Search

At least 33 million people worldwide are living with human immunodeficiency virus (HIV) infection, and about 20-30% of these are also infected with hepatitis C virus (HCV). Co-infection with HIV and HCV is a major public health concern. Co-infected persons develop cirrhosis and end-stage liver disease more quickly than individuals infected with HCV only. The particular HCV strain or genotype is a major factor for HCV prognosis. The pattern of HCV genotypes in a cohort of HIV/HCV co-infected patients was investigated. One hundred (100) adult patients were recruited from the Nigerian Institute of Medical Research (NIMR), Yaba, Lagos, with age ranging from 18 to 65 years (58% male). Upon recruitment, they were placed on appropriate antiretroviral drugs; 300 mg tenofovir (TDF), 200 mg emtricitabine (FTC) plus 600 mg efavirenz (EFV) once daily dosage. HCV genotyping was done using the Linear Array hepatitis C virus genotyping kit (Roche Molecular Systems, Inc. USA). HCV genotyping revealed prevalence of genotypes 1 (65.6%) and 4 (34.4%), respectively. These are the hard-to-treat genotypes that previously required a long duration of HCV therapy until newer drugs were introduced. The nature of HCV genotypes in HIV/HCV co-infected people has serious implications for further HCV therapy. These findings are pertinent for decisions about the best possible time for and kind of HCV treatment in the setting of co-morbid HIV infection.

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Lassa Fever (LF) continues to be an endemic acute viral hemorrhagic fever (VHF) illness in Nigeria. Many suspected cases of LF infection have subsequently been confirmed negative and raises concerns as to what the diagnosis of such patients could be. Hence this study was to determine the causative agents of unconfirmed LF among initially suspected cases in South Western Nigeria. In this retrospective study, blood samples originally collected from 233 suspected cases of a LF outbreak response at Owo and Ose LGAs of Ondo State, were transported in triple level packaging and stored at -80°C. All samples were screened for LF IgM and IgG markers and LF PCR. Forty-five out of the stored plasma samples were randomly retrieved and analyzed for presence of IgM for seven other VHF viruses; Chikungunya (CHIK), West Nile (WN), Rift Valley fever (RVF), Yellow fever (YF), Dengue fever (DEN), Zika and Crimean-Congo hemorrhagic fever (CCHF). Out of 45 samples screened, 1 (2.2%) was positive for YF IgM antibody. The same sample was previously confirmed LF positive by PCR. This LF and YF co-infection was from a male, 23-year old individual. The presence of co-infections of LF and YF draw to limelight the need to be broad minded in exploring for the presence of other VHF viruses in outbreaks. Further studies are needed to decipher the diagnosis of LF suspected cases.

Zika virus (ZIKV) is one of the arboviruses implicated in febrile illness, microcephaly and other neurological disorders in babies whose mothers were infected during pregnancy. Information on ZIKV in Nigeria is limited. Hence, this study was aimed at investigating the seroprevalence of Zika virus among pregnant women in Lagos State. In a cross-sectional study, blood samples collected from 352 randomly selected pregnant women in four hospitals in Lagos State were separated and plasma analyzed using Zika virus IgG and IgM capture Enzyme-linked immunosorbent assay (Demeditec Diagnostics, Germany). The optical densities were read using Precision Microplate reader (Molecular devices) and cut-off calculated according to manufacturer’s guide. Parameters and symptoms such as history of fever, rashes on the body, exposure to mosquito were extracted from the questionnaire and analyzed. IgM seropositive samples were screened for ZIKV RNA on RT-qPCR. Out of 352 samples screened, 7(2.0%) and 5(1.4%) of the pregnant women tested positive for IgG and IgM respectively. None tested positive for both IgG and IgM markers. Statistical analysis showed that there is no significant relationship between the symptoms analyzed in this study at 95% Confidence interval except conjunctivitis. None of the ZIKV IgM seropositive samples tested positive for ZIKV RNA on RT-qPCR. The results show that there is evidence of exposure to Zika virus among the population studied in Lagos, Nigeria. Also, the low level seroprevalence of the virus in the population studied indicates that there is lack of herd immunity of Zika virus infection in Lagos, Nigeria.

Background: The current resurgence and transmission dynamics of Lassa fever (LF) within an endemic community in Nigeria calls for concern. Lassa fever virus is known to be transmitted from rodents to humans as well as from human to human. This study aims to compare the knowledge, attitude/practices and prevention of Community dwellers (CD) and Contacts of confirmed Lassa fever patients (CCP) with respect to LF in an endemic area in Nigeria. Methodology: This is a comparative cross-sectional study conducted between 2018 and 2019 during an outbreak of LF disease in Ondo State, Nigeria. A total of 250 consenting CD and 104 CCP were randomly selected to participate in this study. They were administered semi-structured questionnaires which were analysed using SPSSv23. Lassa fever disease causative agents, mode of transmission and prevention as well as actions on response to Lassa virus infections were assessed among respondents. Data were analysed and presented using descriptive statistics at 95% confidence interval and (p

Multi-drug (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) continues to be a global public health problem especially in high TB burden countries like Nigeria. Many of these cases are undetected and go on to infect high risk individuals. Clinical samples from positive rifampicin resistant Xpert®MTB/Rif assay were subjected to direct whole genome sequencing and bioinformatics analysis to identify the full antibiotics resistance and lineage profile. We report two (2) XDR TB samples also belonging to the East-Asian/Beijing family of lineage 2 Mycobacterium tuberculosis complex (MTBC) from clinical samples in Nigeria. Our findings further reveal the presence of resistance genes to first-line drugs (rifampicin, isoniazid, ethambutol and pyrazanimide), second-line injectables (capreomycin, streptomycin, kanamycin and/or amikacin) and at least one of the fluoroquinolones (ofloxacin, moxifloxacin, levofloxacin and/or ciprofloxacin) in both samples. The genomic sequence data from this study not only provide the first evidence of XDR TB in Nigeria and West Africa, but also emphasize the importance of WGS in accurately detecting MDR and XDR TB, to ensure adequate and proper management treatment regimens for affected individuals. This will greatly aid in preventing the spread of drug resistance TB in high burden countries.

