Search

The red alga Asparagopsis armata is a species with a haplodiplophasic life cycle alternating between morphologically distinct stages. The species is known for its various biological activities linked to the production of halogenated compounds, which are described as having several roles for the algae such as the control of epiphytic bacterial communities. Several studies have reported differences in targeted halogenated compounds (using gas chromatography–mass spectrometry analysis (GC-MS)) and antibacterial activities between the tetrasporophyte and the gametophyte stages. To enlarge this picture, we analysed the metabolome (using liquid chromatography–mass spectrometry (LC-MS)), the antibacterial activity and the bacterial communities associated with several stages of the life cycle of A. armata: gametophytes, tetrasporophytes and female gametophytes with developed cystocarps. Our results revealed that the relative abundance of several halogenated molecules including dibromoacetic acid and some more halogenated molecules fluctuated depending on the different stages of the algae. The antibacterial activity of the tetrasporophyte extract was significantly higher than that of the extracts of the other two stages. Several highly halogenated compounds, which discriminate algal stages, were identified as candidate molecules responsible for the observed variation in antibacterial activity. The tetrasporophyte also harboured a significantly higher specific bacterial diversity, which is associated with a different bacterial community composition than the other two stages. This study provides elements that could help in understanding the processes that take place throughout the life cycle of A. armata with different potential energy investments between the development of reproductive elements, the production of halogenated molecules and the dynamics of bacterial communities.

The checklist of the ectoparasites of Syrian marine fish is provided. This fauna comprises (28) species, representing (20) genera, (15) families, (9) orders and (8) classes. The checklist is arranged alphabetically; with additional details for each species include the hosts, infected site, prevalence and intensity, and references or the source of these data. Considering these very limited data, we discussed the results found and highlighted the importance to conduct more parasitological studies in the region.

The taxonomy of species of Bivesicula Yamaguti, 1934 is analysed for samples from holocentrid, muraenid and serranid fishes from Japan, Ningaloo Reef (Western Australia), the Great Barrier Reef (Queensland), New Caledonia and French Polynesia. Analysis of three genetic markers (cox1 mtDNA, ITS2 and 28S rDNA) identifies three strongly supported clades of species and suggests that Bivesicula as presently recognized is not monophyletic. On the basis of combined morphological, molecular and biological data, 10 species are distinguished of which five are proposed as new. Bivesicula Clade 1 comprises seven species of which three are effectively morphologically cryptic relative to each other; all seven infect serranids and four also infect holocentrids. Bivesicula Clade 2 comprises three species of which two are effectively morphologically cryptic relative to each other; all three infect serranids and one also infects a muraenid. Bivesicula Clade 3 comprises two known species from apogonids and a pomacentrid, and forms a clade with species of Paucivitellosus Coil, Reid & Kuntz, 1965 to the exclusion of other Bivesicula species. Taxonomy in this genus is made challenging by the combination of low resolving power of ribosomal markers, the existence of regional cox1 mtDNA populations, exceptional and unpredictable host-specificity and geographical distribution, and significant host-induced morphological variation.

International audience; Aquatic animal diseases are one of the major limiting factors in aquaculture development, with disease emergence forecast to increase with global change. However, in order to treat increasing diseases in a context of global emergence of antimicrobial resistance and strengthening regulations on antimicrobial use, sustainable alternatives are urgently needed. The use of plant supplements to increase fish immunity and disease resistance has gained much popularity within the last decades. The use of functional supplements, such as plants, can also improve growth and feed assimilation, contributing to a better optimization of aquaculture resources (e.g. fish meal inclusion). We conducted a systematic review and meta-analysis in order to identify the research gaps in the use of plant-enriched diets in fish aquaculture and estimate, for the first time, the overall efficacy of plant-enriched diets on fish growth, immunity and disease resistance as well as the effect of intrinsic parameters (fish trophic level, type of plant material, dosage, treatment duration and pathogen species) on the treatment efficacy. We found that plant-enriched diets significantly enhanced growth, immunity and disease survival of treated fish, regardless of the fish trophic level, treatment duration and type of material used. We also show that plant supplements are a versatile alternative that can benefit different aquaculture sectors (from small-scale fish farmers to intensive productions). Finally, we observed that studies need to improve the information reported about the plant material used (e.g. origin, identification, chemical composition), in order to allow the comparison of different experiments and improve their repeatability.

International audience; Anguillid eels are found globally in fresh, transitional and saline waters and have played an important role in human life for centuries. The population status of several species is now of significant concern. The threats to populations include direct exploitation at different life stages, blockages to migratory routes by dams and other structures, changes in river basin management that impact habitat carrying capacity and suitability, pollution, climate change, diseases and parasites. While much has been done to understand eel biology and ecology, a major challenge is to identify the key research and management questions so that effective and targeted studies can be designed to inform conservation, management and policy. We gathered 30 experts in the field of eel biology and management to review the current state of knowledge for anguillid eel species and to identify the main topics for research. The identified research topics fell into three themes: (a) Lifecycle and Biology; (b) Impacts and (c) Management. Although tropical anguillid eels are by far the least well understood, significant knowledge gaps exist for all species. Considerable progress has been made in the last 20 years, but the status of many species remains of great concern, particularly for northern temperate species. Without improved engagement and coordination at the regional, national and international level, the situation is unlikely to improve. Further, adaptive management mechanisms to respond to developments in science, policy and our knowledge of potential threats are required to ensure the future of these important and enigmatic species.

