Search

Gastro-intestinal tumours (GISTs) are driven by aberrant expression of the c-KIT oncoprotein. They can be effectively treated by the kinase inhibitor imatinib, which locks the c-KIT kinase domain into an inactive conformation. However resistance to imatinib, driven by active-site mutations, is a recurrent clinical challenge, which has been only partly met by the subsequent development of second and third-generation c-KIT inhibitors. It is reported here that a tetra-substituted naphthalene diimide derivative, which is a micromolar inhibitor of cell growth in a wild-type patient-derived GIST cell line, has a sub-micromolar activity in two distinct patient-derived imatinib-resistant cell lines. The compound has been previously shown to down-regulate expression of the c-KIT protein in a wild-type GIST cell line. It does not affect c-KIT protein expression in a resistant cell line to the same extent, whereas it profoundly down-regulates the expression of the anti-apoptopic protein BCL-2. It is proposed that the mechanism of action involves targeting quadruplex nucleic acid structures, and in particular those in the BCL-2 gene and its RNA transcript. The BCL-2 protein is up-regulated in the GIST-resistant cell line, and is strongly down-regulated after treatment. The compound strongly stabilises a range of G-quadruplexes including a DNA one from the BCL-2 promoter and an RNA quadruplex from its 5'-UTR region. A reporter assay construct incorporating the 5'-UTR quadruplex sequence demonstrates down-regulation of BCL-2 expression., (Copyright © 2018 Elsevier Ltd. All rights reserved.)

Tetra-substituted naphthalene diimide (ND) derivatives with positively charged termini are potent stabilizers of human telomeric and gene promoter DNA quadruplexes and inhibit the growth of human cancer cells in vitro and in vivo. The present study reports the enhancement of the pharmacological properties of earlier ND compounds using structure-based design. Crystal structures of three complexes with human telomeric intramolecular quadruplexes demonstrate that two of the four strongly basic N-methyl-piperazine groups can be replaced by less basic morpholine groups with no loss of intermolecular interactions in the grooves of the quadruplex. The new compounds retain high affinity to human telomeric quadruplex DNA but are 10-fold more potent against the MIA PaCa-2 pancreatic cancer cell line, with IC50 values of ~10 nM. The lead compound induces cellular senescence but does not inhibit telomerase activity at the nanomolar dosage levels required for inhibition of cellular proliferation. Gene array qPCR analysis of MIA PaCa-2 cells treated with the lead compound revealed significant dose-dependent modulation of a distinct subset of genes, including strong induction of DNA damage responsive genes CDKN1A, DDIT3, GADD45A/G, and PPM1D, and repression of genes involved in telomere maintenance, including hPOT1 and PARP1.

G-quadruplexes are higher-order nucleic acid structures that can form in G-rich telomeres and promoter regions of oncogenes. Telomeric quadruplex stabilization by small molecules can lead to telomere uncapping, followed by DNA damage response and senescence, as well as chromosomal fusions leading to deregulation of mitosis, followed by apoptosis and downregulation of oncogene expression. We report here on investigations into the mechanism of action of tetra-substituted naphthalene diimide ligands on the basis of cell biologic data together with a National Cancer Institute COMPARE study. We conclude that four principal mechanisms of action are implicated for these compounds: 1) telomere uncapping with subsequent DNA damage response and senescence; 2) inhibition of transcription/translation of oncogenes; 3) genomic instability through telomeric DNA end fusions, resulting in mitotic catastrophe and apoptosis; and 4) induction of chromosomal instability by telomere aggregate formation.

The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these can be selectively targeted by non-macrocyclic quadruplex-stabilizing phenyl bis-oxazole derivatives. These do not bind significantly to duplex DNA and show low stabilization of the human telomeric quadruplex. These results suggest an approach to targeting HSP90 at the DNA level., (Copyright © 2012 Elsevier Ltd. All rights reserved.)