Objectives Optimising antibiotic use in healthcare settings through antimicrobial stewardship programmes (ASPs) is critical to effectively treat infections, protect patients from harms caused by unnecessary antibiotic use, and combat antimicrobial resistance. This needs assessment was designed to provide the current status of ASPs in healthcare facilities in Lagos State and identify gaps for future interventions. Methods A descriptive cross-sectional survey was conducted using a self-administered questionnaire to ascertain the extent and nature of ongoing ASPs among selected healthcare facilities and identify gaps for future interventional studies. Results Of 32 questionnaires distributed, 25 (78%) were completed and returned from three tertiary, six secondary, eleven primary and five private healthcare facilities. The mean years of practice of respondents was 13.96 ± 7.8 years (2–31 years). Six facilities (24%) had a team responsible for ASP operating at varying degrees of capacity, while five (20%) had a formal ASP. All six facilities with an antimicrobial stewardship (AMS) team had a medical doctor as the team lead, and 5 (20%) also had a pharmacist involved in implementation efforts. Routine pre-authorisation for specific antibiotic was performed in six facilities (24%), four of which monitor pre-authorisation interventions. Only two facilities (8%) performed prospective audit and feedback for specific antibiotic agents. Private healthcare facilities were more likely to have information technology (IT) capability to support the needs of AMS activities. Conclusion This study revealed minimal ASP activities in healthcare facilities in Lagos State and highlighted possibilities of leveraging on available IT resources for a co-ordinated AMS strategy.

Biosafety is an important issue globally, as a line of defence that protects health personnel, public and the environment from exposure to hazardous agents. Most developing nations have weak health systems and consequently weak biosafety. Engaging in an external quality program such as an accreditation process will help build capacity and competence in all areas. The Centre for Human Virology and Genomics (CHVG) laboratory of the Nigerian Institute of Medical Research, Lagos, Nigeria started its biosafety program in compliance to international standards stipulated by ISO 15189:2012, in its journey towards laboratory accreditation. Accreditation is widely used to attest for laboratory competence. In the quest for laboratory accreditation, several processes were implemented to ensure compliance, one of which was biosafety. Simple remedial actions and policies that have worked in other climes were applied over a 10-year period in the CHVG laboratory. A significant drop in nonconforming incidences and laboratory accidents was seen while biosafety audits showed improvement in safety practices. Keywords: Biosafety, Infection control, audit French Title: Mise en œuvre de la biosécurité dans la lutte contre les infections: un examen décennal La biosécurité est une question importante à l'échelle mondiale, en tant que ligne de défense qui protège le personnel de santé, le public et l'environnement de l'exposition à des agents dangereux. La plupart des pays en développement ont des systèmes de santé faibles et, par conséquent, une faible sécurité biologique. S'engager dans un programme de qualité externe tel qu'un processus d'accréditation aidera à renforcer les capacités et les compétences dans tous les domaines. Le laboratoire du Centre de virologie humaine et de génomique (CHVG) de l'Institut nigérian de recherche médicale de Lagos, au Nigéria, a commencé son programme de biosécurité conformément aux normes internationales stipulées par ISO 15189: 2012, dans son parcours vers l'accréditation des laboratoires. L'accréditation est largement utilisée pour attester la compétence du laboratoire. Dans la recherche de l'accréditation des laboratoires, plusieurs processus ont été mis en œuvre pour assurer la conformité, dont l'un était la biosécurité. Des mesures correctives simples et des politiques qui ont fonctionné sous d'autres climats ont été appliquées sur une période de 10 ans dans le laboratoire du CHVG. Une baisse significative des incidents non conformes et des accidents de laboratoire a été observée tandis que les audits de biosécurité ont montré une amélioration des pratiques de sécurité. Mots clés: Biosécurité, Contrôle des infections, audit

Background Antimicrobial resistance (AMR) in bacterial pathogens is a worldwide concern that demands immediate attention. Most information on AMR originates from high-income countries and little is known about the burden in Africa, particularly Nigeria. Using four sentinel sites (General hospitals) in Lagos State, this study sought to estimate the burden of AMR. Methods This is a hospital-based surveillance using secondary health care centres. Four sites were randomly selected and included in the study. Clinical isolates were collected over a period of 6 months for each site from August 2020 to March 2021. All isolates were characterised and analysed for resistance to 15 antibiotics using the Kirby-Baur method. Multiplex PCR assay was used for the detection of Extended spectrum beta lactamase genes. Data analysis was done using SPSS version 27.0. Results Four hundred and ninety-nine (499) patients consented and participated in this study, consisting of 412 (82.6%) females and 87 (17.4%) males. The mean age ± SD of the participants was 33.9 ± 13.8 with a range of 1–89 years. The majority (90.8%) of the participants were outpatients. Two hundred and thirty-two (232) isolates were obtained from 219 samples, comprising of 120 (51.7%) Gram positive and 112 (48.3%) Gram negative organisms. Key bacterial pathogens isolated from this study included Staphylococcus aureus (22.8%), Escherichia coli (16.4%), Staphylococcus spp. (15.9%), Enterococcus spp. (7.3%) and Klebsiella pneumoniae (6.5%). There was high prevalence of multi-drug resistance (79.3%) among the isolates with 73.6% of Staphylococcus aureus phenotypically resistant to methicillin and 70% possessed the MecA gene. 76.5% of Enterococcus spp. isolated were Vancomycin resistant. Overall, resistance to Cephalosporins was most frequently/commonly observed (Cefotaxime 87.5%). Conclusion A high incidence of AMR was identified in clinical bacteria isolates from selected general hospitals in Lagos State, highlighting the necessity for the implementation of national action plans to limit the prevalence of AMR. Surveillance via collection of isolates has a lot of promise, especially in resource-limited environments.

A subgroup among people living with HIV (PLHIV) experience viral suppression, sometimes to an undetectable level in the blood and/or are able to maintain a healthy CD4+ T-cell count without the influence of antiretroviral (ARV) therapy. One out of three hundred PLHIV fall into this category, and a large sample of this group can be found in areas with a high prevalence of HIV infection such as Nigeria and South Africa. Understanding the mechanism underpinning the nonprogressive phenotype in this subgroup may provide insights into the control of the global HIV epidemic. This work provides mechanisms of the elite control and nonprogressive phenotype among PLHIV in Nigeria and South Africa and identifies research gaps that will contribute to a better understanding on HIV controllers among PLHIV.