The digenetic trematode family Gorgocephalidae comprises just a few species, and the literature devoted to the lineage consists of only a handful of reports. With one exception, all reports have been based on material collected in the Indo-West Pacific, an expansive marine ecoregion stretching from the east coast of Africa to Easter Island, Hawaii and French Polynesia. We collected adult and intramolluscan gorgocephalids from kyphosid fishes and littorinid gastropods from several Australian localities, and from South Africa and French Polynesia. Specimens of Gorgocephalus kyphosi and G. yaaji were collected from, or near, their type-localities, providing new morphological and molecular (COI, ITS2 and 28S) data needed for a revised understanding of species boundaries in the family. Two new species are recognized: Gorgocephalus euryaleae sp. nov. and Gorgocephalus graboides sp. nov. New definitive host records are provided for described species and three new intermediate hosts are identified. These new records are all associated with Kyphosus fishes and littorinid gastropods, reaffirming the restriction of gorgocephalids to these hosts. Most significantly, we provide evidence that G. yaaji is distributed from South Africa to French Polynesia, spanning the breadth of the Indo-West Pacific. Our findings have significant relevance regarding digenean species delineation over geographic range.

WOS:000682021900001; International audience; Aim Several drivers explain the global distribution of all reef fish. However, whether these drivers also explain the distribution and traits of a functional subgroup involving cleaner fishes remain unclear. Here we examine the variation in traits of cleaner fishes and test whether historical, environmental, ecological and geographical drivers are correlated with cleaner species richness and abundance at global reefs. Location Tropical and subtropical reefs. Taxon Actinopterygii. Methods We tested whether species traits and trait space vary between facultative (i.e. species that clean only during the juvenile stages or sporadically) and dedicated (i.e. species that clean during their whole lives) cleaner types. We compiled data from local checklists (relative richness) and belt transects (standardized richness and abundance). We built four models to test whether past and current isolation (i.e. distance from Quaternary refugia and biodiversity centres), sea temperature, primary productivity, local species pool and abundance of potential clients influenced the relative richness and abundance of cleaners. Results Facultative cleaners had high trait variability that contributed disproportionally to the trait space, whereas dedicated cleaners exhibited low trait variability. Cleaner species richness was higher in the Indo-Pacific and Caribbean provinces, but the relative richness and standardized abundance of cleaners were higher in the Atlantic (i.e. North Eastern and Southwestern) and Eastern Pacific. Isolation influenced the relative richness of facultative cleaners, whereas the distance to Quaternary refugia, sea temperature and isolation influenced the relative richness of dedicated cleaners. Local species richness and standardized abundance of cleaner fish exhibited a strong relationship with regional diversity. The standardized abundance of both facultative and dedicated cleaners was influenced by the abundance of potential clients and the local species pool. Main conclusions The small trait space occupied by cleaner fishes may reflect their restricted origin among lineages of reef fishes. Differences in the relative richness and standardized abundance of cleaner fishes across marine realms suggest a strong influence on biogeographical history. Our results also indicate that cleaner fishes originated mostly in peripheral areas in high latitudes due to the absence of dedicated cleaners. Our results imply that cleaner fishes do not follow the pattern of main centres of origin described for reef fishes due to opportunistic cleaning behaviour that originated with higher frequency at locations with low species richness.

Stable isotopes of carbon and nitrogen characterize trophic relationships in predator–prey relationships, with clear differences between consumer and diet (discrimination factor Δ13C and Δ15N). However, parasite–host isotopic relationships remain unclear, with Δ13C and Δ15N remaining incompletely characterized, especially for helminths. In this study, we used stable isotopes to determine discrimination factors for 13 parasite–host pairings of helminths in coral reef fish. Differences in Δ15N values grouped according to parasite groups and habitat within the host with positive Δ15N values observed for trematodes and nematodes from the digestive tract and variable Δ15N values observed for cestodes and nematodes from the general cavity. Furthermore, Δ13C values showed more complex patterns with no effect of parasite group or habitat within host. A negative relationship was observed between Δ15N and host δ15N values among different host-parasite pairings as well as within 7 out of the 13 pairings, indicating that host metabolic processing affects host-parasite discrimination values. In contrast, no relationships were observed for Δ13C values. Our results indicate that parasite group, habitat within host, and host stable isotope value drive Δ15N of helminths in coral reef fish while their effect on Δ13C is more idiosyncratic. These results call for use of taxon- or species-specific and scaled framework for bulk stable isotopes in the trophic ecology of parasites.

Somatic growth is a critical biological trait for organismal, population, and ecosystem-level processes. Due to its direct link with energetic demands, growth also represents an important parameter to estimate energy and nutrient fluxes. For marine fishes, growth rate information is most frequently derived from sagittal otoliths, and most of the available data stems from studies on temperate species that are targeted by commercial fisheries. Although the analysis of otoliths is a powerful tool to estimate individual growth, the time-consuming nature of otolith processing is one barrier for collection of comprehensive datasets across multiple species. This is especially true for coral reef fishes, which are extremely diverse. Here, we provide back-calculated size-at-age estimates (including measures of uncertainty) based on sagittal otoliths from 710 individuals belonging to 45 coral reef fish species from French Polynesia. In addition, we provide Von Bertalanffy growth parameters which are useful to predict community level biomass production., Measurement(s) growth Technology Type(s) otolithometry Sample Characteristic - Organism Actinopterygii Sample Characteristic - Environment coral reef Sample Characteristic - Location French Polynesia Machine-accessible metadata file describing the reported data: 10.6084/m9.figshare.13027817