The ability of small molecules to target DNA forms the basis of many clinically used antitumour agents. This study examines the effects of novel 9-aminoacridine carboxamides, synthesised by click chemistry based upon the reactions of either 9-(2-azidoethyl)amino or 9-propargylaminoacridine compounds, on various types of DNA tertiary structures. This gave either monomeric or dimeric compounds, the dimeric derivatives being the first unsymmetrical acridine dimers to be described. The compounds were assayed for duplex DNA, quadruplex DNA and four-way junction DNA binding. Their antiproliferative activity in the Human promyelocytic leukaemia cell line, HL60, was also assessed. Although for some of the compounds, notably the acridine 4-carboxamides, activity correlated with DNA binding affinity, for others it did not, with the rigidly linked dimers in particular showing a complicated relationship between 3- and 4-carboxamide structure and biological activity. The monomeric 3-carboxamides were more effective at stabilising G-quadruplex structures and also gave more hits in the four-way junction stabilisation assay. There is clear evidence from the binding of the 3-carboxamides that these compounds destabilise the open X form of the junction at lower concentrations and stabilise the X-stacked at higher concentrations. This might have implications for the biological activity of these compounds against proteins that bind to the Holliday junction (HJ)., (Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.

Thirteen compounds with diverse chemical structures have been identified as selective telomeric G-quadruplex-binding ligands through screening the NCI Diversity Set II, the NCI Natural Products Set II and the NCI Mechanistic Diversity Set libraries containing a total of 2307 members against a human telomeric G-quadruplex using a FRET-based DNA melting assay. These compounds show significant selectivity towards a telomeric G-quadruplex compared to duplex DNA, fall within a molecular weight range of 327-533, and are generally consistent with the Lipinski Rule of Five for drug-likeness. Thus they provide new chemical scaffolds for the development of novel classes of G-quadruplex-targeting agents., (Copyright © 2012 Elsevier Ltd. All rights reserved.)

The integrity of telomeres in most cancer cells is maintained by the action of the telomerase enzyme complex, which catalyzes the synthesis of telomeric DNA repeats in order to replace those lost during replication. Telomerase is especially up-regulated in metastatic cancer and is thus emerging as a major therapeutic target. One approach to telomerase inhibition involves the sequestration of the single-stranded 3' ends of telomeric DNA into higher-order quadruplex structures. We have recently shown that tetra-substituted naphthalene diimide compounds are potent quadruplex-stabilizing molecules with telomerase inhibitory activity in cells. We show here that one such compound, BMSG-SH-3, which has been optimized by computer modeling, has significant in vivo antitumor activity against a model for pancreatic cancer, a cancer that is especially resistant to current therapies. A large reduction in telomerase activity in treated tumors was observed and the naphthalene diimide compound was found to be selectively localized in the treated tumors. We find that the expression of the therapeutically important chaperone protein HSP90, a regulator of telomerase is also reduced in vivo by BMSG-SH-3 treatment. The compound is a potent stabilizer of two G-quadruplex sequences found in the promoter region of the HSP90 gene, as well as a G-quadruplex from human telomeric DNA. It is proposed that the simultaneous targeting of these quadruplexes may be an effective anti-tumor strategy., (Copyright © 2011 Elsevier Ltd. All rights reserved.)

Comparative X-ray structure studies reveal that C-F bond incorporation into the peripheral pyrrolidine moieties of the G-quadruplex DNA binding ligand BSU6039 leads to a distinct pyrrolidine ring conformation, relative to the non-fluorinated analogue, and with a different binding mode involving reversal of the pyrrolidinium N(+)-H orientation.

