Search

XBP1s inhibited Ubqln1 promoter activity and circUbqln1 biogenesis. Deletion of XBP1 amplified the elevation in circUbqln1 expression, facilitating the translocation of circUbqln1 into the nucleus with the assistance of p14–3–3ζ, then promoted the expression and enzyme activity of PRODH, accelerated the degradation of proline into P5C, leading to decreased collagen fiber synthesis, ultimately accelerating OA progression. [Display omitted] • XBP1s participates in the occurrence and development of OA through a novel ncRNA: circUbqln1. • XBP1s inhibits the levels of linear Ubqln1 mRNA and circUbqln1 biosynthesis. • The circUbqln1 enters the nucleus with the assistance of phosphorylated 14–3–3ζ, and upregulates the transcriptional activity of Prodh , leading to abnormal proline metabolism, then accelerating the progression of OA. • Knockdown of circUbqln1 expression can protect against cartilage and effectively alleviate the progression of OA. • The circUbqln1 may be a potential therapeutic target in OA, which provides new insights and ideas into the pathogenesis and therapy of OA. Osteoarthritis (OA) is a degenerative bone disease associated with ageing, characterized by joint pain, stiffness, swelling and deformation. Currently, pharmaceutical options for the clinical treatment of OA are very limited. Circular RNAs(cirRNAs) have garnered significant attention in OA and related drug development due to their unique RNA sequence characteristics.Therefore,exploring the role of cirRNAs in the occurrence and development of OA is of paramount importance for the development of effective medications for OA. To identify a novel circRNA, circUbqln1 , for treating osteoarthritis and elucidate its pathophysiological role and mechanisms in the treatment of OA. The circUbqln1 expression and distribution were determined by qRT-PCR and FISH. XBP1 gene knockout(XBP1 cKO) spontaneous OA and DMM model and WT mouse CIOA model were used to explore the role of XBP1 and circUbqln1 in OA.Overexpression or knockdown of circUbqln1 lentivirus was used to observe the impacts of circUbqln1 on primary chondrocytes,C28/I2 and mice in vitro and in vivo.Chromatin immunoprecipitation,luciferase reporter assay,RNA pulldown,mass spectrometry,RNA immunoprecipitation,fluorescence in situ hybridization,and flow cytometry to explore the molecular mechanisms of circUbqln1. It was found that cartilage-specific XBP1 cKO mice exhibited a faster OA progression compared to normal's.Importantly,transcript factor XBP1s has the capacity to impede the biogenesis of circUbqln1 ,derived from Ubqln1. The circUbqln1 promotes cartilage catabolism and inhibits anabolism, therefore accelerates the occurrence of OA.Mechanismly, circUbqln1 can translocate to the chondrocyte nucleus with the assistance of phosphorylated 14–3–3ζ, upregulate the transcriptional activity of the proline dehydrogenase(Prodh) promoter and PRODH enzyme activity. Consequently, this leads to the promotion of proline degradation and the inhibition of collagen synthesis,ultimately culminating in the impairment of cartilage and its structural integrity. CircUbqln1 plays a crucial role in the occurrence and development of OA, indicating that the inhibition of circUbqln1 holds promise as a significant approach for treating OA in the future. [ABSTRACT FROM AUTHOR]

Despite decades of research being conducted to understand what physiological deficits in the brain are an underlying basis of psychiatric diseases like schizophrenia, it has remained difficult to establish a direct causal relationship between neuronal dysfunction and specific behavioral phenotypes. Moreover, it remains unclear how metabolic processes, including amino acid metabolism, affect neuronal function and consequently modulate animal behaviors. PRODH, which catalyzes the first step of proline degradation, has been reported as a susceptibility gene for schizophrenia. It has consistently been shown that PRODH knockout mice exhibit schizophrenia-like behaviors. However, whether the loss of PRODH directly impacts neuronal function or whether such neuronal deficits are linked to schizophrenia-like behaviors has not yet been examined. Herein, we first ascertained that dysregulated proline metabolism in humans is associated with schizophrenia. We then found that PRODH was highly expressed in the oreins layer of the mouse dorsal hippocampus. By using AAVmediated shRNA, we depleted PRODH expression in the mouse dorsal hippocampus and subsequently observed hyperactivity and impairments in the social behaviors, learning, and memory of these mice. Furthermore, the loss of PRODH led to altered neuronal morphology and function both in vivo and in vitro. Our study demonstrates that schizophrenia-like behaviors may arise from dysregulated proline metabolism due to the loss of PRODH and are associated with altered neuronal morphology and function in mice. [ABSTRACT FROM AUTHOR]

Naive human embryonic stem cells (hESCs) that resemble the pre-implantation epiblasts are fueled by a combination of aerobic glycolysis and oxidative phosphorylation, but their mitochondrial regulators are poorly understood. Here we report that, proline dehydrogenase (PRODH), a mitochondria-localized proline metabolism enzyme, is dramatically upregulated in naive hESCs compared to their primed counterparts. The upregulation of PRODH is induced by a reduction in c-Myc expression that is dependent on PD0325901, a MEK inhibitor routinely present in naive hESC culture media. PRODH knockdown in naive hESCs significantly promoted mitochondrial oxidative phosphorylation (mtOXPHOS) and reactive oxygen species (ROS) production that triggered autophagy, DNA damage, and apoptosis. Remarkably, MitoQ, a mitochondria-targeted antioxidant, effectively restored the pluripotency and proliferation of PRODH-knockdown naive hESCs, indicating that PRODH maintains naive pluripotency by preventing excessive ROS production. Concomitantly, PRODH knockdown significantly slowed down the proteolytic degradation of multiple key mitochondrial electron transport chain complex proteins. Thus, we revealed a crucial role of PRODH in limiting mtOXPHOS and ROS production, and thereby safeguarding naive pluripotency of hESCs. Synopsis: Downregulation of PRODH promotes oxidative phosphorylation and ROS production, which in turn impair pluripotency and proliferation of naive but not primed hESCs, revealing a crucial role of PRODH in safeguarding human naive pluripotency. PRODH is expressed in naive hESCs at a higher level compared to their primed counterparts. MEK inhibitor present in naive culture media upregulates PRODH by suppressing MYC. PRODH depletion boosts mtOXPHOS and ROS production in naive hESCs. PRODH promotes proteolytic degradation of the ETC complex components. Downregulation of PRODH promotes oxidative phosphorylation and ROS production, which in turn impair pluripotency and proliferation of naive but not primed hESCs, revealing a crucial role of PRODH in safeguarding human naive pluripotency. [ABSTRACT FROM AUTHOR]