Stable isotopes of carbon and nitrogen characterize trophic relationships in predator-prey relationships, with clear differences between consumer and diet (discrimination factor, Δ13C, Δ15N). However, parasite-host isotopic relationships remain unclear, with Δ13C and Δ15N remaining incompletely characterized, especially for helminths. In this study, we used stable isotopes to determine discrimination factors for 13 parasite-host pairings of helminths in coral reef fish. Δ15N differences grouped according to phylogeny and attachment site on the hosts: Δ15N was positive for trematodes and nematodes from the digestive tract and varied for cestodes and nematodes from the general cavity. Δ13C showed more complex patterns with no effect of phylogeny or attachment site. A negative relationship was observed between Δ15N and host δ15N value among different host-parasite pairings as well as within 7 out of the 13 parings, indicating that host metabolic processing affects host-parasite discrimination values. In contrast, no relationships were observed for Δ13C. Our results indicate that host phylogeny, attachment site and host stable isotope value drive Δ15N of helminths in coral reef fish while Δ13C is more idiosyncratic. These results call for use of taxon- or species-specific and scaled framework for bulk stable isotopes in the trophic ecology of parasites.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

International audience; Three new monorchiid trematodes are reported from fishes of the families Nemipteridae and Pomacanthidae; two species are described from the southern Great Barrier Reef and the third from off Moorea, French Polynesia. Allobacciger polynesiensis sp. nov. is described from Centropyge flavissima (Cuvier), Allobacciger brevicirrus sp. nov. from Scolopsis bilineata (Bloch) and Scolopsis margaritifera (Cuvier), and Allobacciger annulatus sp. nov. from Centropyge tibicen (Cuvier), Centropyge vroliki (Bleeker) and Centropyge bicolor (Bloch). The three species most closely resemble the type-species, Allobacciger macrorchis Hafeezullah & Siddiqi, 1970, as well as Allobacciger centropygis Machida & Uchida, 2001, differing primarily in the morphology of the terminal genitalia and excretory vesicle. With the introduction of these new species, the most recent generic concept does not accurately reflect all species in the genus, and we provide a revised generic diagnosis to accommodate the new taxa. Complete ITS2 rDNA, partial 28S rDNA, partial 18S rDNA and partial cox1 mtDNA sequence data were generated for the three new species; all markers distinguish the three species reported here unambiguously. Phylogenetic analyses of the new sequence data show that the three new species of Allobacciger Hafeezullah & Siddiqi, 1970 form a well-supported clade.

The emergence of DNA barcoding and metabarcoding opened new ways to study biological diversity, however, the completion of DNA barcode libraries is fundamental for such approaches to succeed. This dataset is a DNA barcode reference library (fragment of Cytochrome Oxydase I gene) for 2,190 specimens representing at least 540 species of shore fishes collected over 10 years at 154 sites across the four volcanic archipelagos of French Polynesia; the Austral, Gambier, Marquesas and Society Islands, a 5,000,000 km2 area. At present, 65% of the known shore fish species of these archipelagoes possess a DNA barcode associated with preserved, photographed, tissue sampled and cataloged specimens, and extensive collection locality data. This dataset represents one of the most comprehensive DNA barcoding efforts for a vertebrate fauna to date. Considering the challenges associated with the conservation of coral reef fishes and the difficulties of accurately identifying species using morphological characters, this publicly available library is expected to be helpful for both authorities and academics in various fields., Design Type(s)population data analysis objective • biodiversity assessment objectiveMeasurement Type(s)fishTechnology Type(s)taxonomic diversity assessment by targeted gene surveyFactor Type(s)Species • geographic locationSample Characteristic(s)Actinopterygii • French Polynesia • ocean biome Machine-accessible metadata file describing the reported data (ISA-Tab format)

International audience; Seven South Pacific anguillid eel species live from New Guinea to French Polynesia, but their spawning areas and life histories are mostly unknown despite previous sampling surveys. A July–October 2016 research cruise was conducted to study the spawning areas and times, and larval distributions of South Pacific anguillid eels, which included a short 155°E station-line northeast of New Guinea and five long transects (5–25°S, 160°E–140°W) crossing the South Equatorial (SEC) and other currents. This survey collected nearly 4000 anguilliform leptocephali at 179 stations using an Isaacs-Kidd Midwater Trawl accompanied by 104 CTD casts. Based on morphometric observations and DNA sequencing, 74 anguillid leptocephali were collected, which in the southern areas included 29 larvae of six species: Anguilla bicolor pacifica, A. marmorata, A. australis, A. reinhardtii, A. megastoma, and A. obscura (all anguillid species of the region were caught except A. dieffenbachii). Small A. australis (9.0–16.8 mm) and A. reinhardtii (12.4, 12.5 mm) leptocephali were collected south of the Solomon Islands, other A. australis (10.8–12.0 mm) larvae were caught northwest of Fiji along with an A. obscura (20.0 mm) larva, and an A. marmorata (7.8 mm) larva was collected near Samoa. Considering collection sites, larval ages from otolith analysis, and westward SEC drift, multiple spawning locations occurred from south of the Solomon Islands and the Fiji area (16–20 days old larvae) to near Samoa (19 days old larva) during June and July in areas where high-salinity Subtropical Underwater (STUW, ~150 m depth) and the warm, low-salinity surface Fresh Pool were present. Five long hydrographic sections showed the strong Fresh Pool in the west and the STUW formation area in the east.

