A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.
Journal Article
Research Support, Non-U.S. Gov't
info:eu-repo/semantics/published