Emerging evidence suggests that proline metabolism is important for regulating the survival and death of different types of cancer cells. Proline dehydrogenase (PRODH), an enzyme catalyzing proline catabolism, and the degradation products of proline by PRODH, such as ATP and ROS, are known to play critical roles in cancer progression. Notably, the role of PRODH in cancer is still complicated and unclear, and primarily depends on the cancer type and tumor microenvironment. For instance, PRODH induces apoptosis and senescence through ROS signaling in different types of cancers, while as a protumor factor, PRODH promotes malignant phenotypes of certain tumors under stresses such as hypoxia. In order to assess whether PRODH can serve as a novel target for cancer therapy, we will provide an overview of the biological functions of PRODH and its double-edged role in cancer in this article. [ABSTRACT FROM AUTHOR]

The aim of the study was to investigate changes in proline metabolism in seedlings of tree species during drought stress. One month old Paulownia tomentosa seedlings were exposed to moisture conditions at various levels (irrigation at 100, 75, 50 and 25% of field capacity), and then the material (leaves and roots) was collected three times at 10-day intervals. The activity of enzymes involved in proline metabolism was closely related to drought severity; however, proline content was not directly impacted. The activity of pyrroline-5-carboxylate synthetase (P5CS), which catalyzes proline biosynthesis, increased in response to hydrogen peroxide accumulation, which was correlated with soil moisture. In contrast, the activity of proline dehydrogenase (ProDH), which catalyzes proline catabolism, decreased. Compared to proline, the activity of these enzymes may be a more reliable biochemical marker of stress-induced oxidative changes. The content of proline is dependent on numerous additional factors, i.e., its degradation is an important alternative energy source. Moreover, we noted tissue-specific differences in this species, in which roots appeared to be proline biosynthesis sites and leaves appeared to be proline catabolism sites. Further research is needed to examine a broader view of proline metabolism as a cycle regulated by multiple mechanisms and differences between species.

Background: The shortened life expectancy in schizophrenia (SCZ) patients may be correlated with most cancers, yet there is heterogeneity in the studies examining these correlations. This study explored the expression of SCZrelated genes (HTR2A, COMT, and PRODH) in pan-cancer analysis. It helped to enhance the mechanistic understanding of the SCZ-cancer relationship and their immune mechanisms at the genetic level. Additionally, this study established a survival prediction model for glioblastoma and low-grade glioma (GBMLGG). Methods and results: SCZ-associated genes (HTR2A, COMT, and PRODH) were subjected to pan-cancer analysis. COX regression analysis and survival analysis were carried out for differentially expressed genes in multiple cancers, and finally, GBMLGG was derived as the focus for further detailed analysis. The immune scores and immune cell infiltration analyses were performed. All three genes were considerably linked with immune infiltration in GBMLGG, consistent with survival analysis. Based on the immunocyte analysis, it was observed that CD8+ T cells might be critically involved in the survival of GBMLGG. Genomic heterogeneity studies identified correlations of three genes with GBMLGG in tumor mutational burden (TMB) and mutant-allele tumor heterogeneity (MATH). HTR2A and COMT were significantly negatively correlated in TMB. Furthermore, it was found that HTR2A had a significant positive correlation with MATH, whereas PRODH had a significant negative correlation with MATH. Accordingly, a survival prediction model was constructed for GBMLGG using these three genes and clinical data, with better results obtained when evaluated in two separate datasets. Finally, gene expression validation and further immunocyte analysis were carried out in the single-cell RNA sequencing (scRNA-seq) data of glioma. Conclusion: SCZ-associated genes (HTR2A, COMT, and PRODH) were significantly differentially expressed in the carcinogenesis and survival of multiple cancers. The up or downregulation of gene expression varied across cancer types. In the GBMLGG analysis, upregulation of HTR2A and COMT was significantly positively correlated with carcinogenesis, while the opposite was noted for PRODH. Furthermore, a negative correlation was found between the upregulation of HTR2A and COMT and the survival of GBMLGG, and the opposite was also noted for PRODH. As reflected in the immunocyte analysis, abnormal expression of the three genes might be linked with CD8+ T cell infiltration, which might be critically involved in the survival of GBMLGG patients. The expression of HTR2A and COMT may inversely affect the efficacy of immunotherapy through the TMB pathway and further affect the prognosis of patient survival. The expression of HTR2A might positively indicate the degree of tumor heterogeneity through MATH and further affect the survival and prognosis of patients. The negative correlation of PRODH led to the opposite effect. Finally, the constructed survival prediction model demonstrated good predictive value, which was well validated in scRNA-seq analysis. [ABSTRACT FROM AUTHOR]

Summary: Amino acids in the bone marrow microenvironment (BMME) are a critical factor for multiple myeloma (MM) progression. Here, we have determined that proline is elevated in BMME of MM patients and links to poor prognosis in MM. Moreover, exogenous proline regulates MM cell proliferation and drug resistance. Elevated proline in BMME is due to bone collagen degradation and abnormal expression of the key enzyme of proline catabolism, proline dehydrogenase (PRODH). PRODH is downregulated in MM patients, mainly as a result of promoter hypermethylation with high expression of DNMT3b. Thus, overexpression of PRODH suppresses cell proliferation and drug resistance of MM and exhibits therapeutic potential for treatment of MM. Altogether, we identify proline as a key metabolic regulator of MM, unveil PRODH governing MM progression and provide a promising therapeutic strategy for MM treatment. [ABSTRACT FROM AUTHOR]