Timoniellaspp. are cryptogonimid flukes (Digenea: Cryptogonimidae) that parasitize the guts of fish in brackish waters.Timoniella imbutiforme, a species from the Mediterranean Sea, is recorded in the Black Sea, whileT. balthicahas been described from the Baltic Sea. In this paper, we clarify the taxonomic status ofTimoniellapopulations in the Baltic and Black seas. Adults and metacercariae ofTimoniellaspp. were sampled from localities in the Mediterranean Sea (France), Black Sea (Ukraine) and Baltic Sea (Germany) and subjected to molecular and morphological analysis, including Bayesian phylogenetic reconstruction based on concatenated sequences of ITS1–ITS2–28S. This allowed us to construct a new key to species of the genusTimoniella. Our results suggest thatT. balthicaforms part of the Boreal–Atlantic relict fauna of the Black Sea and should now be considered a junior synonym ofT. imbutiforme.

Trematodes of the genus Aphalloides Dollfus, Chabaud & Golvan, 1957 reach maturity in their second intermediate host, small fishes of the family Gobionellidae, genera Pomatoschistus and Knipowitschia. Two morphologically similar species have been described from European waters: Aphalloides coelomicola Dollfus et al., 1957 in the Mediterranean Sea (including the brackish Black Sea region) and Aphalloides timmi Reimer, 1970 in the Baltic Sea. There was no difference in morphology and morphometry for specimens corresponding to A. coelomicola and A. timmi and examination of the 28S rDNA sequence confirmed the similarity. Based on these results, these two species are synonymized and A. coelomicola redescribed.

The emergence of DNA barcoding and metabarcoding opened new ways to study biological diversity, however, the completion of DNA barcode libraries is fundamental for such approaches to succeed. This dataset is a DNA barcode reference library (fragment of Cytochrome Oxydase I gene) for 2,190 specimens representing at least 540 species of shore fishes collected over 10 years at 154 sites across the four volcanic archipelagos of French Polynesia; the Austral, Gambier, Marquesas and Society Islands, a 5,000,000 km2area. At present, 65% of the known shore fish species of these archipelagoes possess a DNA barcode associated with preserved, photographed, tissue sampled and cataloged specimens, and extensive collection locality data. This dataset represents one of the most comprehensive DNA barcoding efforts for a vertebrate fauna to date. Considering the challenges associated with the conservation of coral reef fishes and the difficulties of accurately identifying species using morphological characters, this publicly available library is expected to be helpful for both authorities and academics in various fields.

SUMMARYWe studied the monogenean communities of 34 species of butterflyfish from the tropical Indo-West Pacific, identifying 13 dactylogyrid species (including two species that are presently undescribed). Monogenean assemblages differed significantly between host species in terms of taxonomic structure, intensity and prevalence. Parasite richness ranged from 0 (Chaetodon lunulatus) to 11 (C. auriga, C. citrinellus and C. lunula). Host specificity varied between the dactylogyrids species, being found on 2–29 of the 34 chaetodontid species examined. Sympatric butterflyfish species were typically parasitized by different combinations of dactylogyrid species, suggesting the existence of complex host–parasite interactions. We identified six clusters of butterflyfish species based on the similarities of their dactylogyrid communities. Dactylogyrid richness and diversity were not related to host size, diet specialization, depth range or phylogeny of butterflyfish species. However, there was a weak positive correlation between monogenean richness and diversity and host geographical range. Most communities of dactylogyrids were dominated by Haliotrema aurigae and H. angelopterum, indicating the importance of the genus Haliotrema in shaping monogenean communities of butterflyfishes. This study casts light on the structure of the monogenean communities of butterflyfishes, suggesting that the diversity and complexity of community structures arises from a combination of host species-specific parameters.

International audience; Fish mucus layers are the main surface of exchange between fish and the environment, and they possess important biological and ecological functions. Fish mucus research is increasing rapidly, along with the development of high-throughput techniques, which allow the simultaneous study of numerous genes and molecules, enabling a deeper understanding of the fish mucus composition and its functions. Fish mucus plays a major role against fish infections, and research has mostly focused on the study of fish mucus bioactive molecules (e.g., antimicrobial peptides and immune-related molecules) and associated microbiota due to their potential in aquaculture and human medicine. However, external fish mucus surfaces also play important roles in social relationships between conspecifics (fish shoaling, spawning synchronisation, suitable habitat finding, or alarm signals) and in interspecific interactions such as prey-predator relationships, parasite-host interactions, and symbiosis. This article reviews the biological and ecological roles of external (gills and skin) fish mucus, discussing its importance in fish protection against pathogens and in intra and interspecific interactions. We also discuss the advances that "omics" sciences are bringing into the fish mucus research and their importance in studying the fish mucus composition and functions.

Podocotyloides stenometra Pritchard, 1966 (Digenea: Opecoelidae) is the only trematode known to infect anthozoan corals. It causes disease in coral polyps of the genus Porites Link (Scleractinia: Poritidae) and its life-cycle depends on ingestion of these polyps by butterflyfishes (Perciformes: Chaetodontidae). This species has been reported throughout the Indo-Pacific, from the Seychelles to the Galapagos, but no study has investigated whether multiple species are involved. Here, we recollect P. stenometra from its type-host and type-locality, in Hawaiian waters, and describe four new species from examination of 768 butterflyfishes from French Polynesia. On the basis of morphology, phylogeny and life-history, we propose Polypipapiliotrema Martin, Cutmore & Cribb n. gen. and the Polypipapiliotrematinae Martin, Cutmore & Cribb n. subf., for P. stenometra (Pritchard) n. comb., P. citerovarium Martin, Cutmore & Cribb n. sp., P. hadrometra Martin, Cutmore & Cribb n. sp., P. heniochi Martin, Cutmore & Cribb n. sp., and P. ovatheculum Martin, Cutmore & Cribb n. sp. Given the diversity uncovered here and the ubiquity, abundance and diversity of butterflyfishes on coral reefs, we predict that Polypipapiliotrema will prove to comprise a rich complex of species causing disease in corals across the Indo-Pacific. The unique life-cycle of these taxa is consistent with phylogenetic distinction of the group and provides evidence for a broader basis of diversification among the family. We argue that life-cycle specialisation, in terms of adoption of disparate second intermediate host groups, has been a key driver of the diversification and richness of the Opecoelidae, the largest of all trematode families and the group most frequently encountered in coral reef fishes.