G-Quadruplex DNA ligands are promising novel anticancer agents with potentially fewer side effects and greater selectivity than standard anticancer drugs. However, the design of G-quadruplex ligands remains challenging since known chemical features increasing selectivity have often compromised drugability. Three C-11 diamino cryptolepine derivatives, with significant chemical differences between the side chains, low cytotoxicity to mammalian non-tumor cells (Vero cells) and drug-like properties, were selected for anticancer drug screening in the NCI Developmental Therapeutics Program. The three compounds showed good in vitro anticancer profiles with GI(50) averages at sub-micromolar concentrations (0.32-0.78 μM), cytostatic effects (TGI) at micromolar concentrations (1.3-6.9 μM) and moderate cytotoxic effects to cancer cells (LC(50)) also at micromolar concentrations (4.7-33 μM), but only the compound with a linear alkylamine side chain (NSC748393) showed a good score in the in vivo anticancer Hollow Fiber assay. compare analysis of growth inhibition profile of NSC748393 suggested a multi-target mechanism. G-Quadruplex DNA binding affinity and selectivity studies by FRET-melting assays showed that NSC748392 and NSC478393, with aliphatic amine side chains, are good G-quadruplex ligands but not selective, whereas a C-11 aromatic side chain, as in NSC748394, increases selectivity although with decreasing binding affinity. Overall, NSC748393 can be considered a lead molecule for the design of effective but more selective anticancer drugs targeting telomeric G-quadruplexes., (Copyright © 2010 Elsevier Ltd. All rights reserved.)

A comprehensive SAR investigation of the C2-position of pyrrolo[2,1-c][1,4]benzodiazepine (PBD) monomer antitumor agents is reported, establishing the molecular requirements for optimal in vitro cytotoxicity and DNA-binding affinity. Both carbocyclic and heterocyclic C2-aryl substituents have been studied ranging from single aryl rings to fused ring systems, and also styryl substituents, establishing across a library of 80 analogues that C2-aryl and styryl substituents significantly enhance both DNA-binding affinity and in vitro cytotoxicity, with a correlation between the two. The optimal C2-grouping for both DNA-binding affinity and cytotoxicity was found to be the C2-quinolinyl moiety which, according to molecular modeling, is due to the overall fit of the molecule in the DNA minor groove, and potential specific contacts with functional groups in the floor and walls of the groove. This analogue (14l) was shown to delay tumor growth in a HCT-116 (bowel) human tumor xenograft model.

Quadruplex RNAs are less well understood than their DNA counterparts, yet of potentially high biological relevance. The interactions of several quadruplex-binding ligands with telomeric RNA quadruplexes are reported and compared with their binding to the analogous DNA quadruplexes.

Guanine-rich DNA sequences with the ability to form quadruplex structures are enriched in the promoter regions of protein-coding genes, particularly those of proto-oncogenes. G-quadruplexes are structurally polymorphic and their folding topologies can depend on the sample conditions. We report here on a structural study using solution state NMR spectroscopy of a second G-quadruplex-forming motif (c-kit2) that has been recently identified in the promoter region of the c-kit oncogene. In the presence of potassium ions, c-kit2 exists as an ensemble of structures that share the same parallel-stranded propeller-type conformations. Subtle differences in structural dynamics have been identified using hydrogen-deuterium exchange experiments by NMR spectroscopy, suggesting the coexistence of at least two structurally similar but dynamically distinct substates, which undergo slow interconversion on the NMR timescale.

We report a novel class of biaryl polyamides highly selective for G-quadruplex DNA, and with significant cytotoxicity in several cancer cell lines; they form planar U-shaped structures that match the surface area dimensions of a terminal G-quartet in quadruplex structures rather than the grooves of duplex DNA.

Most of human gastrointestinal stromal tumors (GIST) are driven by activating mutations in the proto-oncogene KIT, a tyrosine kinase receptor. Clinical treatment with imatinib targets the kinase domain of KIT, but tumor regrowth occurs as a result of the development of resistant mutations in the kinase active site. An alternative small-molecule approach to GIST therapy is described, in which the KIT gene is directly targeted, and thus, kinase resistance may be circumvented. A naphthalene diimide derivative has been used to demonstrate the concept of dual quadruplex targeting. This compound strongly stabilizes both telomeric quadruplex DNA and quadruplex sites in the KIT promoter in vitro. It is shown here that the compound is a potent inducer of growth arrest in a patient-derived GIST cell line at a concentration (approximately 1 microM) that also results in effective inhibition of telomerase activity and almost complete suppression of KIT mRNA and KIT protein expression. Molecular modeling studies with a telomeric quadruplex have been used to rationalize aspects of the experimental quadruplex melting data.