Background: Lung cancer is a serious threat to human life. It is of great significance to elucidate the pathogenesis of lung cancer and search for new markers. This study evaluate the clinical value of pyrroline-5-carboxylate reductase 1 (PYCR1) and explore its role and mechanisms in the malignant progression of lung cancer. Methods: PYCR1 expression and its relationship with prognosis were analyzed using a bioinformatics database. Enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry were utilized to examine the expression of PYCR1 in lung cancer tissues and peripheral blood. PYCR1-overexpressing lung cancer cells were constructed, then the cell proliferative, migration, and invasion ability was examined by the MTT and Transwell assays. siRNA against PRODH and STAT3 inhibitor sttatic was used to further elucidate the underlying mechanisms. Luciferase and CHIP assays were carried out for validate the how PYCR1 regulated PD-L1 expression via STAT3. Xenograft experiment was performed to determine the role of PYCR1 in vivo. Results: Database analysis showed that PYCR1 expression was significantly increased in lung cancer tissues, and its high expression predicted poor prognosis. Lung cancer tissue and peripheral blood of patients showed obviously increased PYCR1 expression, and the sensitivity and specificity of serum PYCR1 in the diagnosis of lung cancer were 75.7% and 60%, respectively. PYCR1 overexpression enhanced the proliferative, migration, and invasion abilities of lung cancer cells. Both PRODH silence and stattic effectively attenuated the function of PYCR1. Animal experiment and IHC data indicated that PYCR1 could activated STAT3 phosphorylation and PD-L1, as well as suppressed T cell infiltration in lung cancer. Finally, we also validated that PYCR1 promoted PD-L1 transcription by elevating STAT3 binding to the gene promoter. Conclusion: PYCR1 has certain value in the diagnosis and prognosis of lung cancer. Moreover, through regulating JAK-STAT3 signaling pathway, PYCR1 significantly participated in process of lung cancer progression via the metabolism link between proline and glutamine, indicating that PYCR1 might be also a novel therapeutic target.

Objective: Anorectal malformations (ARM) are classified as a multifactorial disease. The etiology of ARM is still not clear due to the complexity of the pathological anomalies. Materials and Methods: The microarray-based comparative genomic hybridization (array CGH) results of 10 patients with ARM not associated with a specific syndrome were analyzed using the 8x60K ISCA Agilent microarray platform (Human Genome CGH Microarray; Agilent Technologies, Inc., Santa Clara, CA, USA). Pathogenic copy number variants were further confirmed using fluorescence in situ hybridization or quantitative real-time polymerase chain reaction testing. Results: Chromosome 22q11.2 deletion was detected in 2 patients. One of these patients had anal stenosis, minor cardiac abnormalities, and a small 0.89-Mb deletion. The second patient had anal atresia, immune deficiency, inguinal hernia, and a 2.7-Mb cryptic deletion. The overlapping genes in the deletion regions of the 2 patients were the DGCR5, DGCR6, and PRODH genes. Conclusion: DGCR6 alters the expression of important genes such as TBX1 and affects neural crest migration. Given that ARM are caused by abnormalities in neural crest cell migration, it may be that these genes play a role in the etiology. To our knowledge, this is one of the smallest interstitial deletions in the chromosome 22q11.2 region to be published to date. Further research on the DGCR6 gene, which may be a candidate gene responsible for anal atresia, will clarify this point. [ABSTRACT FROM AUTHOR]

Introduction: Schizophrenia is a chronic heterogenic neurodevelopment disorder. Many genes interfere in the development of SCZ. All four genes, NrCAM, PRODH, ANK3, and ANKK1, which were evaluated in this study, were previously reported to be associated with Schizophrenia. The NrCAM contributes to creating cognitive deficiencies through the CAM’s signaling pathway. PRODH plays a vital role in creating SCZ negative symptoms through the signaling pathway of glutamatergic and NMDA receptors. ANK3 affects ion channel and molecular adhesion in Ranvier and initial segments of axons, leading to mental retardation, sleep disorder, and SCZ. ANKK1 encodes a protein kinase and was reported to be associated with alcohol addiction, Attention Deficit Hyperactivity Disorder (ADHD), and SCZ. Methods: The subjects were selected from Schizophrenic patients referring to the Psychiatric Ward of Imam-Hussein Hospital and Schizophrenic Patients Support Institution (AHEBBA). 95 (30 Schizoaffective patients, 57 Paranoid patients, and 8 disorganized) patients were recruited as the subjects in the present case-control association study. 120 healthy subjects were recruited from the Tehran Medical Genetics Laboratory staff and a group of students from the Islamic Azad University of Science and Research in Tehran. The genotypes were determined with molecular genotyping techniques of PCR-RFLP, ARMS-PCR, and Cycle sequencing. Results were analyzed by the Chi-Square test using SPSS V. 24 and R, SNP STATE Package to investigate significant differences between cases and controls. Results: The incidence of schizophrenia was 68% and 32% among men and women, respectively. The evaluation of the allelic association between schizophrenia and all the candidate SNPs showed a significant association between NrCAMchr('39')s SNP rs10235968 and SCZ (P=0.001). Haplotype T, T, C in rs10235968, rs6967368, rs3763463, respectively, within the NrCAM gene, showed significant association with schizophrenia disorder (P=0.0001). Conclusion: No association was found between other candidate SNPs and SCZ among the subjects.

Background: Estrogen receptor-positive breast cancer accounts for around 70% of all cases. Tamoxifen, an anti-estrogenic inhibitor, is the primary drug used for this type of breast cancer treatment. However, tamoxifen resistance is a major challenge in clinics. Metabolic reprogramming, an emerging hallmark of cancer, plays a key role in cancer initiation, progression, and therapy resistance. The metabolism of non-essential amino acids such as serine, proline, and glutamine is involved in tumor metabolism reprogramming. Although the association of glutamine metabolism with tamoxifen resistance has been well established, the role of proline metabolism and its critical enzyme PRODH is unknown., Objective: The aim of this study is to explore the role and mechanism of PRODH in tamoxifen resistance in breast cancer cells., Methods: PRODH and GPX4 expressions in tamoxifen-resistant cells were detected using real-time PCR and Western blot analysis. The breast cells' response to tamoxifen was measured using MTT assays. Trans-well assays were used to detect cell migration and invasion. A Xenograft tumor assay was used to detect the role of PRODH in tumor growth. Reactive oxygen species were measured using flow cytometry., Results: PRODH expression is reduced in tamoxifen-resistant cells, and its overexpression enhances tamoxifen response in vitro and in vivo. Conversely, PRODH knockdown confers tamoxifen resistance in tamoxifen-sensitive cells. Mechanistic studies show that ferroptosis is inhibited in tamoxifen-resistant cells and overexpression of PRODH restores the ferroptosis in tamoxifen-resistant cells. Moreover, Ferrostatin-1 (Fer-1), the ferroptosis inhibitor, reversed the effect of PRODH on tamoxifen resistance., Conclusions: These findings suggest that PRODH regulates tamoxifen resistance by regulating ferroptosis in tamoxifen-resistant cells.

