionally adaptive behaviors that are strengthened as memories. Indeed, detailed knowledge of the neural circuitry modulating fear memory could be the turning point for the comprehension of this emotion and its pathological states. A comprehensive understanding of the circuits mediating memory encoding, consolidation, and retrieval presents the fundamental technological challenge of analyzing activity in the entire brain with single-neuron resolution. In this context, we develop the brain-wide neuron quantification toolkit (BRANT) for mapping whole-brain neuronal activation at micron-scale resolution, combining tissue clearing, high-resolution light-sheet microscopy, and automated image analysis. The robustness and scalability of this method allow us to quantify the evolution of activity patterns across multiple phases of memory in mice. This approach highlights a strong sexual dimorphism in recruited circuits, which has no counterpart in the behavior. The methodology presented here paves the way for a comprehensive characterization of the evolution of fear memory., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2023 The Author(s). Published by Elsevier Inc. All rights reserved.)

The anterior cingulate cortex (ACC) plays a crucial role in encoding, consolidating and retrieving memories related to emotionally salient experiences, such as aversive and rewarding events. Various studies have highlighted its importance for fear memory processing, but its circuit mechanisms are still poorly understood. Cortical layer 1 (L1) of the ACC might be a particularly important site of signal integration, since it is a major entry point for long-range inputs, which is tightly controlled by local inhibition. Many L1 interneurons express the ionotropic serotonin receptor 3a (5HT3aR), which has been implicated in post-traumatic stress disorder and in models of anxiety. Hence, unraveling the response dynamics of L1 interneurons and subtypes thereof during fear memory processing may provide important insights into the microcircuit organization regulating this process. Here, using 2-photon laser scanning microscopy of genetically encoded calcium indicators through microprisms in awake mice, we longitudinally monitored over days the activity of L1 interneurons in the ACC in a tone-cued fear conditioning paradigm. We observed that tones elicited responses in a substantial fraction of the imaged neurons, which were significantly modulated in a bidirectional manner after the tone was associated to an aversive stimulus. A subpopulation of these neurons, the neurogliaform cells (NGCs), displayed a net increase in tone-evoked responses following fear conditioning. Together, these results suggest that different subpopulations of L1 interneurons may exert distinct functions in the ACC circuitry regulating fear learning and memory., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Fossati, Kiss-Bodolay, Prados, Chéreau, Husi, Cadilhac, Gomez, Silva, Dayer and Holtmaat.)

Introduction: The increase in availability and nutritional composition of oilseed co-products has made it essential to study the use of this biomass., Methods: The objective of this work was to investigate the effects of including oilseed cakes on intake and digestibility, performance, carcass characteristics and meat sensory in feedlot lambs. Twenty-four crossbred Dorper × Santa Inês lambs, with initial body weight of 30 ± 1.3 kg, male, castrated, aged 4-5 months, were distributed in a completely randomized experimental design with four treatments (diets) and six replications (animals), confined in individual stalls for 70 days., Results: The inclusion of tucuma cake (Tuc) reduced dry matter intake ( p  < 0.01) and diets with cupuassu cake (Cup) and palm kernel cake (Palm) reduced dry matter digestibility ( p  < 0.05). The Tuc diet also provided the lowest final body weight ( p  = 0.02); lower average daily gain ( p  = 0.03); lower feed efficiency ( p  = 0.03) and lower carcass weight ( p  < 0.01). However, diets did not influence carcass yield (%), fat thickness (mm) and loin eye area (cm 2 ; p  > 0.05). Meat from lambs on the control diet was rated as less fibrous and more tender ( p  < 0.05)., Conclusion: The inclusion of tucuma cake does not influence digestibility, but reduces intake, performance and influences carcass characteristics and meat texture. Diets with cupuassu cake or palmiste cake reduced digestibility, however, intake, performance and carcass characteristics were similar to the control diet., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 de Castro, Budel, Rodrigues, Silva, de Lima, de Souza, da Silva, Joele, Silva and Lourenço-Junior.)