Background: HIV co-infection with hepatitis B (HBV) and/or hepatitis C virus (HCV) is common, largely due to shared routes of transmission, but paucity of data exists for long term treatment outcomes of HIV infected patients, and those co-infected with HBV and HCV despite the high burden in Nigeria. The aim of study was to describe the longterm treatment outcomes in HIV infected Nigerians and to assess the effect of HBV and HCV co-infections on longterm response to antiretroviral therapy (ART).Methodology: This was a retrospective study of HIV infected adults (> 18 years old) consecutively initiating ART between July 2004 and December 2007, who were followed up for 7 years (2011 and 2014). HBV and HCV infections were diagnosed by detection of serum hepatitis B surface antigen (HBsAg) and HCV antibody (HCVAb) respectively. HIV viral load and CD4 count were monitored 3-monthly after initiating ART, and treatment outcomes based on these were compared between patients with HIV mono-infection, HIV/HBV, HIV/HCV and HIV/HBV/HCV co-infections. Clinical and laboratory data of the patients were abstracted from the medical databases, FileMaker Pro, v 10, entered into Microsoft Excel, and analyzed using SPSS version 20.0.Results: A total of 2,800 adults were evaluated (median age of 35.5 years; 64.2% female), of whom 197 (7.0%) were co-infected with HBV, 53 (1.9%) with HCV, and 15 (0.5%) with HBV and HCV. During the 7-year period, 369 (13.2%) patients were lost to follow up. Immune reconstitution, measured by CD4 recovery, was lower in both HBV and HCV co-infections compared to HIV mono-infection, but this was not statistically significant (p>0.05). Median baseline HIV viral load was 4.63 log copies/ml for all groups, which decreased to undetectable level at a median time of 6 months and remained so for the study duration.Conclusion: This study revealed a higher virologic failure among HIV/HCV co-infected group compared to other groups. No immunological difference in ART treatment outcomes between HIV mono-infected and those co-infected with HBV and HCV after 7-year follow-up. Gradual rise in CD4 was found to be an immunological evidence of the body’s recovery from HIV, buttressed by the drop in viral load over the 7-year period. Keywords: ART, HIV, HBV, HCV co-infection, long term outcomes English title: Résultats à long terme du traitement antirétroviral hautement actif chez les Nigérians infectés par le VIH et ceux co-infectés par les virus des hépatites B et C Contexte: La co-infection par le VIH avec l'hépatite B (VHB) et/ou le virus de l'hépatite C (VHC) est courante, engrande partie en raison des voies de transmission partagées, mais il existe peu de données sur les résultats dutraitement à long terme des patients infectés par le VIH, et ceux co -infectés par le VHB et le VHC malgré le fardeau élevé au Nigéria. Le but de l'étude était de décrire les résultats du traitement à long terme chez les Nigérians infectés par le VIH et d'évaluer l'effet des co-infections par le VHB et le VHC sur la réponse à long terme au traitement antirétroviral (TAR).Méthodologie: Il s'agissait d'une étude rétrospective sur des adultes infectés par le VIH (>18 ans) ayant commencé un traitement antirétroviral consécutivement entre juillet 2004 et décembre 2007, suivis pendant 7 ans (2011 et 2014). Les infections par le VHB et le VHC ont été diagnostiquées par détection de l'antigène de surface sérique de l'hépatite B (AgHBs) et des anticorps anti-VHC (HCVAb) respectivement. La charge virale du VIH et la numération des CD4 ont été surveillées tous les trois mois après le début du TAR, et les résultats du traitement basés sur ceuxci ont été comparés entre les patients atteints de mono-infection VIH, VIH/VHB, VIH/VHC et VIH/VHB/VHC. Les données cliniques et de laboratoire des patients ont été extraites des bases de données médicales, FileMaker Pro, v 10, saisies dans Microsoft Excel et analysées à l'aide de SPSS version 20.0.Résultats: Un total de 2800 adultes ont été évalués (âge médian de 35,5 ans; 64,2% de femmes), dont 197 (7,0%) étaient co-infectés par le VHB, 53 (1,9%) par le VHC et 15 (0,5%) par le VHB et VHC. Au cours de la période de 7 ans, 369 (13,2%) patients ont été perdus de vue. La reconstitution immunitaire, mesurée par la récupération des CD4, était plus faible dans les co-infections par le VHB et le VHC que dans la mono-infection par le VIH, mais cela n'était pas statistiquement significatif (p>0,05). La charge virale VIH de base médiane était de 4,63 log copies / ml pour tous les groupes, ce qui a diminué à un niveau indétectable à une période médiane de 6 mois et le reste pendant toute la durée de l'étude.Conclusion: Cette étude a révélé un échec virologique plus élevé parmi le groupe co-infecté par le VIH / VHC par rapport aux autres groupes. Aucune différence immunologique dans les résultats du traitement TAR entre le VIH mono-infecté et ceux co-infectés par le VHB et le VHC après un suivi de 7 ans. L’augmentation progressive des CD4 s’est avérée être une preuve immunologique de la guérison du corps du VIH, étayée par la baisse de la charge virale au cours de la période de 7 ans. Mots clés: TAR, VIH, VHB, co-infection par le VHC, résultats à long terme

Background Antimicrobial resistance (AMR) is a global problem compromising the effective treatment of infectious diseases. The World Health Organization (WHO) is encouraging and promoting awareness creation among health workers as one of its strategies to reduce the rate of emergence and transmission of AMR. Available data on the prescribing behavior of healthcare workers (HCWs) in Nigeria remains incomplete. This study was designed to provide an up-to-date estimate of the knowledge, attitude and antibiotic prescribing behavior of HCWs in Nigeria. Methods This is a cross-sectional study. Self-administered questionnaires were distributed to healthcare workers selected from six states, one each from the 6 geopolitical zones in Nigeria. A multi-stage sampling technique was used to reflect the three tiers of healthcare: primary, secondary and tertiary levels. Quantitative data was summarized using descriptive statistics. All data analysis was done using the Statistical package for social sciences version 26.0. Results Of the 420 questionnaires distributed, 358 (85.2%) responded. The mean year of practice of the respondents was 9.32 ± 7.8 years. About a half (50.3%) agreed that their prescribing behavior could promote antimicrobial resistance. 49.2% had a good knowledge of AMR and physicians had significantly better knowledge than other HCWs (X2 = 69.59, P Conclusion This study reveals an overall moderate level of knowledge of AMR and attitude towards minimizing the emergence of antimicrobial resistance though this did not translate significantly to practice. Further efforts must be made in order to improve rational prescription of antimicrobials among HCWs in Nigeria.