L-proline catabolism is emerging as a key pathway that is critical to cellular metabolism, growth, survival, and death. Proline dehydrogenase (PRODH) enzyme, which catalyzes the first step of proline catabolism, has diverse functional roles in regulating many pathophysiological processes, including apoptosis, autophagy, cell senescence, and cancer metastasis. Notably, accumulated evidence demonstrated that PRODH plays complex role in many types of cancers. In this review, we briefly introduce the function of PRODH, then its expression in different types of cancer. We next discuss the regulation of PRODH in cancer, the downstream pathways of PRODH and the therapies that are under investigation. Finally, we propose novel insights for future perspectives on the modulation of PRODH. [ABSTRACT FROM AUTHOR]

Cancer cells show a formidable capacity to survive under stringent conditions, to elude mechanisms of control, such as apoptosis, and to resist therapy. Cancer cells reprogram their metabolism to support uncontrolled proliferation and metastatic progression. Phenotypic and functional heterogeneity are hallmarks of cancer cells, which endow them with aggressiveness, metastatic capacity, and resistance to therapy. This heterogeneity is regulated by a variety of intrinsic and extrinsic stimuli including those from the tumor microenvironment. Increasing evidence points to a key role for the metabolism of non-essential amino acids in this complex scenario. Here we discuss the impact of proline metabolism in cancer development and progression, with particular emphasis on the enzymes involved in proline synthesis and catabolism, which are linked to pathways of energy, redox, and anaplerosis. In particular, we emphasize how proline availability influences collagen synthesis and maturation and the acquisition of cancer cell plasticity and heterogeneity. Specifically, we propose a model whereby proline availability generates a cycle based on collagen synthesis and degradation, which, in turn, influences the epigenetic landscape and tumor heterogeneity. Therapeutic strategies targeting this metabolic-epigenetic axis hold great promise for the treatment of metastatic cancers.

Introduction: Schizophrenia is a chronic heterogenic neurodevelopment disorder. Many genes interfere in the development of SCZ. All four genes, NrCAM, PRODH, ANK3, and ANKK1, which were evaluated in this study, were previously reported to be associated with Schizophrenia. The NrCAM contributes to creating cognitive deficiencies through the CAM's signaling pathway. PRODH plays a vital role in creating SCZ negative symptoms through the signaling pathway of glutamatergic and NMDA receptors. ANK3 affects ion channel and molecular adhesion in Ranvier and initial segments of axons, leading to mental retardation, sleep disorder, and SCZ. ANKK1 encodes a protein kinase and was reported to be associated with alcohol addiction, Attention Deficit Hyperactivity Disorder (ADHD), and SCZ. Methods: The subjects were selected from Schizophrenic patients referring to the Psychiatric Ward of Imam-Hussein Hospital and Schizophrenic Patients Support Institution (AHEBBA). 95 (30 Schizoaffective patients, 57 Paranoid patients, and 8 disorganized) patients were recruited as the subjects in the present case-control association study. 120 healthy subjects were recruited from the Tehran Medical Genetics Laboratory staff and a group of students from the Islamic Azad University of Science and Research in Tehran. The genotypes were determined with molecular genotyping techniques of PCR-RFLP, ARMS-PCR, and Cycle sequencing. Results were analyzed by the Chi-Square test using SPSS V. 24 and R, SNP STATE Package to investigate significant differences between cases and controls. Results: The incidence of schizophrenia was 68% and 32% among men and women, respectively. The evaluation of the allelic association between schizophrenia and all the candidate SNPs showed a significant association between NrCAM's SNP rs10235968 and SCZ (P=0.001). Haplotype T, T, C in rs10235968, rs6967368, rs3763463, respectively, within the NrCAM gene, showed significant association with schizophrenia disorder (P=0.0001). Conclusion: No association was found between other candidate SNPs and SCZ among the subjects. [ABSTRACT FROM AUTHOR]

It is well-established that plants accumulate high concentrations of sodium (Na+) and chloride (Cl‾) ions when subjected to salinity stress. However, little is known about individual or relative toxic impacts of these ions and whether they exert additive impacts under NaCl. Most of the investigations have historically been directed to decode Na+-toxicity, and as a result deeper understandings about Cl‾-toxicity are lacking. In this study, the extent to which sodium and chloride ions contribute in inducing nitrosative responses and proline metabolism is shown in two rice cultivars, one tolerant (Panvel-3) and one sensitive (Sahyadri-3). Equimolar (100 mM) concentrations of Na+, Cl‾ and NaCl (EC ≈ 10 dSm−1) reduced biomass production in both the cultivars in following manner NaCl > Na+>Cl‾. Na+ and NaCl treatments displaced K+, however, the tolerant cultivar maintained low Na+/K+ levels. Hyper-accumulation of Na+ may apparently be attributed for the reduced plant growth and biomass accumulation, and higher lipid-peroxidation. Nitric oxide and nitrate reductase were more responsive to NaCl followed by Na+ and Cl‾, respectively. The expression patterns of key-genes involved in proline biosynthesis and degradation confirmed the involvement of proline in better performance of salt tolerant cultivar under stresses, with higher responsiveness to NaCl and then Na+ and Cl‾ treatments. Principal component analysis revealed correlations in proline metabolism and nitrosative responses under ionic stresses and confirmed the closeness of NaCl and Na+ stresses. Overall, amongst the individual ions, Na+ induced higher toxicity than Cl‾ and both these ions exerted additive stress impacts under NaCl treatment. • Na+, Cl‾, NaCl (100 mM, EC≈10 dSm-1) impacts were investigated on proline metabolism and nitrosative responses in rice. • Nitrosative responses, including nitric oxide and nitrate reductase were more responsive to NaCl followed by Na+ and Cl‾. • Transcriptional profiling of key genes confirmed higher responsiveness of proline metabolism to NaCl followed by Na+ and Cl‾. • Results clearly indicated a link between proline metabolism and nitrosative responses of rice cultivars. • Overall toxicity was in NaCl>Na+>Cl‾ manner with additive impacts under NaCl stress. [ABSTRACT FROM AUTHOR]

