Search

Studies the correlation between the level of peripheral myelin protein 22 gene expression and the degree of demyelination and reduction of the nerve conduction velocity in transgenic mice. Role of myelin proteins in Schwann cell differentiation and division; Relationship between human mitochondrial RNA expression and transgene copy number; Causes of gene disruption during integration.

Polycystin-2 (PC-2), a cation channel of the Trp family, is involved in autosomal dominant polycystic kidney disease (ADPKD) type 2 (ADPKD2). This protein has recently been localized to the primary cilium where its channel function seems to be involved in a mechanosensory phenomenon. However, its biological function is not totally understood, especially in tubule formation. In the present paper, we describe a mouse model for human PC-2 overexpression, obtained by inserting a human bacterial artificial chromosome (BAC) containing the PKD2 gene. Three lines were generated, expressing different levels of PKD2. One line, PKD2-Y, has been explored in more detail and we will present physiological and molecular exploration of these transgenic animals. Our data demonstrate that transgenic animals older than 12 months present tubulopathy with proteinuria and failure to concentrate urine. Moreover, the kidney cortex has been found disorganized. Finally, we observe that extracellular matrix protein expression is downregulated in these animals. In conclusion, overexpression of human PKD2 leads to anomalies in tubular function, probably due to abnormalities in tubule morphogenesis.

Charcot-Marie-Tooth disease (CMT) is the most common hereditary peripheral neuropathy, affecting 1 in 2,500 people. The only treatment currently available is rehabilitation or corrective surgery. The most frequent form of the disease, CMT-1A, involves abnormal myelination of the peripheral nerves. Here we used a mouse model of CMT-1A to test the ability of ascorbic acid, a known promoter of myelination, to correct the CMT-1A phenotype. Ascorbic acid treatment resulted in substantial amelioration of the CMT-1A phenotype, and reduced the expression of PMP22 to a level below what is necessary to induce the disease phenotype. As ascorbic acid has already been approved by the FDA for other clinical indications, it offers an immediate therapeutic possibility for patients with the disease.

FG syndrome is an X-linked condition comprising mental retardation, congenital hypotonia, macrocephaly, distinctive facial changes, and constipation or anal malformations. In a linkage analysis, we mapped a major FG syndrome locus [FGS1] to Xq13, between loci DXS135 and DXS1066. The same data, however, clearly demonstrated genetic heterogeneity. Recently, we studied a French family in which an inversion [inv(X)(q12q28)] segregates with clinical symptoms of FG syndrome. This suggests that one of the breakpoints corresponds to a second FG syndrome locus [FGS2]. We report the results of fluorescence in situ hybridization analysis performed in this family using YACs and cosmids encompassing the Xq11q12 and Xq28 regions. Two YACs, one positive for the DXS1 locus at Xq11.2 and one positive for the color vision pigment genes and G6PD loci at Xq28, were found to cross the breakpoints, respectively. We postulate that a gene might be disrupted by one of the breakpoints., (Copyright 2000 Wiley-Liss, Inc.)

K+ channels are essential for a variety of cellular functions in both excitable and nonexcitable cells, and K+ channel gene alteration has been recently described in cardiac and neurological disorders. To explore further the relations between hereditary human diseases and K+ channels, we isolated from a human cosmid library the gene encoding the inwardly rectifying K+ channel alpha-subunit Kir 2.2 (KCNJ12). PCR analysis performed on this clone indicates that the entire open reading frame is contained in one unique exon. A polymorphic (CA)16 sequence was localized 2.2 kb upstream of the ATG start codon. Fluorescence in situ hybridization on human metaphases assigns the gene to band 17p11.1. The implication of a deletion of the Kir 2.2 gene in the Smith-Magenis syndrome, which is also localized at 17p11, is unlikely since a Kir 2.2-linked microsatellite sequence could be amplified from the DNA of a Smith-Magenis syndrome affected patient bearing a 17p interstitial deletion.

A human clone corresponding to the homologue of the murine Polycomb-like gene M33 has been used to map this gene (CBX2) to human chromosomes. Both somatic cell hybrid panels and FISH on metaphase chromosomes have been used. These techniques gave a consistent localization, at the tip of the long arm of chromosome 17 (17q25). This localization, as well as the potential role of a mammalian Polycomb-like protein, suggests a potential involvement in two different pathologies: the campomelic syndrome, an inherited disorder, and neoplastic disorders linked to allele loss already described in this region.