Background: The world is currently experiencing a healthcare crisis caused by Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). Healthcare workers (HCWs) are at the forefront of controlling the spread of the disease; this response has resulted in a huge number of infections amongst HCWs and unfortunately some casualties. Infection prevention and control practices (IPC) are practical, proven methods that prevent avoidable harm to patients and protect health workers from contagious infection. This study was done to evaluate the effectiveness of IPC practices utilized in COVID-19 testing drive through facility in Lagos Nigeria. Method: The facility recruited 42 HCWs who were trained on IPC and use of Personal Protective Equipment (PPEs). Training on donning and doffing of PPEs, preparation of decontaminants and sample handling were done for relevant personnel. A daily log for monitoring COVID-19 symptoms was deployed to all HCWs; to help early detection of COVID-19 infection and prevent transmission amongst staff. Results: Of 42 personnel, 92.8% had a tertiary level of education while 71.4% had at least 5 years work experience. A total of 5 (11.9%) out of 42 HCWs were positive by week six of the study. All infected persons worked at the drive through centre. Most common symptom filled in the daily log tool was headache and fatigue. Conclusion: Despite all the measures introduced, 11.9% of HCWs became positive within 6 weeks, showing the highly infectious nature of the virus and the need to research into more effective measures in preventing the transmission of highly infectious pathogens to HCWs during outbreaks.

Background Hepatitis C virus (HCV) screening is critical to HCV elimination efforts. Simplified diagnostics are required for low-resource settings and difficult-to-reach populations. This retrospective study assessed performance of rapid diagnostic tests (RDTs) for detection of HCV antibodies. Methods Two lots of 13 RDTs were evaluated at 3 laboratories using archived plasma samples from 4 countries (Nigeria, Georgia, Cambodia, and Belgium). HCV status was determined using 3 reference tests according to a composite algorithm. Sensitivity and specificity were evaluated in HIV-infected and HIV-uninfected populations. Operational characteristics were also assessed. Results In total, 1710 samples met inclusion criteria. In HIV-uninfected samples (n = 384), the majority of RDTs had sensitivity ≥98% in 1 or both lots and most RDTs had specificity ≥99%. In HIV-infected samples (n = 264), specificity remained high but sensitivity was markedly lower than in HIV-uninfected samples; only 1 RDT reached >95%. The majority of HIV-infected samples for which sensitivity was low did not have detectable HCV viral load/core antigen. Interreader variability, lot-to-lot variability, and rate of invalid runs were low for all RDTs ( Conclusions HCV RDTs should be evaluated in the intended target population, as sensitivity can be impacted by population factors such as HIV status. Clinical Trials Registration NCT04033887

Background A common complication of any respiratory disease by a virus could be a secondary bacterial infection, which is known to cause an increase in severity. It is, however, not clear whether the presence of some opportunistic pathogens called pathobionts contributes to the severity of the disease. In COVID-19 patients, undetected bacterial co-infections may be associated with the severity of the disease. Therefore, we investigated the implications of bacterial co-infections in COVID-19 cases. Results This is a cross-sectional study that involved archived specimens collected from nasopharyngeal samples of 150 people for COVID-19 screening in Lagos. DNA extraction from the samples was carried out to determine the presence of five respiratory bacterial pathogens using nested real-time PCR, and data were analysed using the Chi-square test. Of the 150 samples collected, 121 (80.7%) were positive for SARs-CoV-2 infection and 29 were negative. The proportion of patients with bacteria co-infection in COVID-19-negative, asymptomatic, and mild cases were 93.1%, 70.7%, and 67.5%, respectively. There was no statistically significant difference between mild COVID-19 conditions and bacteria co-infection (p = 0.097). There was also no significant difference in the nasal carriage of Staphylococcus aureus, Mycoplasma pneumoniae, and Haemophilus spp. However, there was a statistically significant increase in the carriage of Moraxella catarrhalis and Chlamydophila pneumoniae among COVID-19-negative patients when compared with the positive patients (p value = 0.003 and 0.000 for Moraxella catarrhalis and Chlamydophila pneumoniae, respectively). Conclusions The current study shows that bacterial co-infection and superinfection with COVID-19 are not associated with mild and asymptomatic COVID-19 cases in our setting. However, given the high prevalence of Staphylococcus aureus and Mycoplasma pneumoniae among the mild COVID-19 cases seen in this study, early diagnosis and treatment of these bacterial co-infections are still encouraged to mitigate the effect on the severity of COVID-19.

Objectives: The objective of this study was to assess the factors affecting testing behaviours amongst the population in Ondo and Lagos States.Methods: A cross-sectional study involving 704 individuals who were considered eligible for COVID-19 testing in 4 local governments in Lagos (307) and Ondo (397) states in Nigeria, was conducted from April-June 2021. Respondents were selected using simple random sampling. A close-ended questionnaire was administered using a digital survey platform known as SurveyCTO. Data were analyzed using R 4.1.0.Results: In Lagos state, 52.4% were females, 47.2% were males while in Ondo, 55.2% were females, 44.6% were male. Chi-square tests of association revealed that socio demographic factors significantly associated with testing patterns was education level in Lagos, and none in Ondo. Testing behavior associated with testing patterns included awareness of nearby COVID-19 testing centers, internet access, knowledge of preexisting conditions and having another member of the family testing positive at 5% significance level.Conclusion: Knowledge of pre-existing conditions, knowledge of COVID-19 symptoms, and knowing where to go when having symptoms were significantly associated with testing and willingness to test.