Cancer cells show a formidable capacity to survive under stringent conditions, to elude mechanisms of control, such as apoptosis, and to resist therapy. Cancer cells reprogram their metabolism to support uncontrolled proliferation and metastatic progression. Phenotypic and functional heterogeneity are hallmarks of cancer cells, which endow them with aggressiveness, metastatic capacity, and resistance to therapy. This heterogeneity is regulated by a variety of intrinsic and extrinsic stimuli including those from the tumor microenvironment. Increasing evidence points to a key role for the metabolism of non-essential amino acids in this complex scenario. Here we discuss the impact of proline metabolism in cancer development and progression, with particular emphasis on the enzymes involved in proline synthesis and catabolism, which are linked to pathways of energy, redox, and anaplerosis. In particular, we emphasize how proline availability influences collagen synthesis and maturation and the acquisition of cancer cell plasticity and heterogeneity. Specifically, we propose a model whereby proline availability generates a cycle based on collagen synthesis and degradation, which, in turn, influences the epigenetic landscape and tumor heterogeneity. Therapeutic strategies targeting this metabolic-epigenetic axis hold great promise for the treatment of metastatic cancers. [ABSTRACT FROM AUTHOR]

Mutations in the proline dehydrogenase gene PRODH are linked to behavioral alterations in schizophrenia and as part of DiGeorge and velo-cardio-facial syndromes, but the role of PRODH in their etiology remains unclear. Here, we establish a Drosophila model to study the role of PRODH in behavioral disorders. We determine the distribution of the Drosophila PRODH homolog slgA in the brain and show that knockdown and overexpression of human PRODH and slgA in the lateral neurons ventral (LNv) lead to altered aggressive behavior. SlgA acts in an isoform-specific manner and is regulated by casein kinase II (CkII). Our data suggest that these effects are, at least partially, due to effects on mitochondrial function. We thus show that precise regulation of proline metabolism is essential to drive normal behavior and we identify Drosophila aggression as a model behavior relevant for the study of the mechanisms that are impaired in neuropsychiatric disorders.

Proline dehydrogenase (PRODH), which degrades L-proline, resides within the schizophrenia-linked 22q11.2 deletion suggesting a role in disease. Supporting this, elevated L-proline levels have been shown to increase risk for psychotic disorders. Despite the strength of data linking PRODH and L-proline to neuropsychiatric diseases, targets of disease-relevant concentrations of L-proline have not been convincingly described. Here, we show that Prodh-deficient mice with elevated CNS L-proline display specific deficits in high-frequency GABA-ergic transmission and gamma-band oscillations. We find that L-proline is a GABA-mimetic and can act at multiple GABA-ergic targets. However, at disease-relevant concentrations, GABA-mimesis is limited to competitive blockade of glutamate decarboxylase leading to reduced GABA production. Significantly, deficits in GABA-ergic transmission are reversed by enhancing net GABA production with the clinically relevant compound vigabatrin. These findings indicate that accumulation of a neuroactive metabolite can lead to molecular and synaptic dysfunction and help to understand mechanisms underlying neuropsychiatric disease.

Proline was reported to improve sperm quality in rams, stallions, cynomolgus monkeys, donkeys, and canines during cryopreservation. However, the underlying mechanism remains unclear. The aim of this study was to investigate the effect of proline on boar semen during liquid storage at 17 °C and explore the underlying mechanism. Freshly ejaculated boar semen was supplemented with different concentrations of proline (0, 25, 50, 75, 100, 125 mM) and stored at 17 °C for nine days. Sperm motility patterns, membrane integrity, ATP (adenosine triphosphate), reactive oxygen species (ROS), and GSH (glutathione) levels, and the activities of catalase (CAT) and superoxide dismutase (SOD) were evaluated after storage for up to five days. It was observed that boar sperm quality gradually decreased with the extension of storage time, while the ROS levels increased. Addition of 75 mM proline not only significantly improved sperm membrane integrity, motility, and ATP levels but also maintained the redox homeostasis via increasing the GSH levels and activities of CAT and SOD. When hydrogen peroxide (H2O2) was used to induce oxidative stress, addition of proline significantly improved sperm quality and reduced ROS levels. Moreover, addition of proline also improved sperm quality during the rapid cooling process. Notably, addition of DL-PCA (DL-pipecolinic acid) rescued the reduction of progressive motility and total motility caused by H2O2, and THFA (tetrahydro-2-furoic acid) failed to provide protection. Furthermore, addition of proline at 75 mM increased the activity of proline dehydrogenase (PRODH) and attenuated the H2O2-induced reduction in progressive motility. These data demonstrate that proline protects sperm against oxidative stress through the secondary amine structure and proline dehydrogenase-mediated metabolism.

Under physiological conditions, most human endogenous retroviruses (HERVs) are transcriptionally silent. However, re-activation of HERVs is observed under pathological conditions like inflammation or cancer. In addition to expression of HERV sequences, an impact of HERV-loci on expression of adjacent genes has been suggested as probably important patho-physiological mechanism. A candidate for such a gene is PRODH (proline dehydrogenase 1), which is located on chromosome 22 adjacent to HERVK-24. Germ cell tumors (GCTs) are known to express high level of HERVK sequences. In addition, non-seminomatous GCT are useful models to study HERV expression in the context of differentiation since they reflect aspects of cellular development during embryogenesis and usually contain different cell types. This is due to the embryonal carcinoma (EC) cells, which are the stem cell component of GCT. They are pluripotent, show high expression of pluripotency markers like OCT4 and LIN28A and can differentiate into either somatic derivatives (teratoma cells) or choriocarcinoma or yolk-sac tumor cells reflecting extra-embryonal differentiation. OCT4 is lost upon differentiation. We used GCT derived cell lines of varying differentiation stages to analyze expression of HERVK and PRODH. Differentiation status and cellular relationship of GCT cells was determined using microarray analysis and western blotting of the embryonic pluripotency markers OCT4 and LIN28A. The highest expression of HERVK was found in undifferentiated EC cells, which retain a stem cell phenotype and express both OCT4 and LIN28. In contrast, the lowest expression of HERVK was observed in somatic differentiated GCT cells which also lack OCT4 and LIN28A whereas GCT cells with differentiation characteristics of yolk-sac tumor expressed LIN28A but not OCT4 and showed intermediate level of HERVK. A similar pattern was found for PRODH. Differentiation of EC cells by siRNA mediated knock-down of OCT4 or treatment with differentiation inducing medium decreased expression of HERVK and PRODH. Treatment of differentiated GCT cells with 5′-azacytidine and trichostatin A increased expression of HERVK and PRODH, indicating that epigenetic mechanisms are responsible for altered expression of these genes. Our data suggest that HERVK expression is dependent on cellular differentiation stages regulated by epigenetic mechanisms, which can also affect expression of neighboring genes.