We have explored a series of trisubstituted acridine-peptide conjugates for their ability to recognize and discriminate between DNA quadruplexes derived from the human telomere, and the c-kit and N-ras proto-oncogenes. Quadruplex affinity was measured as the peptide sequences were varied, together with their substitution position on the acridine, and the identity of the C-terminus (acid or amide). Surface plasmon resonance measurements revealed that all compounds bound to the human telomeric quadruplex with sub-micromolar affinity. Docking calculations from molecular modelling studies were used to model the effects of substituent orientation and peptide sequence. Modelling and experiment were in agreement that placement of the peptide over the face of the acridine is detrimental to binding affinity. The highest degrees of selectivity were observed towards the N-ras quadruplex by compounds capable of forming simultaneous contacts with their acridine and peptide moieties. The ligands that bound best displayed quadruplex affinities in the 1-5 nM range and at least 10-fold discrimination between the quadruplexes studied.

The design and synthesis of a series of urea-based nonpolycyclic aromatic ligands with alkylaminoanilino side chains as telomeric and genomic G-quadruplex DNA interacting agents are described. Their interactions with quadruplexes have been examined by means of fluorescent resonance energy transfer melting, circular dichroism, and surface plasmon resonance-based assays. These validate the design concept for such urea-based ligands and also show that they have significant selectivity over duplex DNA, as well as for particular G-quadruplexes. The ligand-quadruplex complexes were investigated by computational molecular modeling, providing further information on structure-activity relationships. Preliminary biological studies using short-term cell growth inhibition assays show that some of the ligands have cancer cell selectivity, although they appear to have low potency for intracellular telomeric G-quadruplex structures, suggesting that their cellular targets may be other, possibly oncogene-related quadruplexes.

The telomerase enzyme is implicated in a large proportion of human cancers. Its major function is to maintain the length of telomeric DNA by synthesizing telomeric DNA repeats, and its enzymatic activity is assayed by means of the telomere repeat amplification protocol (TRAP) assay. We show here that this assay is unable to reliably determine the ability of small molecules to inhibit the enzyme because they interfere with the PCR step of the assay, resulting in a major overestimation of their activity. We report a modified TRAP assay that incorporates the addition of an intermediate step, enabling ligand to be removed from the final PCR process using a commercially available oligonucleotide purification kit, so that more reliable estimates of telomerase inhibition can be made.

The crystal structure of a complex between the bimolecular human telomeric quadruplex d(TAGGGTTAGGGT)2 and the experimental anticancer drug BRACO-19, has been determined, to 2.5 A resolution. The binding site for the BRACO-19 molecule is at the interface of two parallel-folded quadruplexes, sandwiched between a G-tetrad surface and a TATA tetrad, and held in the site by networks of water molecules. The structure rationalizes the existing structure-activity data and provides a starting-point for the structure-based design of quadruplex-binding ligands

The trisubstituted acridine compound BRACO-19 has been developed as a ligand for stabilising G-quadruplex structures. It is shown here that BRACO-19 produces short- and long-term growth arrest in cancer cell lines, and is significantly less potent in a normal cell line. BRACO-19 reduces telomerase activity and long-term telomere length attrition is observed. It is also shown that BRACO-19 binds to telomeric single-stranded overhang DNA, consistent with quadruplex formation, and the single-stranded protein hPOT1 has been shown to be displaced from the overhang in vitro and in cellular experiments. It is concluded that the cellular activity of BRACO-19 can be ascribed both to the uncapping of 3' telomere ends and to telomere shortening that may preferentially affect cells with short telomeres.