Background There have been suggestions that hematologic abnormalities in COVID-19 are linked with the progression and severity of diseases and mortality. Lymphopenia, sepsis, and thrombocytopenia were highly reported in patients with COVID-19. This study investigated the significance of hematologic abnormalities in patients with COVID-19 in Lagos, Nigeria, and its potential as a diagnostic tool for COVID-19 severity. Results This was a retrospective observational study with a total of 340 patients with COVID-19 (236 patients included in the analysis). These patients were categorized into two groups, comprising 71 patients with severe COVID-19 (SCP) and 165 patients with non-severe COVID-19 (NSCP). The majority were males in both categories (SCP 74.6% and NSCP 63.6%). The mean ± SD ages for SCP and NSCP were 52.28 ± 16.87 and 42.44 ± 17.18 years, respectively. The SCP (52.1%) and NSCP (20.0%) had underlying health conditions. The SCP exhibited significantly higher neutrophil counts (P P P Conclusions COVID-19 affected the levels of hemoglobin, RBC, PCV, and lymphocytes in the blood, and the differences were significant between the SCP and NSCP. The significant changes in neutrophil and lymphocyte counts may be useful in the prognosis and management of COVID-19 severity in hospital settings. Furthermore, NLR and PLR may be used in the prognosis and management of severe COVID-19 infection, as well as provide an objective basis for early identification and management in low-resource settings.

Background. The objective of this study was to describe the prevalence and clinical features of coronavirus disease 2019 (COVID-19) among children (≤18 years) evaluated for Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection at a testing centre in Lagos, Nigeria. Methodology. This was a retrospective study. Data on the sociodemographic, clinical characteristics and SARS-CoV-2 results of participants at a modified drive-through centre for COVID-19 test sample collection over four months were retrieved from the electronic medical records (EMR). Data obtained were analyzed using SPSS version 22.0. Results. A total of 307 children (≤18 years) were evaluated in this review. The prevalence of SARS-CoV-2 infection among the paediatric population was 16.3%. The median age (interquartile range (IQR)) was 9 (4–14) years. Common symptoms reported by the positive cases were fever (40.0%), cough (32.9%), sore throat (17.1%), and runny nose (15.7%). The majority of the positive cases had mild symptoms. Fever and sore throat were associated with the positive cases. Conclusion. Fever and sore throat were associated with SARS-CoV-2 infection among our cohort which buttresses the need for a high level of suspicion and clinical acumen in the management of common febrile diseases in paediatric settings.

BackgroundWith reports of surges in COVID-19 case numbers across over 50 countries, country-level epidemiological analysis is required to inform context-appropriate response strategies for containment and mitigation of the outbreak. We aimed to compare the epidemiological features of the first and second waves of COVID-19 in Nigeria.MethodsWe conducted a retrospective analysis of the Surveillance Outbreak Response Management and Analysis System data of the first and second epidemiological waves, which were between 27 February and 24 October 2020, and 25 October 2020 to 3 April 2021, respectively. Descriptive statistical measures including frequencies and percentages, test positivity rate (TPR), cumulative incidence (CI) and case fatality rates (CFRs) were compared. A p value of ResultsThere were 802 143 tests recorded during the study period (362 550 and 439 593 in the first and second waves, respectively). Of these, 66 121 (18.2%) and 91 644 (20.8%) tested positive in the first and second waves, respectively. There was a 21.3% increase in the number of tests conducted in the second wave with TPR increasing by 14.3%. CI during the first and second waves were 30.3/100 000 and 42.0/100 000 respectively. During the second wave, confirmed COVID-19 cases increased among females and people 30 years old or younger and decreased among urban residents and individuals with travel history within 14 days of sample collection (p value ConclusionNigeria experienced a larger but less severe second wave of COVID-19. Continued implementation of public health and social measures is needed to mitigate the resurgence of another wave.

Background: Health experts promote the use of alcohol based hand rubs to contain the spread of microbes. The emergence of novel SARS-CoV-2 virus has brought a worsening public health challenge that re-enacted the importance of hand hygiene globally. Objective: This study evaluated the antimicrobial efficacy of locally made alcohol-based hand rubes sourced from grocery shops within Lagos metropolis, Nigeria. Methods: We conducted a laboratory based in vitro experiment, using 20 randomly sourced hand sanitizers against standard Escherichia coli (ATCC 25922) and three locally characterized Multi-drug-Resistant bacterial strains (Staphylococcus aureus (NIMR/NTCC/GP056), Klebsiella pneumonia (NIMR/NTCC/GN065) and Proteus stutzin - (NIMR/NTCC/ GN029). Reference standard, 60 % isopropanol was used as positive control. Test suspension method as per European standard PrEN12054 was employed. The Colony Forming Unit/mL (CFU/mL) at base line and after each contact time (15, 30 & 45 seconds) with samples was recorded. The Logarithmic reduction factor (RF) and percent reduction were computed and expressed using descriptive statistics. Results: Out of the 20 solutions tested (10 sprays and 10 gels), 11 (55%) had standard efficacy of 5-Log10 reduction factor (6.7- 6.8) recommended at 15 seconds exposure time on the 4 bacteria. Out of such 7 (64%) were spray solution (L1, L3, L5, L10, L11, L12 & L16), while 4 (36%) were gel solutions (L9, L15, L18 & L20). Another 2 (10%) had relative time based efficacy at between 30 to 45 seconds exposure (L2 spray and L14 gel). Seven (35%) (L7 & L17 spray; L4, L6, L8, L13 & L19 gel solutions) failed the test. Escherichia coli and Proteus stutzin were more susceptible to the samples tested and produced higher RF. Conclusion: About 45 % of the hand sanitizers had poor efficacy and this is quite high, especially in this era of pandemic. This report underscores the need for production policy review by the regulatory body. It is imperative to enforce quality management regime, particularly, internal and external production quality control. Periodic batch efficacy validation is necessary to ensure precision. Poor quality products must be actionable. We recommend this experiment be scaled up to national level and to cover major microbial pathogens.

The present global pandemic triggered by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has lingered for over a year in its devastating effects. Diagnosis of coronavirus disease 2019 (COVID-19) is currently established with a polymerase chain reaction (PCR) test by means of oropharyngeal-, nasopharyngeal-, anal-swabs, sputum and blood plasma. However, oral and nasal swabs are more commonly used. This study, therefore, assessed sensitivity and specificity of plasma as a diagnostic in comparison with a combination of oral and nasal swab samples, and the implications for blood transfusion. Oropharyngeal (OP) and nasopharyngeal (NP) swab samples were obtained from 125 individuals suspected to have COVID-19 and stored in viral transport medium (VTM) tubes. Ten millilitres of blood samples in EDTA were also obtained by venepuncture and spun to obtain plasma. Viral RNA was obtained from both swabs and plasma by manual extraction with Qiagen QIAamp viral RNA Mini Kit. Detection was done using a real time fluorescent RT-qPCR BGI kit, on a QuantStudio 3 real-time PCR instrument. Average age of study participants was 41 years, with 74 (59.2%) being male. Out of the 125 individuals tested for COVID-19, 75 (60%) were positive by OP/NP swab. However, only 6 (4.8%) had a positive plasma result for COVID-19 with median Ct value of 32.4. Sensitivity and specificity of RT-PCR SARS-CoV-2 test using plasma was 8% and 100% respectively. There was no false positive recorded, but 69 (55.2%) false negatives were obtained by plasma. SARS-CoV-2 viral RNA was detected, albeit low (4.8%) in plasma. Plasma is likely not a suitable biological sample to diagnose acute SARS-CoV-2 infection. The implication of transfusing blood in this era of COVID-19 needs further investigations.