Background: Social support is crucial for persons with multiple sclerosis (MS). We sought to analyze differences in perceived social support in persons with MS vs controls; to study associations between perceived social support, clinical measures, and health-related quality of life (HRQOL) variables in persons with MS; and to establish a predictive value of perceived social support for HRQOL., Methods: We studied 151 persons with MS (mean ± SD: age, 42.01 ± 9.97 years; educational level, 14.05 ± 3.26 years) and 89 controls (mean ± SD: age, 41.46 ± 12.25 years; educational level, 14.60 ± 2.44 years) using the Medical Outcomes Study Social Support Survey (MOS-SSS), Expanded Disability Status Scale, Fatigue Severity Scale, Beck Depression Inventory, and Multiple Sclerosis International Quality of Life (MusiQoL) questionnaire. Parametric and nonparametric statistical methods were used accordingly; P < .05., Results: Persons with MS exhibited lower scores on the MOS-SSS's overall support index ( t 238 = -1.98, P = .04) and on each functional subscale ( t 238 = -2.56 to -2.19, P < .05). No significant differences were found on the social support structural component ( P > .05). Significant associations were observed between social support and depression and fatigue ( r = -0.20 to -0.29, P < .05) and with MusiQoL dimensions ( r = -0.18 to 0.48, P < .05). Multiple regression analysis showed all 4 tested models contributed to HRQOL-explained variance (41%-47%). The emotional/informational support model explained the most HRQOL variability (47%)., Conclusions: Persons with MS perceived reduced social support, presenting lower functional scores than controls. Perceived social support proved to be a predictor of HRQOL. These findings should be considered during therapeutic treatment., Competing Interests: FINANCIAL DISCLOSURES: The authors declare no conflicts of interest., (© 2023 Consortium of Multiple Sclerosis Centers.)

Introduction: Antimicrobial resistance (AMR) is one of the greatest threats to animal and public health. Clostridioides (prev. Clostridium) difficile is a major burden to healthcare and a relevant AMR gene reservoir. Despite the known importance of AMR in C. difficile epidemiology and treatment, antimicrobial susceptibility testing for this pathogen is still based on the determination of the minimal inhibitory concentration (MIC) by the agar dilution method, which is technically demanding and labor-intensive. In this study, the disk diffusion method was used to evaluate the susceptibility of C. difficile to erythromycin, rifampicin, and tetracycline., Material and Methods: A total of 155 isolates isolated between 2011 and 2022 from humans and animals in Brazil were simultaneously tested using the disk diffusion method and the epsilometer test (Etest) for these three antimicrobials on Brucella blood agar supplemented with vitamin K and hemin., Results: The results suggest that disk diffusion can be an interesting routine tool to identify erythromycin- and rifampicin-resistant C. difficile isolates (≥20 mm cut-off) and wild type (WT) strains (≥28 mm). However, the disk diffusion protocol tested in this study does not seem suitable for tetracycline because of the common misclassification of resistant strains., Competing Interests: Declaration of competing interest The authors declare that they have no conflicts of interest., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Traumatic events generate some of the most enduring memories, yet little is known about how long-lasting fear memories can be attenuated. In this review, we collect the surprisingly sparse evidence on remote fear memory attenuation from both animal and human research. What is becoming apparent is twofold: although remote fear memories are more resistant to change compared with recent ones, they can nevertheless be attenuated when interventions are targeted toward the period of memory malleability instigated by memory recall, the reconsolidation window. We describe the physiological mechanisms underlying remote reconsolidation-updating approaches and highlight how they can be enhanced through interventions promoting synaptic plasticity. By capitalizing on an intrinsically relevant phase of memory, reconsolidation-updating harbors the potential to permanently alter remote fear memories., Competing Interests: Declaration of interests None declared by authors., (Copyright © 2023 The Author(s). Published by Elsevier Ltd.. All rights reserved.)