The design, synthesis, biophysical and biochemical evaluation is presented of a new series of benzylamino-substituted acridines as G-quadruplex binding telomerase inhibitors. Replacement of the previously reported anilino substituents by benzylamino groups results in enhanced quadruplex interaction, and for one compound, superior telomerase inhibitory activity.

Combining structure-specific recognition of nucleic acids with limited sequence reading is a promising method to reduce the size of the recognition unit required to achieve the necessary selectivity and binding affinity to control function. It has been demonstrated recently that G-quadruplex DNA structures can be targeted by organic cations in a structure-specific manner. Structural targets of quadruplexes include the planar end surfaces of the G-tetrad stacked columns and four grooves. These provide different geometries and functional groups relative to duplex DNA. We have used surface plasmon resonance and isothermal titration calorimetry to show that binding affinity and selectivity of a series of quadruplex end-stacking molecules to human telomeric DNA are sensitive to compound shape as well as substituent type and position. ITC results indicate that binding is largely enthalpy driven. Circular dichroism was also used to identify a group of structurally related compounds that selectively target quadruplex grooves.

We describe the identification of small-molecule G-quadruplex ligands using a direct ELISA screen of a one-bead-one-compound library of unnatural polyamides displayed on a branched linker with a biotin tag. This general purpose parallel screen for small molecule-oligonucleotide interactions was validated by surface plasmon resonance and ELISA of resynthesized compounds. Linear polyamides displayed similar rankings in their affinity for quadruplex as their branched counterparts. Quadruplex affinity as judged by these surface based techniques was a useful predictor of the ability of the ligands to stabilize the quadruplex to thermal unfolding in solution.

The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. Mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small variation in sequence between the quadruplex in human/chimpanzee as compared to the rat/mouse was examined more closely by biophysical methods. Despite a variation in the sequence and length of loop 2, the quadruplexes showed both comparable CD spectra, indicative of parallel quadruplexes, and also similar thermal-stability profiles, suggesting conservation of biophysical characteristics. Collectively, the evidence suggests that this quadruplex is a serious target for a detailed functional investigation at the cell-biology level.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Interference with telomerase and telomere maintenance is emerging as an attractive target for anticancer therapies. Ligand-induced stabilization of G-quadruplex formation by the telomeric DNA single-stranded 3' overhang inhibits telomerase from catalyzing telomeric DNA synthesis and from capping telomeric ends. We report here the effects of a 3,6,9-trisubstituted acridine compound, BRACO-19, on telomerase function in vitro and in vivo. The biological activity of BRACO-19 was evaluated in the human uterus carcinoma cell line UXF1138L, which has very short telomeres (2.7 kb). In vitro, nuclear human telomerase reverse transcriptase (hTERT) expression was drastically decreased after 24 hours, induction of cellular senescence and complete cessation of growth was seen after 15 days, paralleled by telomere shortening of ca. 0.4 kb. In vivo, BRACO-19 was highly active as a single agent against early-stage (68 mm(3)) tumors in a s.c. growing xenograft model established from UXF1138L cells, if given chronically at 2 mg per kg per day i.p. BRACO-19 produced growth inhibition of 96% compared with controls accompanied by partial regressions (P < 0.018). Immunostaining of xenograft tissues showed that this response was paralleled by loss of nuclear hTERT protein expression and an increase in atypical mitoses indicative of telomere dysfunction. Cytoplasmic hTERT expression and its colocalization with ubiquitin was observed suggesting that hTERT is bound to ubiquitin and targeted for enhanced degradation upon BRACO-19 treatment. This is in accord with a model of induced displacement of telomerase from the telomere. The in vitro and in vivo data presented here is consistent with the G-quadruplex binding ligand BRACO-19 producing an anticancer effect by inhibiting the capping and catalytic functions of telomerase.

