Search

New glycyrrhizic acid (GA) conjugates were synthesized with the use of tert-butyl esters of amino acids or benzyl esters of dipeptides; they contained two residues of L-amino acids (Met, Phe, Pro, and Ile or dipeptides Gly-Leu and Gly-Phe). Activation of GA carboxy groups was carried out with the help of N-hydroxysuccinimide, N,N'-dicyclohexylcarbodiimide, or N-hydroxybenzotriazole with dicyclohexylcarbodiimide. A proline-containing GA derivative is a low-toxic substance; it raises the level of agglutinins by 3.7 times in the blood of mice and 3 times that of hemolysins compared with the control. Dipeptide GA derivatives possess an expressed anti-HIV-1 activity in cultures of MT-4 cells and are 90-70 times less cytotoxic than azidothymidine. The selectivity index of the compounds exceeds those of GA by 110 and 34 times, respectively.

New 5'-phosphonates of 3'-azido-3'-deoxythymidine were synthesized and shown to be low-toxic and markedly active in MT-4 cell cultures infected with HIV-1.

In vitro selection of HIV-1(EVK) variants resistant to highly effective nucleoside reverse transcriptase inhibitors (NNRTIs), i.e. azidothymidine (AZT) and didanosine (ddI) was performed. In case of AZT resistant mutants, subcloning by limiting dilutions was used. The isolated AZT resistant mutants and subclones had a broad spectrum of phenotypic resistance (8, 25, 53, 80, 114, 160-fold). The ddI resistant mutant possessed 10-fold resistance. The AZT resistant mutants and subclones had a high level of cross-resistance to H-phosphonate of AZT (H-phAZT) and a moderate level of cross-resistance to d4T. Still, they were effectively inhibited by a new compound, i.e. phosphonate of d4T.

Glycyrrhizic acid and its 30-methyl ester were conjugated with 2-amino-1,3,4,6-tetra-O-acetyl-2-deoxy-alpha-D-glucopyranose, 2,3,4,6-tetra-O-acetyl-beta-D-glucopyranosyl amine, 2,3,4-tri-O-acetyl-apha-L-arabinopyranosyl amine, 2-acetamido-2-deoxy-beta-D-glucopyranosyl amine, and beta-D-galactopyranosyl amine using N,N'-dicyclohexylcarbodiimide and its mixtures with N-hydroxybenzotriazole. Structures of the conjugates were confirmed by IR, UV, 1H, and 13C NMR spectroscopy. The glycoconjugate with the residues of 2-acetamido-2-deoxy-beta-D-glucopyranosyl amine in the carbohydrate part of its molecule exhibited antiviral activity (ID50 4 microg/ml) toward the herpes simplex type 1 virus (HSV-1) in the VERO cell culture. Two compounds demonstrated anti-HIV-1 activity (50-70% inhibition of p24) in a culture of MT-4 cells at concentrations of 0.5-20 microg/ml. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2004, vol. 30, no. 3; see also http://www.maik.ru.

The anti-HIV activity of niglizin (penta-O-nicotinate of glycyrrhizic acid) and of its combinations was studied in the culture of infected MT-4 cells and in respect to the recombinant reverse HIV-1 transcriptase. Niglizin was shown to suppress effectively the HIV replication and to be a noncompetitive inhibitor of reverse transcriptase. Research of a combined anti-HIV action of niglizin and of azidothimidine (AZT) demonstrated that the preparations, when used at ratios of 1:20, 1:50, 1:200 and 1:2000, suppressed the synergetic effect both in the cell culture and in the recombinant reverse HIV transcriptase. A study of the antiviral activity of niglizin and of its joint use with AZT in respect to the AZT-resistant HIV-1 mutant showed niglizin to be more effective (ID50 = 0.134 microM) versus the "wild" strain. (ID50 = 9.64 micriM); whereas, its combined use AZT:niglizin = 1:100 displayed synergism (FIC = 0.553). The efficiency of the combined AZT/niglizin anti-HIV effect both in respect to the "wild" strain and to the AZT-resistant mutant confirms that such combinations are promising for the treatment of HIV infection.