Bovine mastitis is one of the most frequent diseases in dairy cattle worldwide. The use of antiseptics in milking, if properly used, can lead to a reduction in potentially pathogenic microorganisms and their transmission between herds. Several medicinal plants have antiseptic potential, including eucalyptus (Eucalyptus spp.). Therefore, the objective of this study was to evaluate the effectiveness of wood vinegar from Eucalyptus urograndis clone GG I144 (EU) as an antiseptic in vitro and in vivo; in addition, to its cytotoxicity and antimicrobial resistance. Fifteen bovines were used, lactating females 3-6 years of age and divided into three groups of five animals each. The wood vinegar was placed in the teats of the animal for 28 days and collections of cellular debris were performed every 7 days. At the Veterinary Microbiology Laboratory (LAMIV) of UFERSA, the samples were processed and serial dilution was performed in Petri plates with plate count agar (PCA) at 37 °C. Cytotoxicity was verified based on morphological alterations and metabolic activity. Morphological changes were not observed in all cells incubated with 1 % pyroligneous extract. The in vitro data demonstrated antimicrobial activity against S. aureus, S. agalactiae, Salmonella, E. coli and P. aeruginosa. The bacteria of the genus Staphylococcus and Corynebacterium were resistant to penicillin (PEN), rifampicin (RIF), nitrofurantoin (NIT), erythromycin (ERI), and ciprofloxacin (CIP). The extract was used in vivo in the post-dipping of dairy cows, which reduced the microbiological load present in the mammary glands from 4.74 to 2.54 CFU, indicating its future use as an antiseptic., Competing Interests: Declaration of Competing Interest The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Introduction: Neuromyelitis optica spectrum disorder (NMOSD) is a rare but severe neuroimmunological condition associated with a significant financial burden. NMOSD is also associated with increased health care utilization, including neurology outpatient visits, magnetic resonance imaging (MRI) use, long-term medication, among others. We aimed to evaluate real-world patient experiences in access to care and NMOSD burden in an Argentinean cohort., Methods: This cross-sectional study used a self-administered survey and was conducted in Argentina (2022). Patients with NMOSD were divided into three groups: private health insurance (PHI), social health insurance (SHI), and public health insurance (PHI, Ministry of Public Health). Differences in access and health care barriers were assessed., Results: One hundred patients with NMOSD (74 women) with a mean age at diagnosis of 38.7 years were included. Their EDSS was 2.8 and they were followed for 5.2 years. Of them, 51%, 11%, and 13% were employed (full-time: 57.5%), currently unemployed and retired by NMOSD, respectively. 55% of them visited between 2-3 specialists before NMOSD diagnosis. Aquaporin-4-antibody and/or myelin oligodendrocyte glycoprotein-antibody testing was requested in 91% (health insurance covered this partially in 15.3% and 32.9% of the time the test was entirely paid by patient/family). Patients with NMOSD receiving private medical care reported greater access to MRI, outpatient visits, and fewer issues to obtain NMOSD medications compared to those treated at public institutions. A longer mean time to MRI and neurology visit was found in the PHI group when compared with the other two subgroups. Regression analysis showed that private insurance (OR=3.84, p=0.01) was the only independent factor associated with appropriate access to NMOSD medications in Argentina., Conclusion: These findings suggest that barriers to access and utilization of NMOSD care services in Argentina are common. NMOSD patients experienced problems to receive NMOSD medication properly, especially those from the public sector., Competing Interests: Declaration of competing interest None of the authors has any potential financial conflict of interest relating to this manuscript., (Copyright © 2022 Elsevier B.V. All rights reserved.)