Under physiological conditions, most human endogenous retroviruses (HERVs) are transcriptionally silent. However, re-activation of HERVs is observed under pathological conditions like inflammation or cancer. In addition to expression of HERV sequences, an impact of HERV-loci on expression of adjacent genes has been suggested as probably important patho-physiological mechanism. A candidate for such a gene is PRODH (proline dehydrogenase 1), which is located on chromosome 22 adjacent to HERVK-24. Germ cell tumors (GCTs) are known to express high level of HERVK sequences. In addition, non-seminomatous GCT are useful models to study HERV expression in the context of differentiation since they reflect aspects of cellular development during embryogenesis and usually contain different cell types. This is due to the embryonal carcinoma (EC) cells, which are the stem cell component of GCT. They are pluripotent, show high expression of pluripotency markers like OCT4 and LIN28A and can differentiate into either somatic derivatives (teratoma cells) or choriocarcinoma or yolk-sac tumor cells reflecting extra-embryonal differentiation. OCT4 is lost upon differentiation. We used GCT derived cell lines of varying differentiation stages to analyze expression of HERVK and PRODH. Differentiation status and cellular relationship of GCT cells was determined using microarray analysis and western blotting of the embryonic pluripotency markers OCT4 and LIN28A. The highest expression of HERVK was found in undifferentiated EC cells, which retain a stem cell phenotype and express both OCT4 and LIN28. In contrast, the lowest expression of HERVK was observed in somatic differentiated GCT cells which also lack OCT4 and LIN28A whereas GCT cells with differentiation characteristics of yolk-sac tumor expressed LIN28A but not OCT4 and showed intermediate level of HERVK. A similar pattern was found for PRODH. Differentiation of EC cells by siRNA mediated knock-down of OCT4 or treatment with differentiation inducing medium decreased expression of HERVK and PRODH. Treatment of differentiated GCT cells with 5'-azacytidine and trichostatin A increased expression of HERVK and PRODH, indicating that epigenetic mechanisms are responsible for altered expression of these genes. Our data suggest that HERVK expression is dependent on cellular differentiation stages regulated by epigenetic mechanisms, which can also affect expression of neighboring genes. [ABSTRACT FROM AUTHOR]

Studies on Schizophrenia, so far reveal a complex picture of neurological malfunctioning reported to be strongly associated with proline dehydrogenase (PRODH). This study employs in silico hybrid approach for virtual screening and molecular docking followed by pharmacophore identification and structural modeling. Docking studies revealed critical residues for receptor-ligand interaction. Virtual screening approach coupled with docking energies and drug likeness rules, suggested that of 8 compounds, Clozapine, MCULE-1620364835-0 (Drug Score 88 %) and PB-752728400 (Drug Score 85 % and Binding energy 8.1 kcal/mol) observed as potential inhibitor compounds for targeting PRODH. Energy score of selected compounds were better than the previous listed drug analogs. ALDH4A1, functional partner of PRODH showed strong interactions with PRODH. [ABSTRACT FROM AUTHOR]

Summary Proline dehydrogenase (PRODH), which degrades L-proline, resides within the schizophrenia-linked 22q11.2 deletion suggesting a role in disease. Supporting this, elevated L-proline levels have been shown to increase risk for psychotic disorders. Despite the strength of data linking PRODH and L-proline to neuropsychiatric diseases, targets of disease-relevant concentrations of L-proline have not been convincingly described. Here, we show that Prodh -deficient mice with elevated CNS L-proline display specific deficits in high-frequency GABA-ergic transmission and gamma-band oscillations. We find that L-proline is a GABA-mimetic and can act at multiple GABA-ergic targets. However, at disease-relevant concentrations, GABA-mimesis is limited to competitive blockade of glutamate decarboxylase leading to reduced GABA production. Significantly, deficits in GABA-ergic transmission are reversed by enhancing net GABA production with the clinically relevant compound vigabatrin. These findings indicate that accumulation of a neuroactive metabolite can lead to molecular and synaptic dysfunction and help to understand mechanisms underlying neuropsychiatric disease. [ABSTRACT FROM AUTHOR]

Accumulation of free L-proline (Pro) is a typical stress response incited by osmotic injuries in plants and microorganisms. Although the protective role of Pro in osmotic stress is not well understood, it is thought to function as compatible osmolyte or as a scavenger of reactive oxygen species (ROS). Here we show that, in Arabidopsis thaliana, Pro biosynthesis can be activated by incompatible plant—pathogen interactions triggering a hypersensitive response (HR). Pro accumulates in leaf tissues treated with Pseudomonas syringae pv. tomato avirulent strains (avrRpt2 and avrRpm1) but remains unchanged in leaves infected with isogenic virulent bacteria. Incompatible interactions lead to transcriptional activation of AtP5CS2, but not AtP5CS1, encoding the rate limiting enzyme in Pro biosynthesis pyrroline-5-carboxylate synthase (P5CS). AtP5CS2:GUS and AtP5CS2:LUC transgenes were induced inside and around the HR lesions produced by avirulent Pseudomonas spp. in transgenic plants. Pro accumulation was faster and stronger when stimulated by avrRpm1 than by avrRpt2, and was compromised in the low-salicylic acid plants NahG and eds5 when signaled through the RPS2-dependent pathway. In addition, Pro content and AtP5CS2 expression were enhanced by ROS in wild-type plants, suggesting that ROS may function as an intermediate signal in AtP5CS2-mediated Pro accumulation.

Several studies have shown that human endogenous retroviruses and endogenous retrovirus-like repeats (here collectively HERVs) impose direct regulation on human genes through enhancer and promoter motifs present in their long terminal repeats ( LTRs). Although chimeric transcription in which novel gene isoforms containing retroviral and human sequence are transcribed from viral promoters are commonly associated with disease, regulation by HERVs is beneficial in other settings; for example, in human testis chimeric isoforms of TP63 induced by an ERV9 LTR protect the male germ line upon DNA damage by inducing apoptosis, whereas in the human globin locus the γ- and β-globin switch during normal hematopoiesis is mediated by complex interactions of an ERV9 LTR and surrounding human sequence. The advent of deep sequencing or next-generation sequencing (NGS) has revolutionized the way researchers solve important scientific questions and develop novel hypotheses in relation to human genome regulation. We recently applied next-generation paired-end RNA-sequencing (RNA-seq) together with chromatin immunoprecipitation with sequencing (ChIP-seq) to examine ERV9 chimeric transcription in human reference cell lines from Encyclopedia of DNA Elements (ENCODE). This led to the discovery of advanced regulation mechanisms by ERV9s and other HERVs across numerous human loci including transcription of large gene-unannotated genomic regions, as well as cooperative regulation by multiple HERVs and non-LTR repeats such as Alu elements. In this article, well-established examples of human gene regulation by HERVs are reviewed followed by a description of paired-end RNA-seq, and its application in identifying chimeric transcription genome-widely. Based on integrative analyses of RNA-seq and ChIP-seq, data we then present novel examples of regulation by ERV9s of tumor suppressor genes CADM2 and SEMA3A, as well as transcription of an unannotated region. Taken together, this article highlights the high suitability of contemporary sequencing methods in future analyses of human biology in relation to evolutionary acquired retroviruses in the human genome. [ABSTRACT FROM AUTHOR]