The synthesis and evaluation of a group of 2,6-, 2,7- and 3,6-bis-aminoalkylamido acridones are reported, which show a similar level of activity against telomerase in vitro compared to their acridine counterparts. Computer modelling and calculations of relative binding energies suggest an equivalent binding mode to human intramolecular G-quadruplex DNA, but with significantly reduced affinity, as a result of the limited delocalisation of the acridone chromophore compared to the acridine system. Thermal melting studies on acridone and acridine quadruplex complexes using a FRET approach support these predictions. Long-term cell proliferation studies at sub-cytotoxic doses with two representative acridones using the SKOV3 cell line, show that neither compound produces growth arrest, in contrast with the effects produced by the tri-substituted acridine compound BRACO-19. It is concluded that telomerase inhibitory activity is a necessary though by itself insufficient property in order for cellular growth arrest to occur at sub-toxic concentrations, and that tight quadruplex binding is also required.

The synthesis and evaluation for telomerase-inhibitory and quadruplex DNA binding properties of three related series of rationally designed trisubstituted acridine derivatives are described. These are substituted on the acridine ring at the 2,6,9; 2,7,9; and 3,6,9 positions. The ability of several of the most potent compounds to interact with and stabilize an intramolecular G-quadruplex DNA was evaluated by surface plasmon resonance methods, and affinities were found to correlate with potency in a telomerase assay. The interactions of a number of compounds with a parallel quadruplex DNA structure were simulated by molecular modeling methods. The calculated interaction energies were compared with telomerase activity and showed generally consistent correlations between quadruplex affinity and telomerase inhibition. These data support a model for the action of these compounds that involves the stabilization of intermediate quadruplex structures that inhibit the elongation of telomeric DNA by telomerase in tumor cells.

G-Quadruplex DNAs are folded, non-Watson-Crick structures that can form within guanine-rich DNA sequences such as telomeric repeats. Previous studies have identified a series of trisubstituted acridine derivatives that are potent and selective ligands for G-quadruplex DNA. These ligands have been shown previously to inhibit the activity of telomerase, the specialized reverse transcriptase that regulates telomere length. The RecQ family of DNA helicases, which includes the Bloom's (BLM) and Werner's (WRN) syndrome gene products, are apparently unique among cellular helicases in their ability to efficiently disrupt G-quadruplex DNA. This property may be relevant to telomere maintenance, since it is known that the sole budding yeast RecQ helicase, Sgs1p, is required for a telomerase-independent telomere lengthening pathway reminiscent of the "ALT" pathway in human cells. Here, we show that trisubstituted acridine ligands are potent inhibitors of the helicase activity of the BLM and WRN proteins on both G-quadruplex and B-form DNA substrates. Inhibition of helicase activity is associated with both a reduction in the level of binding of the helicase to G-quadruplex DNA and a reduction in the degree to which the G-quadruplex DNA can support DNA-dependent ATPase activity. We discuss these results in the context of the possible utility of trisubstituted acridines as antitumor agents for the disruption of both telomerase-dependent and telomerase-independent telomere maintenance.

The telomerase enzyme is a potential therapeutic target in many human cancers. A series of potent inhibitors has been designed by computer modeling, which exploit the unique structural features of quadruplex DNA. These 3,6,9-trisubstituted acridine inhibitors are predicted to interact selectively with the human DNA quadruplex structure, as a means of specifically inhibiting the action of human telomerase in extending the length of single-stranded telomeric DNA. The anilino substituent at the 9-position of the acridine chromophore is predicted to lie in a third groove of the quadruplex. Calculated relative binding energies predict enhanced selectivity compared with earlier 3,6-disubstituted compounds, as a result of this substituent. The ranking order of energies is in accord with equilibrium binding constants for quadruplex measured by surface plasmon resonance techniques, which also show reduced duplex binding compared with the disubstituted compounds. The 3,6,9-trisubstututed acridines have potent in vitro inhibitory activity against human telomerase, with EC(50) values of up to 60 nM.