The development of X-ray-absorbing scintillating nanoparticles is of high interest for solving the short penetration depth problem of visible and infrared light in photodynamic therapy (PDT). Thus, these nanoparticles are considered a promising treatment for several types of cancer. Herein, gadolinium oxide nanoparticles doped with europium ions (Gd 2 O 3 :Eu 3+ ) were obtained by using polyvinyl alcohol as a capping agent. Hybrid silica nanoparticles decorated with europium-doped gadolinium oxide (SiO 2 -Gd 2 O 3 :Eu 3+ ) were also prepared through the impregnation method. The synthesized nanoparticles were structurally characterized and tested to analyze their biocompatibility. X-ray diffraction, scanning electron microscopy, and transmission electron microscopy confirmed the high crystallinity and purity of the Gd 2 O 3 :Eu 3+ particles and the homogeneous distribution of nanostructured rare earth oxides throughout the fumed silica matrix for SiO 2 -Gd 2 O 3 :Eu 3+ . Both nanoparticles displayed stable negative ζ-potentials. The photoluminescence properties of the materials were obtained using a Xe lamp as an excitation source, and they exhibited characteristic Eu 3+ bands, including at 610 nm, which is the most intense transition band of this ion. Cytotoxicity studies on mouse glioblastoma GL261 cells indicated that these materials appear to be nontoxic from 10 to 500 μg·mL -1 and show a small reduction in viability in non-tumor cell lines. All these findings demonstrate their possible use as alternative materials in PDT.

Aqueous and ethanolic pomegranate peel extracts (PPE) were studied as a source of phenolic compounds with antimicrobial, anti-quorum sensing, and antioxidant properties. The aqueous extract showed higher total phenolic and flavonoid content (153.43 mg GAE/g and 45.74, respectively) and antioxidant capacity (DPPH radical inhibition: 86.12%, ABTS radical scavenging capacity: 958.21 mg TE/dw) compared to the ethanolic extract. The main phenolic compounds identified by UPLC-DAD were chlorogenic and gallic acids. The aqueous PPE extract showed antimicrobial activity against Listeria monocytogenes , Salmonella Typhimurium, Candida tropicalis (MICs 19-30 mg/mL), and anti-quorum sensing activity expressed as inhibition of Chromobacterium violaceum violacein production (%). The aqueous PPE extracts at 25 mg/mL applied on alfalfa sprouts reduced psychrophilic bacteria (1.12 Log CFU/100 g) and total coliforms (1.23 Log CFU/100 g) and increased the antioxidant capacity of the treated sprouts (55.13 µmol TE/100 g (DPPH) and 126.56 µmol TE/100 g (ABTS)) compared to untreated alfalfa. This study emphasizes PPE's antioxidant and antimicrobial activities in alfalfa sprouts preservation.

γ-Aminobutyric acid (GABA) is the main inhibitory neurotransmitter in adult central nervous system (CNS) synapses, but it excites immature CNS neurons as well as neurons in the myenteric plexus. The present work aimed to determine whether GABA-induced nonadrenergic, noncholinergic (NANC) neuronal-mediated relaxation of the rat duodenum is dependent on the activity of Na + K + Cl - cotransporters (NKCC) and requires calcium influx. In the presence of guanethidine (3 µmol/L), atropine (3 µmol/L), and indomethacin (1 µmol/L), relaxations induced by GABA (100 µmol/L), KCl (5-10 mmol/L) and electrical field stimulation (1-8 Hz, 2 ms, 60 V), but not those induced by bradykinin (10-100 nmol/L) were abolished by lidocaine (300 µmol/L). However, only GABA-induced relaxations were reduced in a concentration-dependent manner by the NKCC1/2 inhibitors bumetanide (0.1-1 µmol/L) and furosemide (1-10 µmol/L). GABA-induced NANC neuronal relaxation was abolished by bicuculline (30 µmol/L) and inhibited by N-nitroarginine methyl ester (l-NAME, 300 µmol/L). The ω-conotoxin GVIA (1 µmol/L), which acts exclusively on neuronal Ca V 2 channels, but not on smooth muscle voltage-gated Ca 2+ Ca V 1 channels, and nonselective blockers of these channels (verapamil 100 nmol/L and ruthenium red 10 µmol/L), reduced GABA-induced relaxations. These results showed that the activation of GABA A receptors induces NANC nitrergic neuronal relaxations in the rat duodenum, which depend on NKCC activity and Ca V 2 channel activation, suggesting that this phenomenon results from neuronal depolarization promoted by Cl - efflux through GABA A receptors, with subsequent Ca 2+ influx and nitric oxide release.