The assignment of NMR resonances of lupane triterpenoids was refined by the example of 3,28-dinicotinoylbetulin, obtained by acylation of betulin. Hepatoprotective, untiulcer, antiinflammatory, reparative, and anti-HIV activities were found for the compound. In addition, it was demonstrated to have immunomodulatory activity, for the first time detected among lupane triterpenoids. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2002, vol. 28, no. 6; see also http://www.maik.ru.

Cell culture U937 chronically infected with HIV-1 is suggested as a model for adequate evaluation of antiviral activity of HIV inhibitors. Azidothimidine (AZT) notable decreased HIV-1 reproduction in chronically infected U937 cells to passages 15-18. Glycirrhizic acid (GA) effectively inhibited the virus production during the first four passages, while in subsequent passages (up to passage 20) decreased the virus production by only 60% in comparison with the control. If a combination of AZT and GA (1:1000) was used, p24 was not detected in the culture fluid by passage 20. Culturing of U937 cells with AZT led to a 10-fold decrease in the amount of DNA 2-LTR in comparison with the total content of proviral DNA, the content of HIV-1 DNA 1-LTR remaining virtually unchanged. Culturing of U937 with a combination of AZT and GA resulted in a notable decrease in the content of proviral DNA 2-LTR after passage 3, while after passage 9 this form of HIV-1 DNA was not detected at all.

It was established that 5'-phosphonates of 3'-azido-2',3'-dideoxythymidine (AZT) inhibit HIV reproduction in the MT-4 cell line as well as AZT. However, the viability of HIV-infected MT-4 cells after treatment with phosphonates was considerable higher that after AZT treatment. Inhibitory activities of 5'-phosphonates of 3'-fluoro-2',3'-dideoxythymidine (FLT) on HIV-infected MT-4 cells were rather low. The mechanism of action of these derivatives and prospects for their application for suppressing HIV infection are discussed.

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

Anti-HIV activity of antisense oligonucleotide derivatives conjugated to lipophilic groups has been investigated. Aliphatic linear structures and cholesterol were coupled to the 5'-terminal phosphate of oligonucleotides via glycine or propylene diamine spacers. The oligonucleotides were targeted to a conserved sequence of the viral gene env, to a sequence in the negative sense viral RNA, to the 5'-terminus of the gene rev and to poly(A) sequences. The conjugation with lipophilic groups stimulated binding of oligonucleotides to cells and protected the oligonucleotides against cellular nucleases. The lipophilic derivatives of oligonucleotides containing an ester bond in the linker structure were cleaved by cellular esterases yielding oligonucleotides protected from 5'-nuclease degradation by the glycine residue. Antiviral activity of the derivatives exceeded that of the corresponding unmodified oligonucleotides. The virus suppression was sequence-specific and most pronounced in the case of the cholesteryl conjugated oligonucleotides.

The anti-HIV activity of beta-glycyrrhizic acid (GA) and various derivatives was studied using various strains of HIV-1 and HIV-2 in primary infected lymphoblastoid cells MT-4 and monocyte cell line U-973 chronically infected with HIV-1 and containing provirus (GKV 4005). Beta-glycyrrhizic acid and its derivatives were shown to effectively inhibit HIV-1 reproduction in MT-4 cells. The antiviral effect of beta-GA sodium salt exceeded that of AZT in cells GKV 4005. The selective indices for some GA salts were evaluated, namely: 53 for 1NH4 salt of GA, 6.7 for 1K-2Li salt of GA; 4.45 for GA. The mechanism of GA action is discussed.

A chronically HIV-1-infected culture of continuous human monocytes producing infectious virus during long-term continuous cultivation (over 200 passages) without the addition of noninfected cells was generated. HIV-1 produced by this culture had typical morphology and complete set of virus-specific proteins. This cell line is proposed for use as an additional model for the evaluation of antiviral effects of various drugs.