Correspondence - No abstract available.

Background: Accurate SARS-CoV-2 serological assays are critical for COVID-19 serosurveillance. However, previous studies have indicated possible cross-reactivity of these assays, including in malaria-endemic areas.Methods: We tested 213 well-characterized pre-pandemic samples from Nigeria using two SARS-CoV-2 serological assays: Abbott Architect IgG and Euroimmun NCP IgG assay, both targeting SARS-CoV-2 nucleocapsid protein. To assess antibody binding strength, an avidity assay was performed on these samples and on plasma from SARS-CoV-2 PCR-positive persons.Results: Thirteen (6.1%) of 212 samples run on the Abbott assay and 38 (17.8%) of 213 run on the Euroimmun assay were positive. Anti-Plasmodium IgG levels were significantly higher among false-positives for both Abbott and Euroimmun; no association was found with active P. falciparum infection. An avidity assay using various concentratIons of urea wash in the Euroimmun assay reduced loosely-bound IgG: of 37 positive/borderline pre-pandemic samples, 46%, 86%, 89%, and 97% became negative using 2M, 4M, 5M, and 8M urea washes, respectively. The wash slightly reduced avidity of antibodies from SARS-CoV-2 patients within 28 days of PCR confirmation; thereafter avidity increased for all urea concentrations except 8M.Conclusions: This validation found moderate to substantial cross-reactivity on two SARS-CoV-2 serological assays using samples from a malaria-endemic setting. A simple urea wash appeared to alleviate issues of cross-reactivity.

In an outbreak, effective detection of the aetiological agent(s) involved using molecular techniques is key to efficient diagnosis, early prevention and management of the spread. However, sequencing is necessary for mutation monitoring and tracking of clusters of transmission, development of diagnostics and for vaccines and drug development. Many sequencing methods are fast evolving to reduce test turn-around-time and to increase through-put compared to Sanger sequencing method; however, Sanger sequencing remains the gold standard for clinical research sequencing with its 99.99% accuracy This study sought to generate sequence data of SARS-CoV-2 using Sanger sequencing method and to characterize them for possible site(s) of mutations. About 30 pairs of primers were designed, synthesized, and optimized using endpoint PCR to generate amplicons for the full length of the virus. Cycle sequencing using BigDye Terminator v.3.1 and capillary gel electrophoresis on ABI 3130xl genetic analyser were performed according to the manufacturers’ instructions. The sequence data generated were assembled and analysed for variations using DNASTAR Lasergene 17 SeqMan Ultra. Total length of 29,760bp of SARS-CoV-2 was assembled from the sample analysed and deposited in GenBank with accession number: MT576584. Blast result of the sequence assembly shows a 99.97% identity with the reference sequence. Variations were noticed at positions: nt201, nt2997, nt14368, nt16535, nt20334, and nt28841-28843, which caused amino acid alterations at the S (aa614) and N (aa203-204) regions. The mutations observed at S and N-gene in this study may be indicative of a gradual changes in the genetic coding of the virus hence, the need for active surveillance of the viral genome.

The first case of COVID-19 in Nigeria was recorded on February 27, 2020, being an imported case by an Italian expatriate, to the country. Since then, there has been steady increase in the number of cases. However, the number of cases in Nigeria is low in comparison to cases reported by other countries with similar large populations, despite the poor health system prevailing in the country. This has been mainly attributed to the low testing capacity in Nigeria among other factors. Therefore, there is a need for innovative ways to increase the number of persons testing for COVID-19. The aim of the study was to pilot a nasopharyngeal swab self-sample collection model that would help increase COVID-19 testing while ensuring minimal person-to-person contact being experienced at the testing center. 216 participants took part in this study which was carried out at the Nigerian Institute of Medical Research between June and July 2020. Amongst the 216 participants, 174 tested negatives for both self-collected samples and samples collected by Professionals, 30 tested positive for both arms, with discrepancies occurring in 6 samples where the self-collected samples were positive while the ones collected by the professionals were negative. The same occurred in another set of 6 samples with the self-collected samples being negative and the professional—collected sample coming out positive, with a sensitivity of 83.3% and a specificity of 96.7%. The results of the interrater analysis are Kappa = 0.800 (95% CI, 0.690 to 0.910) which implies an outstanding agreement between the two COVID-19 sampling methods. Furthermore, since p< 0.001 Kappa (k) coefficient is statistically different from zero, our findings have shown that self-collected samples can be reliable in the diagnosis of COVID-19.

Introduction Hepatitis C Virus (HCV) is highly infectious with no currently available vaccine. Prior to treatment, it is recommended to confirm HCV infection with either quantitative or qualitative nucleic acid test. Access to these assays in Nigeria is limited but for effective management of patients, HCV viral load (VL) prior to therapy is required and genotype may be needed in some instances. This study aimed at reviewing the pattern of HCV viral load and genotype in the country, and its implication in patient management. Methods this was a retrospective study that involved data abstraction from an electronic database of an accredited laboratory between June 2013 and May 2017. De-linked data were abstracted from records of adult subjects with HCV VL and genotype results, these were analysed using Microsoft Excel 2010 and SPSS v20. Results within the study period, 346 subjects had baseline VL and 134 (38.7%) had genotype results available. Of these, 202/346 (58.4%) had detectable VL results with higher prevalence in males (64.7%) and ≥51years (42.5%) age group. The median VL among 202 subjects was 407,430 (IQR: 96,388 - 1,357,012) IU/mL. Distribution of genotypes showed that genotypes 1 and 4 had prevalence of 63.2% and 16.8% respectively. Conclusion genotypes 1 and 4 have the highest prevalence. A greater proportion of subjects had VL values ≤800,000 IU/mL, an indication that they are more likely to respond well to available antiviral therapy hence, access to these antivirals will greatly improve management of HCV infection in Nigeria.