Main conclusion: Six BnaProDH1 and two BnaProDH2 genes were identified in Brassica napus genome. The BnaProDH1 genes are mainly expressed in pollen and roots' organs while BnaProDH2 gene expression is associated with leaf vascular tissues at senescence. Abstract: Proline dehydrogenase (ProDH) catalyzes the first step in the catabolism of proline. The ProDH gene family in oilseed rape ( Brassica napus) was characterized and compared to other Brassicaceae ProDH sequences to establish the phylogenetic relationships between genes. Six BnaProDH1 genes and two BnaProDH2 genes were identified in the B. napus genome. Expression of the three paralogous pairs of BnaProDH1 genes and the two homoeologous BnaProDH2 genes was measured by real-time quantitative RT-PCR in plants at vegetative and reproductive stages. The BnaProDH2 genes are specifically expressed in vasculature in an age-dependent manner, while BnaProDH1 genes are strongly expressed in pollen grains and roots. Compared to the abundant expression of BnaProDH1, the overall expression of BnaProDH2 is low except in roots and senescent leaves. The BnaProDH1 paralogs showed different levels of expression with BnaA&C.ProDH1.a the most strongly expressed and BnaA&C.ProDH1.c the least. The promoters of two BnaProDH1 and two BnaProDH2 genes were fused with uidA reporter gene (GUS) to characterize organ and tissue expression profiles in transformed B. napus plants. The transformants with promoters from different genes showed contrasting patterns of GUS activity, which corresponded to the spatial expression of their respective transcripts. ProDHs probably have non-redundant functions in different organs and at different phenological stages. In terms of molecular evolution, all BnaProDH sequences appear to have undergone strong purifying selection and some copies are becoming subfunctionalized. This detailed description of oilseed rape ProDH genes provides new elements to investigate the function of proline metabolism in plant development. [ABSTRACT FROM AUTHOR]

Proline metabolism is implicated in plant responses to abiotic stresses, including the chilling stress. During proline catabolism, the two-step oxidation of proline is performed by the continuous actions of proline dehydrogenase (ProDH), which produces Δ-pyrroline-5-carboxylate (P5C), and P5C dehydrogenase (P5CDH), which oxidizes P5C to glutamate. The Arabidopsis thaliana chilling mutants chs1 and chs2 are sensitive to chilling temperatures of 13-18°C. For a better understanding of Arabidopsis responses to chilling stress, 4-week-old wild-type (WT) and chs1 and chs2 lines, with three plants in each group, were subjected to chilling stress (13°C), cold stress (4°C), or remained under normal conditions (23°C); and several factors including the expression of ProDH2 and P5CDH genes, POX (peroxidase) and SOD (superoxide dismutase) activities, as well as MDA and proline contents were examined. Our results showed an increase in the proline content in all lines under chilling conditions. In addition, a greater expression of ProDH2 and a lower expression of P5CDH were observed, leading us to speculate a greater breakdown of proline into P5C and a consequent overproduction of ROS in the ETC cycle. The higher POX and SOD activities and a higher MDA content in chs mutants at 13°C are in line with this speculation. Finally, cold-treated plants (4°C) only showed an increase in proline levels. [ABSTRACT FROM AUTHOR]

Abstract: There are multiple genetic links between schizophrenia and a deficit of proline dehydrogenase (PRODH) enzyme activity. However, reports testing for an association of schizophrenia with the resulting proline elevation have been conflicting. The objectives of this study were to investigate whether hyperprolinemia is associated with schizophrenia, and to measure the relationship between plasma proline, and clinical features and symptoms of schizophrenia. We performed a cross-sectional case–control study, comparing fasting plasma proline in 90 control subjects and 64 schizophrenic patients and testing for association of mild to moderate hyperprolinemia with schizophrenia. As secondary analyses, the relationship between hyperprolinemia and five measures of clinical onset, symptoms and outcome were investigated. Patients had significantly higher plasma proline than matched controls (p<0.0001), and categorical analysis of gender adjusted hyperprolinemia showed a significant association with schizophrenia (OR 6.15, p=0.0003). Hyperprolinemic patients were significantly older at their first hospitalization (p=0.015 following correction for multiple testing). While plasma proline level was not related to total, positive or negative symptoms, hyperprolinemic status had a significant effect on length of hospital stay (p=0.005), following adjustment for race, BPRS score, and cross-sectional time from admission to proline measurement. Mild to moderate hyperprolinemia is a significant risk factor for schizophrenia, and may represent an intermediate phenotype in the disease. Hyperprolinemic patients have a significantly later age of first psychiatric hospitalization, suggestive of later onset, and hospital stays 46% longer than non-hyperprolinemic subjects. These findings have implications in the etiology of schizophrenia, and for the clinical management of these patients. [Copyright &y& Elsevier]

Abstract: Over the last fifteen years it has become established that 22q11.2 deletion syndrome (22q11DS) is a true genetic risk factor for schizophrenia. Carriers of deletions in chromosome 22q11.2 develop schizophrenia at rate of 25–30% and such deletions account for as many as 1–2% of cases of sporadic schizophrenia in the general population. Access to a relatively homogeneous population of individuals that suffer from schizophrenia as the result of a shared etiological factor and the potential to generate etiologically valid mouse models provides an immense opportunity to better understand the pathobiology of this disease. In this review we survey the clinical literature associated with the 22q11.2 microdeletions with a focus on neuroanatomical changes. Then, we highlight results from work modeling this structural mutation in animals. The key biological pathways disrupted by the mutation are discussed and how these changes impact the structure and function of neural circuits is described. [Copyright &y& Elsevier]