Triple helix-forming oligonucleotides may be useful as gene-targeting reagents in vivo, for applications such as gene knockout. One important property of these complexes is their often remarkable stability, as demonstrated in solution and in cells following transfection. Although encouraging, these measurements do not necessarily report triplex stability in cellular compartments that support DNA functions such as replication and mutagenesis. We have devised a shuttle vector plasmid assay that reports the stability of triplexes on DNA that undergoes replication and mutagenesis. The assay is based on plasmids with novel variant supF tRNA genes containing embedded sequences for triplex formation and psoralen cross-linking. Triple helix-forming oligonucleotides were linked to psoralen and used to form triplexes on the plasmids. At various times after introduction into cells, the psoralen was activated by exposure to long wave ultraviolet light (UVA). After time for replication and mutagenesis, progeny plasmids were recovered and the frequency of plasmids with mutations in the supF gene determined. Site-specific mutagenesis by psoralen cross-links was dependent on precise placement of the psoralen by the triple helix-forming oligonucleotide at the time of UVA treatment. The results indicated that both pyrimidine and purine motif triplexes were much less stable on replicated DNA than on DNA in vitro or in total transfected DNA. Incubation of cells with amidoanthraquinone-based triplex stabilizing compounds enhanced the stability of the pyrimidine triplex.

The ribonucleoprotein telomerase is responsible for maintaining the length of telomeric ends of chromosomes in tumour cells. It is activated in over 85% of the tumour cells, and is emerging as a major target for cancer chemotherapy. A range of molecules containing tricyclic and tetracyclic aromatic chromophores has been shown to inhibit the telomerase enzyme system at the micromolar level. There is evidence that they do so via stabilisation of a guanine-quadruplex structure, which provides a stop signal for further telomere elongation. The known structure-activity relationships for these compounds are summarised, and pointers for the development of future molecules with enhanced selectivity are described.

We have used quantitative DNase I footprinting to measure the relative affinities of four disubstituted and two monosubstituted amidoanthraquinone compounds for intermolecular DNA triplexes, and have examined how the position of the attached base-functionalized substituents affects their ability to stabilize DNA triplexes. All four isomeric disubstituted derivatives examined stabilize DNA triplexes at micromolar or lower concentrations. Of the compounds studied the 2,7-disubstituted amidoanthraquinone displayed the greatest triplex affinity. The order of triplex affinity for the other disubstituted ligands decreases in the order 2,7 > 1,8 = 1,5 > 2,6, with the equivalent monosubstituted compounds being at least an order of magnitude less efficient. The 1,5-disubstituted derivative also shows some interaction with duplex DNA. These results have been confirmed by molecular modelling studies, which provide a rational basis for the structure-activity relationships. These suggest that, although all of the compounds bind through an intercalative mode, the 2,6, 2,7 and 1,5 disubstituted isomers bind with their two side groups occupying adjacent triplex grooves, in contrast with the 1,8 isomer which is positioned with both side groups in the same triplex groove.

Telomerase is a major new target for the rational design of novel anticancer agents. We have previously identified anthraquinone-based molecules capable of inhibiting telomerase by stabilizing G-quadruplex structures formed by the folding of telomeric DNA. In the present study we describe the synthesis and biological evaluation of a series of analogous fluorenone-based compounds with the specific aims of, first, determining if the anthraquinone chromophore is a prerequisite for activity and, second, whether the conventional cytotoxicity inherent to anthraquinone-based molecules may be reduced by rational design. This fluorenone series of compounds exhibits a broad range of telomerase inhibitory activity, with the most potent inhibitors displaying levels of activity (8-12 microM) comparable with other classes of G-quadruplex-interactive agents. Comparisons with analogous anthraquinone-based compounds reveal a general reduction in the level of cellular cytotoxicity. Molecular modeling techniques have been used to compare the interaction of fluorenone- and analogous anthraquinone-based inhibitors with a human G-quadruplex structure and to rationalize their observed biological activities.