Background One of the objectives of the Global Action Plan by the World Health Organization (WHO) to contain antimicrobial resistance (AMR), is to improve global awareness through effective communication and education. Comprehensive information on the level of awareness of AMR among Nigerian public is deficient. This study was therefore designed to assess the current level of awareness and knowledge of the Nigerian public of AMR. Methods Pre-tested and validated questionnaire was used to obtain information from the general public across the six geopolitical zones (North Central, North East, North West, South East, South South and South West) in Nigeria. Multi-stage sampling was used to select one state from each zone and respondents were selected through a multi-stage sampling technique. Responses to eight questions were used to grade the level of knowledge categorized as poor, fair and good. Collation and analysis of data were performed at the Microbiology Department of the Nigerian Institute of Medical Research (NIMR), Lagos, Nigeria, using SPSS version 24.0. Results Questionnaires from 482 respondents comprising 242 (50.2%) females and 240 (49.8%) males from six states (Lagos, Ebonyi, Delta, Plateau, Borno and Jigawa) were analyzed. Of the 482 respondents, 322 (66.8%) had taken antibiotics in the last six months out of which 31.3% were without prescription. 26.1% of respondents believe they don’t need to complete the dosage as long as they feel better. Although 272(56.5%) of the respondents were familiar with the term “antibiotic resistance”, only 40(8.3%) had good knowledge of AMR. A majority (76.6%) believed that they were powerless to stop the spread of AMR. There was no association between the gender of respondents and knowledge of AMR (p = 0.13). However, respondents from Ebonyi and Delta states in southern Nigeria were more likely to have good knowledge of AMR (X2 = 53.22, P Conclusion This survey provides an insight into the level of AMR awareness and antibiotic use in the wider Nigeria public. Our findings show that about a third of the general public consume antibiotics obtained without prescription. There is an overall poor understanding of antimicrobial resistance and/or proper use of antibiotics among respondents. It is critical that more holistic public enlightenment programs are carried out to increase awareness of AMR and promote responsible use of antibiotics.

Objective: Cleft lip and/or cleft palate (CL/P) are congenital anomalies of the face and have multifactorial etiology, with both environmental and genetic risk factors playing crucial roles. Though at least 40 loci have attained genomewide significant association with nonsyndromic CL/P, these loci largely reside in noncoding regions of the human genome, and subsequent resequencing studies of neighboring candidate genes have revealed only a limited number of etiologic coding variants. The present study was conducted to identify etiologic coding variants in GREM1, a locus that has been shown to be largely associated with cleft of both lip and soft palate. Patients and Method: We resequenced DNA from 397 sub-Saharan Africans with CL/P and 192 controls using Sanger sequencing. Following analyses of the sequence data, we observed 2 novel coding variants in GREM1. These variants were not found in the 192 African controls and have never been previously reported in any public genetic variant database that includes more than 5000 combined African and African American controls or from the CL/P literature. Results: The novel variants include p.Pro164Ser in an individual with soft palate cleft only and p.Gly61Asp in an individual with bilateral cleft lip and palate. The proband with the p.Gly61Asp GREM1 variant is a van der Woude (VWS) case who also has an etiologic variant in IRF6 gene. Conclusion: Our study demonstrated that there is low number of etiologic coding variants in GREM1, confirming earlier suggestions that variants in regulatory elements may largely account for the association between this locus and CL/P.

In contrast to the progress that has been made toward understanding the genetic etiology of cleft lip with or without cleft palate, relatively little is known about the genetic etiology for cleft palate only (CPO). A common coding variant of grainyhead like transcription factor 3 ( GRHL3) was recently shown to be associated with risk for CPO in Europeans. Mutations in this gene were also reported in families with Van der Woude syndrome. To identify rare mutations in GRHL3 that might explain the missing heritability for CPO, we sequenced GRHL3 in cases of CPO from Africa. We recruited participants from Ghana, Ethiopia, and Nigeria. This cohort included case-parent trios, cases and other family members, as well as controls. We sequenced exons of this gene in DNA from a total of 134 nonsyndromic cases. When possible, we sequenced them in parents to identify de novo mutations. Five novel mutations were identified: 2 missense (c.497C>A; p.Pro166His and c.1229A>G; p.Asp410Gly), 1 splice site (c.1282A>C p.Ser428Arg), 1 frameshift (c.470delC; p.Gly158Alafster55), and 1 nonsense (c.1677C>A; p.Tyr559Ter). These mutations were absent from 270 sequenced controls and from all public exome and whole genome databases, including the 1000 Genomes database (which includes data from Africa). However, 4 of the 5 mutations were present in unaffected mothers, indicating that their penetrance is incomplete. Interestingly, 1 mutation damaged a predicted sumoylation site, and another disrupted a predicted CK1 phosphorylation site. Overexpression assays in zebrafish and reporter assays in vitro indicated that 4 variants were functionally null or hypomorphic, while 1 was dominant negative. This study provides evidence that, as in Caucasian populations, mutations in GRHL3 contribute to the risk of nonsyndromic CPO in the African population.

Introduction: effective and safe means of sample collection is a crucial component of testing for Covid-19. Uptake of testing is key to containing and controlling the spread of the virus. Scientists have been working on various strategies that will increase the uptake of testing for COVID-19. One such method involves the use of the drive-through sampling strategy. Methods: data was collected by both qualitative and quantitative methods. An eligibility form was filled online. While in-depth interviews were conducted for the qualitative aspect of the study. Results: 2,600 visits were recorded at the website, 2300 (88.46%) participants successfully registered for the test. 57.4% were found eligible of which 78.0% presented for the test. This Consisted of 78.0% drive-through and 22.0% walk-in. The average time for transiting through the drive-through site was 19.2 ± 4.6minutes while that of the walk-in was 28 ± 9.2min. This difference was statistically significant (p

Background We identified a HIV-positive cohort in virologic failure (VF) who re-suppressed without drug switch. We characterized their drug resistance mutations (DRM) and adherence profiles to learn how to better manage HIV drug resistance. A retrospective cohort study utilizing clinical data and stored samples. Patients received ART at three Nigerian treatment centres. Plasma samples stored when they were in VF were genotyped. Result Of 126 patients with samples available, 57 were successfully genotyped. From ART initiation, the proportion of patients with adherence ≥90% increased steadily from 54% at first high viral load (VL) to 67% at confirmed VF, and 81% at time of re-suppressed VL. Sixteen (28%) patients had at least one DRM. Forty-six (81%) patients had full susceptibility to the three drugs in their first-line (1 L) regimen. Thirteen (23%) were resistant to at least one antiretroviral drug but three were resistant to drugs not used in Nigeria. Ten patients had resistance to their 1 L drug(s) and six were fully susceptible to the three drugs in the recommended second-line regimen. Conclusion This cohort had little drug resistance mutations. We conclude that if adherence is not assured, patients could exhibit virologic failure without having developed mutations associated with drug resistance.