Geographical distribution of parasite species can provide insights into the evolution and diversity of parasitic communities. Biogeography of marine parasites is poorly known, especially because it requires an understanding of host-parasite interactions, information that is rare, especially over large spatial scales. Here, we have studied the biogeographical patterns of dactylogyrid parasites of chaetodontids, one of the most well-studied fish families, in the tropical Indo-west Pacific region. Dactylogyrid parasites were collected from gills of 34 butterflyfish species ( n = 560) at nine localities within an approximate area of 62 million km 2 . Thirteen dactylogyrid species were identified, with richness ranging from 6 to 12 species at individual localities. Most dactylogyrid communities were dominated by Haliotrema angelopterum or Haliotrema aurigae , for which relative abundance was negatively correlated ( ρ = −0.59). Parasite richness and diversity were highest in French Polynesia and the Great Barrier Reef (Australia) and lowest in Palau. Three biogeographic regions were identified based on dactylogyrid dissimilarities: French Polynesia, characterised by the dominance of H. angelopterum , the western Pacific region dominated by H. aurigae , and Ningaloo Reef (Australia), dominated by Euryhaliotrema berenguelae . Structure of host assemblages was the main factor explaining the dissimilarity (turnover and nestedness components of the Bray-Curtis dissimilarity and overall Bray-Curtis dissimilarity) of parasite communities between localities, while environment was only significant in the turnover of parasite communities and overall dissimilarity. Spatial structure of localities explained only 10% of the turnover of parasite communities. The interaction of the three factors (host assemblages, environment and spatial structure), however, explained the highest amounts of variance of the dactylogyrid communities, indicating a strong colinearity between the factors. Our findings show that spatial arrangement of chaetodontid dactylogyrids in the tropical Indo-west Pacific is primarily characterised by the turnover of the main Haliotrema spp., which is mainly explained by the structure of host assemblages.

International audience; While recent studies have suggested that fish mucus microbiota play an important role in homeostasis and prevention of infections, very few studies have investigated the bacterial communities of gill mucus. We characterised the gill mucus bacterial communities of four butterflyfish species and although the bacterial diversity of gill mucus varied significantly between species, Shannon diversities were high (H = 3.7–5.7) in all species. Microbiota composition differed between butterflyfishes, with Chaetodon lunulatus and C. ornatissimus having the most similar bacterial communities, which differed significantly from C. vagabundus and C. reticulatus. The core bacterial community of all species consisted of mainly Proteobacteria followed by Actinobacteria and Firmicutes. Chaetodonlunulatus and C. ornatissimus bacterial communities were mostly dominated by Gammaproteobacteria with Vibrio as the most abundant genus. Chaetodonvagabundus and C. reticulatus presented similar abundances of Gammaproteobacteria and Alphaproteobacteria, which were well represented by Acinetobacter and Paracoccus, respectively. In conclusion, our results indicate that different fish species present specific bacterial assemblages. Finally, as mucus layers are nutrient hotspots for heterotrophic bacteria living in oligotrophic environments, such as coral reef waters, the high bacterial diversity found in butterflyfish gill mucus might indicate external fish mucus surfaces act as a reservoir of coral reef bacterial diversity.

Plants have been reported to produce various effects such as antistress, growth promotion, appetite stimulation, immunostimulation, aphrodisiac and to have antipathogen properties in fish and shrimp aquaculture due to their varied active principles such as alkaloids, terpenoids, tannins, saponins and flavonoids. To date, most scientific studies on the use of medicinal plants in aquaculture have focused on identification of biological activity rather than natural product determination. The plant species that have displayed the highest potential for use in aquaculture are garlic (Allium sativum), pomegranate (Punica granatum), bermuda grass (Cynodon dactylon), Indian ginseng (Whitania somnifera) and ginger (Zingiber officinale). Algae are considered to be a rich source of original bioactive molecules which display multiple bioactivities. In aquaculture, several recent studies have showed the potential of algae for the treatment of pathogens or to improve fish fitness.

Parasite life histories have been assumed to be shaped by their particular mode of existence. To test this hypothesis, we investigate the relationships between life-history traits of free-living and parasitic platyhelminthes. Using phylogenetically independent contrasts we examine patterns of interspecific covariation in adult size, progeny volume, daily fecundity, total reproductive capacity, age at first reproduction and longevity. The correlations obtained indicate a similar causal chain of life history variations for free-living and parasitic platyhelminthes. These results suggest that increased longevity favours delayed reproduction. Furthermore, growth pattern determines adult body size and age at maturity. For platyhelminthes, whether free-living or parasitic, the total reproductive capacity is found to be directly determined by the size of the worm. Within this group the parasitic way of life does not seem to influence the basic patterns of life history evolution.