Telomerase is an attractive target for the design of new anticancer drugs. We have previously described a series of 1,4- and 2, 6-difunctionalized amidoanthracene-9,10-diones that inhibit human telomerase via stabilization of telomeric G-quadruplex structures. The present study details the preparation of three further, distinct series of regioisomeric difunctionalized amidoanthracene-9,10-diones substituted at the 1,5-, 1,8-, and 2,7-positions, respectively. Their in vitro cytotoxicity and Taq DNA polymerase and human telomerase inhibition properties are reported and compared with those of their 1,4- and 2,6-isomers. Potent telomerase inhibition (telIC50 values 1.3-17.3 microM) is exhibited within each isomeric series. In addition, biophysical and molecular modeling studies have been conducted to examine binding to the target G-quadruplex structure formed by the folding of telomeric DNA. These studies indicate that the isomeric diamidoanthracene-9,10-diones bind to the human telomeric G-quadruplex structure with a stoichiometry of 1:1. Plausible G-quadruplex-ligand complexes have been identified for each isomeric family, with three distinct modes of intercalative binding being proposed. The exact mode of intercalative binding is dictated by the positional placement of substituent side chains. Furthermore, in contrast to previous studies directed toward triplex DNA, it is evident that stringent control over positional attachment of substituents is not a necessity for effective telomerase inhibition.

A number of 1,4- and 2,6-difunctionalized amidoanthracene-9, 10-diones have been prepared. We have examined their in vitro cytotoxicity in several tumor cell lines and their ability to inhibit the telomere-addition function of the human telomerase enzyme together with their inhibition of the Taq polymerase enzyme. Compounds with -(CH2)2- side chains terminating in basic groups such as piperidine show inhibition of telomerase at telIC50 levels of 4-11 microM. These are thus among the most potent nonnucleoside telomerase inhibitors reported to date. Cytotoxicity levels in human tumor cell lines were at comparable levels for several compounds. Implications for amidoanthracene-9,10-dione telomerase inhibitors as potential anticancer agents are discussed.

A triplex-forming oligopyrimidine has been attached at its 5'-end to a photoreactive psoralen derivative and used to target a sequence which forms part of the coding region of the human aromatase gene. The 20 base pair sequence is not a perfect triplex target since it contains three pyrimidine interruptions within the purine-rich strand. Despite this, we have detected triplex-directed photoadduct formation at pH 7.0 between the psoralen-linked oligonucleotide and a 30mer duplex representing the aromatase target. Photoadduct formation was found to be sensitive to pH, temperature, cation concentration and the base composition of the third strand. By varying the base sequence of the target duplex around the psoralen intercalation site, we have characterised the site and mode of psoralen intercalation. The attached psoralen has been found to intercalate at the triplex-duplex junction with a strong preference for one orientation. We have shown that the psoralen will bind at the junction even when there is a preferred TpA step at an adjacent site. We have also compared the binding affinity and photoreactivity of oligodeoxyribonucleotides linked to two different psoralen derivatives and found differences in the rate of crosslinking and the extent of crosslink formation. Finally, we have examined oligodeoxyribonucleotides which are attached to psoralen by polymethylene linkers of different lengths.

A series of 2,6-bis(omega-aminoalkanamido)anthracene-9,10-diones (9,10-anthraquinones), of general formula Ar(NHCO(CH2)nNR2)2, where Ar = anthracene-9,10-dione and n = 1 or 2, have been synthesized by treatment of the corresponding bis(omega-haloalkanamido) derivatives with appropriate secondary amines. The DNA-binding properties of these compounds were evaluated by thermal denaturation studies, unwinding of closed-circular DNA, determination of association constants in solution, and examined by molecular modeling. A representative compound in the series has been examined by X-ray crystallography. In vitro cytotoxicity data is reported for the compounds and some indications of structure-activity relationships have been discerned. In particular, those compounds with two methylene links (n = 2) in each side chain separating the amide and terminal amine moieties have superior activity and, in general, enhanced DNA binding characteristics. It is postulated that the mode of reversible binding of these compounds to DNA involves the side chains occupying both major and minor grooves and, further, that this may confer cytotoxic properties which are distinct from those of previously reported anthracene-9,10-dione cytotoxins.