The natural history of chronic hepatitis B virus (HBV) infection and the spectrum of diseases attributable to chronic hepatitis B are diverse. It is estimated that 15%-25% of chronic carriers will die from complications of progressive disease such as liver cirrhosis, hepatocellular carcinoma, and hepatic decompensation. The main aim of this study is to evaluate the serological and virological profile of patients with hepatitis B infection to enhance the evaluation of the natural history of viral hepatitis in an endemic population.Characteristics of hepatitis B surface antigen (HBsAg) patients (2010-2016) were extracted from the database of a reference laboratory in Lagos. These included serological tests for hepatitis B antigens (HBeAg, HBsAg), antibodies (anti-HBcIgM, anti-HBeAb) (DIA.PRO), and HBV DNA (Roche Diagnostics). SPSS version 20.0 was used for data analysis.Of the 1,983 patients, 1,252 were male and 731 female. HBeAg was detected in 8.0% (128/1,605) of the subjects, anti-HBe was positive in 90.0% (1,257/1,396), while HBcore subclass IgM antibody was detected in 12.6% (116/930). Detectable HBV DNA was identified in 1,781 (89%), with viral load exceeding 2,001 IU/mL in 712 (35.9%) subjects. HBV viral loads200,000 IU/mL were more frequently detected in HBeAg-positive compared with HBeAg-negative subjects (65.7% vs 4.9%, P0.0001).We have demonstrated the predominance of low replicative phase HBV infection and highlighted the importance of HBeAg-negative infections that may require antiviral therapy. HBeAg-positive infections occurred significantly in younger adults with new or acute infections. Our findings have implications for patient evaluation and planning of hepatitis treatment programs.

Background The increasing trends of morbidity and mortality of Lassa fever is becoming more alarming in Nigeria. Information about immune response to the virus is limited. At exposure, the level of immunity plays a vital role in the vulnerability of individuals infected. Objective Investigating the immune status of health workers, infected cases and contacts of infected cases of Lassa fever in Ondo State. Study Design Blood samples were collected from 233 individuals comprising 102 health workers, 22 infected cases and 109 contacts of infected cases from Owo and Ose Local Government Areas and transported in triple level packaging. Plasma samples were analyzed for IgG and IgM markers using ReLASV® Pan-Lassa NP IgG/IgM ELISA Kit (Zalgen Labs, LLC, USA) while RNAs extracted from IgM positive samples were analyzed for LASV RNA according to manufacturers’ instructions. Result Among the health workers, 20/102 (19.6%) and 2/102 (2.0%) were IgG and IgM positive respectively. While 16/22 (72.7%) and 14/22 (63.6%) were IgG and IgM positive respectively among the infected cases. Of the contacts of infected cases screened, 64/109 (58.7%) were IgG positive while 4/109 (3.7%) were positive for IgM. There was no detectable LASV RNA in the samples analyzed. Conclusion These findings suggest that majority of the health workers are naive to the virus and hence may be prone to the viral infection. It could also be suggestive that a good personal protective procedure is been practiced by the health workers, hence the low exposure. However, most of the contacts of infected cases show exposure to the virus.

A key element in containing the spread of the SARS-CoV-2 infection is quality diagnostics which is affected by several factors. We now report the comparative performance of five real-time diagnostic assays. Nasopharyngeal swab samples were obtained from persons seeking a diagnosis for SARS-CoV-2 infection in Lagos, Nigeria. The comparison was performed on the same negative, low, and high-positive sample set, with viral RNA extracted using the Qiagen Viral RNA Kit. All five assays are one-step reverse transcriptase real-time PCR assays. Testing was done according to each assay’s manufacturer instructions for use using real-time PCR platforms. 63 samples were tested using the five qPCR assays, comprising of 15 negative samples, 15 positive samples (Ct = 16–30; one Ct = 35), and 33 samples with Tib MolBiol E-gene Ct value ranging from 36–41. All assays detected all high positive samples correctly. Three assays correctly identified all negative samples while two assays each failed to correctly identify one different negative sample. The consistent detection of positive samples at different Ct/Cq values gives an indication of when to repeat testing and/or establish more stringent in-house cut-off value. The varied performance of different diagnostic assays, mostly with emergency use approvals, for a novel virus is expected. Comparative assays’ performance reported may guide laboratories to determine both their repeat testing Ct/Cq range and/or cut-off value.

Background Orofacial clefts are the most common malformations of the head and neck region. Genetic and environmental factors have been implicated in the etiology of these traits. Methods We recently conducted genotyping of individuals from the African population using the multiethnic genotyping array (MEGA) to identify common genetic variation associated with nonsyndromic orofacial clefts. The data cleaning of this dataset allowed for screening of annotated sex versus genetic sex, confirmation of identify by descent and identification of large chromosomal anomalies. Results We identified the first reported orofacial cleft case associated with paternal uniparental disomy (patUPD) on chromosome 22. We also identified a de novo deletion on chromosome 18. In addition to chromosomal anomalies, we identified cases with molecular karyotypes suggesting Klinefelter syndrome, Turner syndrome and Triple X syndrome. Conclusion Observations from our study support the need for genetic testing when clinically indicated in order to exclude chromosomal anomalies associated with clefting. The identification of these chromosomal anomalies and sex aneuploidies is important in genetic counseling for families that are at risk. Clinicians should share any identified genetic findings and place them in context for the families during routine clinical visits and evaluations.