Fish mucus has important biological and ecological roles such as defense against fish pathogens and chemical mediation among several species. A non-targeted liquid chromatography–mass spectrometry metabolomic approach was developed to study gill mucus of eight butterflyfish species in Moorea (French Polynesia), and the influence of several fish traits (geographic site and reef habitat, species taxonomy, phylogeny, diet and parasitism levels) on the metabolic variability was investigated. A biphasic extraction yielding two fractions (polar and apolar) was used. Fish diet (obligate corallivorous, facultative corallivorous or omnivorous) arose as the main driver of the metabolic differences in the gill mucus in both fractions, accounting for 23% of the observed metabolic variability in the apolar fraction and 13% in the polar fraction. A partial least squares discriminant analysis allowed us to identify the metabolites (variable important in projection, VIP) driving the differences between fish with different diets (obligate corallivores, facultative corallivores and omnivorous). Using accurate mass data and fragmentation data, we identified some of these VIP as glycerophosphocholines, ceramides and fatty acids. Level of monogenean gill parasites was the second most important factor shaping the gill mucus metabolome, and it explained 10% of the metabolic variability in the polar fraction and 5% in the apolar fraction. A multiple regression tree revealed that the metabolic variability due to parasitism in the polar fraction was mainly due to differences between non-parasitized and parasitized fish. Phylogeny and butterflyfish species were factors contributing significantly to the metabolic variability of the apolar fraction (10 and 3%, respectively) but had a less pronounced effect in the polar fraction. Finally, geographic site and reef habitat of butterflyfish species did not influence the gill mucus metabolome of butterflyfishes.

Aquaculture is the main source to increase fish supply. Fast development of aquaculture and increasing fish demand lead to intensification of fish culture, magnifying stressors for fish and thus heightening the risk of disease. Until now, chemotherapy has been widely used to prevent and treat disease outbreaks, although use of chemical drugs has multiple negative impacts on environment and human health e.g. resistant bacterial strains and residual accumulation in tissue. Hence, disease management in aquaculture should concentrate on environmentally friendly and lasting methods. Recently, increasing attention is being paid to the use of plant products for disease control in aquaculture as an alternative to chemical treatments. Plant products have been reported to stimulate appetite and promote weight gain, to act as immunostimulant and to have antibacterial and anti-parasitic (virus, protozoans, monogeneans) properties in fish and shellfish aquaculture due to active molecules such as alkaloids, terpenoids, saponins and flavonoids. However, as it is a relatively emerging practice there is still little knowledge on the long-term effects of plant extracts on fish physiology as well as a lack of homogenization in the extract preparation and fish administration of the plant extracts. This article aims to review the studies carried out on the use of plant products on fish aquaculture and their biological effects on fish such as growth promoter, immunostimulant, antibacterial and anti-parasitic. It also intends to evaluate the current state of the art, the methods used and the problems encountered in their application to the aquaculture industry.

Behavioural and ecological observations were made on young, reared Platax orbicularis in Opunohu Bay, Moorea, French Polynesia, during their transition from the pelagic, dispersive stage to the reeforientated demersal stage. Seventy-two young P. orbicularis (17–75mm standard length, LS) were released in the pelagic zone and 20 (40–70mm LS) adjacent to the reefs. Swimming speed was slow (mean 5·2 cms−1) and independent of size. An ontogenetic descent was observed: the smallest P. orbicularis swam at the surface, medium-sized P. orbicularis swam in midwater (mean 5–13 m) and the largest P. orbicularis swam to the bottom, where many lay on their sides. Platax orbicularis swam southerly on average, away from the ocean and into the bay. Smaller P. orbicularis were more likely to swim directionally than larger individuals. Young P. orbicularis released near reef edges swam at similar, but more variable speeds (mean 6·6 cms−1). About half of those released near reefs swam away, but fewer swam away from an inshore fringing reef than from a patch reef near the bay mouth. Many P. orbicularis swam up the slope onto the reef top, but the little settlement observed was near the reef base. Average, near-reef swimming direction was also southerly. Some reef residents, in particular the triggerfish Balistapus undulatus, harassed young P. orbicularis.

5 pages; International audience; This study investigates the recent evolution of a rich parasite community associated with one of the world's most invasive species, the cichlid fish Oreochromis mossambicus. Populations from the species' native range (Mozambique) are compared to a population from New Caledonia (Wester Pacific), an island where the species was introduced in 1954. The results support the complete local extinction of the gill parasite community in the course of the invasion process. Up to six gill parasite species per locality were documented in the O. mossambicus native range, and previous surveys consistently reported at least one parasite species introduced along African cichlid species established out of Africa. The absence of parasites in New Caledonia is therefore exceptional. This can be attributed to local factors, such as a strong initial population bottleneck, the likely absence of multiple host introductions, and the frequent occurrence of brackish watersheds that might enhance the probability for natural deparasitation.

The emerging orbicular batfish (Platax orbicularis) aquaculture is the most important fish aquaculture industry in French Polynesia. However, bacterial infections are causing severe mortality episodes. Therefore, there is an urgent need to find an effective management solution. Besides the supplying difficulty and high costs of veterinary drugs in French Polynesia, batfish aquaculture takes place close to the coral reef, where use of synthetic persistent drugs should be restricted. Medicinal plants and bioactive algae are emerging as a cheaper and more sustainable alternative to chemical drugs. We have studied the effect of local Polynesian plants and the local opportunistic algae Asparagopsis taxiformis on batfish when orally administered. Weight gain and expression of two immune-related genes (lysozyme g e Lys G and transforming growth factor beta - TGF-b1) were studied to analyze immunostimulant activity of plants on P. orbicularis. Results showed that several plants increased Lys G and TGF-b1 expression on orbicular batfish after 2 and 3 weeks of oral administration. A. taxiformis was the plant displaying the most promising results, promoting a weight gain of 24% after 3 weeks of oral administration and significantly increasing the relative amount of both Lys G and TGF-b1 transcripts in kidney and spleen of P. orbicularis.