The juxtacentromeric region of the human chromosome 17 short arm (17p11.2-p12) contains genes involved in the Charcot-Marie-Tooth type 1A disease (CMT1A) and the Smith-Magenis syndrome (SMS). CMT1A is associated with a duplication of a short segment whereas SMS is linked to microdeletions, extending toward the centromere. We describe the construction and analysis of a 5 Mb YAC contig spanning the CMT1A duplicated segment and the distal part of four SMS microdeletions. We concluded that the YAC contig contains about 1Mb of genomic DNA which is deleted in the four SMS patients analysed. Moreover two YACs contain both STS deleted in SMS (U3) and STS duplicated in CMT1A (5H5), but the proximal breakpoint associated with the CMT1A duplication is not the same as the distal SMS breakpoint we studied. Finally we located five new STS in SMS deletion. Two of them, a microsatellite (D17S805(23)) and the gene coding for small nuclear RNA U3, have been localized in the contig we described. We may also note that snU3 is the first expressed sequence localized in an SMS deletion so far. The possible participation of this gene in the SMS phenotype is discussed.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

cDNA clones encoding four new receptors of the G-protein-coupled receptor family were obtained by selective amplification and cloning from thyroid cDNA and termed RDC1, RDC4, RDC7, and RDC8. RDC7 and RDC8 have recently been identified as A1 and A2 adenosine receptors, respectively. These cDNAs were utilized for chromosomal in situ hybridization to establish the genomic location of the corresponding genes in man. The results indicate that human RDC1, RDC4, RDC7, and RDC8 are in regions 2q37, 1p34.3-1p36.3, 22q11.2-22q13.1, and 11q11-11q13, respectively.

In this study we have utilized human elastin cDNAs in molecular hybridizations to establish the chromosomal location of the human elastin gene. First, in situ hybridizations were performed with metaphase chromosomes from phytohemagglutinin-stimulated human peripheral blood lymphocytes. In three separate experiments using two different regions of human elastin cDNAs, the distribution of grains was found to be concentrated on the long arm of chromosome 7 within the [q11.1-21.1] region, and the peak number of grains coincided with the locus 7q11.2. Second, hybridizations with a panel of human-rodent cell hybrids showed concordance with human chromosome 7. Third, PCR analyses with elastin-specific primers of DNA from a hybrid cell line containing chromosome 7 as the only human chromosome yielded a product of the expected size, while DNA containing human chromosome 2, but not chromosome 7, did not result in a product. The results indicate that the human elastin gene is located in the proximal region of the long arm of chromosome 7. The precise localization of the elastin gene in the human genome is useful in establishing genetic linkage between inheritance of an allele with a mutated elastin gene and a heritable disorder.

The genes encoding calbindin D28k (CALB1) and calretinin (CALB2), two closely related calcium-binding proteins, were mapped by in situ hybridization to the 8q21.3----q22.1 and 16q22----q23 regions of the human genome, respectively. These localizations match the chromosomal regions where the carbonic anhydrase isozyme gene cluster (CA1, CA2, CA3) and the related gene CA7 have been described, respectively. This suggests a common duplication o the calbindin/calretinin and the carbonic anhydrase ancestral genes.

A laminin B2 chain cDNA clone was isolated from a human lung cDNA library by screening with antibody against mouse laminin. The authenticity of the human cDNA clone was established by comparison of the nucleotide and deduced amino acid sequences of the cDNA insert with those of the previously reported mouse laminin cDNA clones. The human clone (LC7) contained an insert of 0.75 kb (kilobase pair) that corresponded to the last 232 amino acid residues in the carboxyl terminus of the B2 chain. Northern blot analyses with the LC7 probe detected two mRNA transcripts of 8.2 and 5.6 kb in both normal human skin fibroblasts and three human tumor cell lines. The cDNA probe was also used in Southern blot analysis of DNA from human rodent somatic cell hybrids to localize the gene to human chromosome 1. In situ hybridization of the cDNA with metaphase chromosome spreads confirmed the assignment and further mapped the human laminin B2 chain gene to the long arm of chromosome 1 in the band q31.

The human thyroglobulin gene was mapped by in situ hybridization whereby a 3H-labeled recombinant plasmid DNA containing a fragment of 2.3 kilobases of human thyroglobulin gene was hybridized to human chromosome preparations. A high proportion (25%) of hybridized metaphases exhibited silver grains at the distal portion of the long arm of chromosome 8. Analysis of the grain position at this site indicated that the chromosomal localization of the human thyroglobulin gene was 8q242-8q243.