This study assesses, for the first time, the interrelationships between size, fecundity, energy reserves and parasitism in female European anchovy, in order to analyse the potential implications for the health of the northwestern Mediterranean anchovy stock arising from the current shortage of large individuals., The European anchovy, Engraulis encrasicolus L. 1758, is one of the most sought-after target species in the northwestern Mediterranean Sea. However, this stock currently consists of small individuals, and landings are reported to have decreased considerably. The main purpose of this study was to assess, for the first time, the interrelationships between size, fecundity, energy reserves and parasitism in female anchovies, in order to analyse the potential implications for the health of northwestern Mediterranean anchovy stocks arising from the current shortage of large individuals. Results revealed that smaller individuals show lower fecundity, lower lipid content and a higher intensity of certain parasites. As it is known that smaller individuals now predominate in the population, the relationships found in this study indicate that the health of anchovies from the northwestern Mediterranean is currently impaired.

We describe a new species of myxozoan, Henneguya mauritaniensis n. sp., extracted from the arterial bulb of the bluespotted seabream, Pagrus caeruleostictus (Valenciennes, 1830), collected in Mauritanian waters. Out of the 209 individuals examined, 30.1 % were infected with this new taxon. Spore total length ranged from 15.0 to 20.5 μm with a mean of 17.9 μm. The two polar capsules were equal in size, and pyriform and caudal appendages joined until mid-length. Morphometric analysis revealed significant differences between H. mauritaniensis n. sp. and morphologically similar species from this region as well as congeners known from other sparid hosts. Phylogenetic analysis of 18 S rDNA indicated that this new species is closely related to Henneguya pagri, reported recently from Pagrus major off Japan. Bayesian inference and maximum likelihood analyses of the 18 S rDNA dataset also revealed that species of marine Henneguya reported forming pseudocysts in the hearts of their fish hosts were closely related. Histological analysis of the H. mauritaniensis n. sp. pseudocysts embedded in the arterial bulb of P. caeruleostictus suggests that these parasites may cause considerable pathology, which may impact negatively on the health of the fish host. Finally, we discussed the importance of a combination of morphological and molecular analysis for species description because of high variability in size within the same taxa.

The sclerotized attachment organ of monogeneans has been widely used to address fundamental questions in ecology and evolution. However, traditional morphometric techniques appear to be partially inadequate and non-optimal. Traditional linear measurements mainly provide information on the size of sclerites but provide very little information, if any, on their shape. The shape of sclerites is indeed virtually unexplored and its implication for ecological and evolutionary processes remains to be analyzed. This study aims to both introduce and illustrate the use of geometric morphometrics in order to study sclerites of monogeneans in a biogeographic context. To do this, we investigated morphological variation patterns among four populations from the Pacific Ocean and six monogenean species through traditional and geometric morphometric techniques. Unlike the traditional method, the geometric morphometric method yielded a high percentage of individuals correctly classified to the four populations, providing strong evidence for phenotypic variability, divergence and local adaptation among islands without evolutionary constraint. Moreover, the traditional method also resulted in inconsistent interpretations of shape variations. This study highlighted the limitations that may arise when using traditional morphometric techniques and emphasizes that considerable information about the shape of sclerotized haptoral parts is added by using geometric morphometrics. Given the prominent taxonomic, ecological and evolutionary role of the haptor for characterizing monogeneans, we ultimately discuss the potential broad use of geometric morphometrics in a wide variety of ecological and evolutionary contexts. This powerful approach might allow a more robust estimation of the extent to which traditional evolutionary theories based on size of sclerites are congruent with their shape.

Spontaneous swimming activity of O-group common sole (Solea solea) was evaluated using a video-tracking system under laboratory conditions. An experiment was conducted during two consecutive days on individuals sampled in June, July, September and November (2004) in a coastal nursery ground (Pertuis Charentais, Bay of Biscay, France). The measured behavioural variables were: distance travelled and frequency of occurrence of burying, swimming and immobility. O-group sole showed a relatively clear circadian activity in line with the artificial light conditions (day, twilight and night). Swimming activity of O-group sole decreased drastically from June to July, thereafter remaining at a very low level in September and November. Such important changes reflect the transition between the exploratory behaviour of the post-colonization period and a well established sedentary behaviour remaining until the onset of winter. These results highlight the potential limitation in habitat use capacities of O-group sole once settled in coastal nursery grounds.

International audience; The bluestriped snapper Lutjanus kasmira and the blacktail snapper L. fulvus were deliberately introduced in the Hawaiian Archipelago from French Polynesia in the late 1950s to enhance local fisheries. These species rapidly spread all over the Windward Islands, became extremely abundant and, therefore, caused controversial environmental concerns. A comparison of the whole metazoan parasite community of L. kasmira and L. fulvus was performed between their native ranges in French Polynesia (Moorea Island in the Society Archipelago and Ua Huka in the Marquesas Islands) and their introduced range in O'ahu, Hawaii, USA. We suggest that 8 monogenean species have been introduced with L. kasmira and L. fulvus into the Hawaiian Archipelago from French Polynesia; 2 other species as well as one nematode should be referred to as cryptogenic. Moreover, experimental mortality conducted on monogeneans found in Polynesia emphasizes the inefficiency of anti-parasite treatment which was performed 50 yr ago, explaining possible parasite introduction. Finally, we discuss the potential threat of exotic parasites to the native fish community in the Hawaiian Archipelago and conclude that the absence of co-evolved hosts prevents parasite transfer from non-indigenous to native fishes as monogeneans are highly specific.

The study focused on small-scale location and movement patterns of the bluestripe snapper Lutjanus kasmira on the north coast of Moorea (Society Archipelago, French Polynesia, southcentral Pacific). Juveniles of this species occur in the estuary, and adults occur widely in the lagoon, the outer slope and in the intermediate channel, where fish aggregate in large schools during daytime. While fish were all sampled within a few hundred metres, they exhibited significantly different parasite fauna and otolith shapes according to their locality: estuary, lagoon, channel and outer slope. While juveniles did not exhibit any parasites in the estuary parasitological and otolith-shape data suggest that adults rarely move between their three adjoining habitats, and more interestingly that large aggregations in the channel are formed predominantly by resident individuals with limited local movement, including at night. Besides giving some information on the host biology, such findings may have application in local fisheries management.

SUMMARYThe parasitic nematodeAnguillicola crassuswas recently introduced into populations of the European eel,Anguilla anguilla. We investigated, under experimental conditions, the regulation ofA. crassusinfrapopulations. We tested the effects of (1) the resource-limited habitat of the parasite and (2) the coexistence of several developmental stages in its niche (the swim-bladder) on the composition of the infrapopulations. The results revealed that the respective effects of these factors differed substantially during the course of the infection. Third-stage larvae (L3s) establishment would not be constrained by the size of the swim-bladder. Their moult to fourth-stage larvae (L4s) would be accelerated as the number of L3s increased. The moulting time of L4s to adults would be reduced by males and would be constrained by the size of the swim-bladder. However, the moult of L4s to adults and their further development would be synchronized with those of the opposite sex. At the time of mating, the number of males and the body weight of adults would depend on the size of the swim-bladder. Soon after the laying of eggs, the developmental constraint on the late L3s would decrease. When adults die, constraints would cease and late larval stages would moult to become adults.

We analyzed the relationships between the macroparasite community of the European eel and the expression of genes involved in the host physiology during its continental life. The genes studied are implicated in (1) host response to environmental stress, i.e., heat shock protein 70 (HSP70) and metallothionein (MT); (2) osmoregulation, i.e., beta thyroid hormone receptor (betaTHR) and Na+/K+ATPase; and (3) silvering, i.e., betaTHR, freshwater rod opsin (FWO), and deep-sea rod opsin (DSO). All were enumerated by quantitative reverse-transcription polymerase chain reaction. The epizootiological results for 93 yellow eels caught in the Salses-Leucate Lagoon (France) included 11 species: 1 nematode, 2 acanthocephalans, 1 monogenean, and 7 digeneans. The molecular results revealed (1) a significant negative relationship between digenean abundance and the expression level of all the tested genes, except FWO; (2) a significant negative relationship between the abundance of the nematode Anguillicola crassus and the expression level of the Na+/K+ATPase gene; and (3) a significant positive relationship between the A. crassus abundance and the expression level of the MT gene. Eels infected with digeneans had, on average, a lower level of expressed genes. We hypothesize that the parasites may disturb the eel's ability to withstand environmental stress and delay their migration to the Sargasso Sea because of degeneration of the gut. We further propose that the effect of the invasive species, A. crassus, on the gene expression was mainly linked to an increased trophic activity of infected eels. Moreover, it is possible that the parasite may have an effect on the fish's migratory behavior, which is tied to reproductive purposes. Additional work, including an experimental approach, is required to confirm our hypotheses.

Parasite species have been widely used as fish host migration tag or as indicators of local pollution. In this paper our approach is to consider the entire parasite community as a biological indicator of the fish environmental conditions. Seven fish species belonging to the Apogonidae, Apogon bandanensis, A. cookii, A. doderleini, A. norfolkensis, A. trimaculatus, Cheilodipterus quinquelineatus and Fowleria variegata, were sampled on six stations in two bays (Grand-Rade and Sainte-Marie) around Noume´a (New-Caledonia). The two bays are submitted to urban wastewater inputs alone or combined with additional industrial inputs which influences decrease from the inner part to the entrance of each bay. A total of 592 fish were dissected for macro parasite examination. Parasites were grouped according to their taxonomical rank and development stage for the analysis. We found an inconsistent effect of the confinement between the two bays, revealing that the parasite community is not the same in the two bays. Moreover, the encysted metacercariae found in the pericardic cavity were found to be significant indicators of the specific anthropogenically impacted environmental conditions prevailing in the inner parts of the two bays. Other parasite taxa were found to be significant indicators of specific environmental conditions in one or two stations among the six sampled. Results on parasite specificity and biological life cycle of the parasite taxa found in sampled Apogonid were further compared with environmental parameters.

European eel parasites, in particular invasive species, are suspected to have a strong influence on the population dynamics of their host. The aim of this work was to study the relationship between parasitic fauna of yellow eels caught at Salses-Leucate lagoon and the fluctuating asymmetry (FA) of some functional bilateral traits: pectoral fins, eyes and otoliths. Epidemiological distance matrices and FA distance matrices were calculated on the basis of the Euclidian distances between each pair of eel and were then compared with a Mantel test in order to establish if there was a relationship between parasitism and FA. Our results revealed different morphological characteristics between eels caught at different dates; only otoliths were found asymmetric. The parasite richness was of 10 species, 1 Nematoda, 1 Acanthocephala, 1 Monogenea and 7 Digenea. We failed to find a significant relationship between asymmetry and parasitism, except for parasites found in the stomach. We discussed the results in the light of the eel life cycle, the specificity of parasite - eel systems and the impact of parasites on the host physiology.