Proline accumulation in response to abiotic stress is controlled partially by transcriptional regulation of key enzymes including Δ -pyrroline-carboxylate synthetase1 ( P5CS1), proline dehydrogenase ( ProDH), ornithine amino transferase ( OAT) and Δ -pyrroline-carboxylate dehydrogenase ( P5CDH). For these genes, the role of abscisic acid (ABA), role of feedback regulation by high proline and the mechanisms of gene regulation upon stress release remain unclear. An ABA-deficient ( aba2-1) mutant, mutants deficient in proline accumulation ( p5cs1), as well as double mutants deficient in both, were used to determine the importance of these factors in transcriptional regulation of proline metabolism. Upregulation of P5CS1 by low water potential was less dependent on ABA than that of stress-marker genes used for comparison. ProDH downregulation by low water potential and upregulation by stress release was not impaired in aba2-1, p5cs1 or p5cs1/aba2-1 compared with wild type despite differing ABA and proline levels in these mutants. Thus, ProDH is a model for characterization of novel regulatory mechanisms associated with low water potential and stress recovery. Both OAT and P5CDH were upregulated during low water potential. This contrasts with previous salt stress experiments and raises questions about the flux of metabolites through proline metabolism under low water potential when high levels of proline accumulate. [ABSTRACT FROM AUTHOR]

Background: Significant associations have been shown for haplotypes comprising three PRODH single nucleotide polymorphisms (SNPs; 1945T/C, 1766A/G, 1852G/A) located in the 3′ region of the gene, suggesting a role of these variants in the etiopathogenesis of schizophrenia. We assessed the relationship between these high-risk PRODH polymorphisms and schizophrenia-related endophenotypes in a large and highly homogeneous cohort of healthy males. Methods: Participants (n = 217) were tested in prepulse inhibition (PPI), verbal and working memory, trait anxiety and schizotypy. The QTPHASE from the UNPHASED package was used for the association analysis of each SNP or haplotype data. This procedure revealed significant phenotypic impact of the risk CGA haplotype. Subjects were then divided in two groups; levels of PPI, anxiety, and schizotypy, verbal and working memory were compared with analysis of variance. Results: CGA carriers (n = 32) exhibited attenuated PPI (p < .001) and verbal memory (p < .001) and higher anxiety (p < .004) and schizotypy (p < .008) compared with the noncarriers (n = 185). There were no differences in baseline startle, demographics, and working memory. The main significant correlations were schizotypy × PPI [85-dB, 120-msec trials] in the carriers and schizotypy × anxiety in the entire group and the noncarriers but not the carriers group. Conclusions: Our results strongly support PPI as a valid schizophrenia endophenotype and highlight the importance of examining the role of risk haplotypes on multiple endophenotypes and have implications for understanding the continuum from normality to psychosis, transitional states, and the genetics of schizophrenia-related traits. [Copyright &y& Elsevier]

Abstract: Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5′ flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at −1161 to −1188bp upstream of the POX transcriptional start site. [Copyright &y& Elsevier]

Haploinsufficiency of 22q11 genes including catechol- O-methyltransferase (COMT) and proline dehydrogenase (PRODH) may result in structural and functional brain abnormalities and increased vulnerability to schizophrenia as observed in patients with microdeletions of 22q11. Thus, COMT and PRODH could be modifier genes for schizophrenia. We examined association of polymorphisms in COMT and PRODH with brain anatomy in young patients with schizophrenia and schizoaffective disorder. We acquired structural magnetic resonance imaging data from 51 male patients and genotyped two single nucleotide polymorphisms (SNPs) in the COMT gene and three in the PRODH gene. Statistical Parametric Mapping software and optimized voxel-based morphometry were used to determine regional gray matter (GM) and white matter (WM) density differences, and total GM and WM volume differences between genotype groups. Two nonsynonymous SNPs in the PRODH gene were associated with bilateral frontal WM density reductions and an SNP in the P2 promoter region of COMT (rs2097603) was associated with GM increase in the right superior temporal gyrus. Furthermore, we found evidence for COMT and PRODH epistasis: in patients with a COMT Val allele (rs4680) and with one or two mutated PRODH alleles, we observed increased WM density in the left inferior frontal lobe. Our results suggest that genetic variation in COMT and PRODH has significant effects on brain regions known to be affected in schizophrenia. Further research is needed to investigate the role of 22q11 genes on brain structure and function and their role in vulnerability for schizophrenia. [ABSTRACT FROM AUTHOR]

There is an overwhelming evidence that children and adults with 22q11.2 deletion syndrome (22q11.2DS) have a characteristic behavioral phenotype. In particular, there is a growing body of evidence that indicates an unequivocal association between 22q11.2DS and schizophrenia, especially in adulthood. Deletion of 22q11.2 is the third highest risk for the development of schizophrenia, with only a greater risk conferred by being the child of two parents with schizophrenia or the monozygotic co-twin of an affected individual. Both linkage and association studies of people with schizophrenia have implicated several susceptibility genes, of which three are in the 22q11.2 region; catechol-o-methyltransferase (COMT), proline dehydrogenase (PRODH), and Gnb1L. In addition, variation in Gnb1L is associated with the presence of psychosis in males with 22q11.2DS. In mouse models of 22q11.2DS, haploinsufficiency of Tbx1 and Gnb1L is associated with reduced prepulse inhibition, a schizophrenia endophenotype. The study of 22q11.2DS provides an attractive model to increase our understanding of the development and pathogenesis of schizophrenia and other psychiatric disorders in 22q11.2DS and in wider population. © 2008 Wiley-Liss, Inc. Dev Disabil Res Rev 2008;14:26–34. [ABSTRACT FROM AUTHOR]

Abstract: Previous studies have suggested that catechol-O-methyltransferase (COMT), proline dehydrogenase (PRODH), and brain-derived neurotrophic factor (BDNF) genes are possible susceptibility genes for schizophrenia. We hypothesized that these genes are also associated with schizotypal traits, which are heritable and related to schizophrenia. We genotyped five single nucleotide polymorphism (SNPs) from the COMT, PRODH and BDNF genes, and performed a series of association analyses between alleles, genotypes or haplotypes, and quantitative schizotypal trait scores derived from the Schizotypal Personality Questionnaire (SPQ), in 465 Chinese healthy subjects. We found that ‘years of education’ was a major influence on seven out of nine schizotypal components, three schizotypal factors and the total SPQ scores. Molecular genetic analysis of COMT, PRODH and BDNF genes showed no significant effects of any variants on schizotypal components or factors of SPQ after correction for multiple testing, although there were weak association between COMT Val158Met (rs4680G/A) and the odd speech subscale (allele-wise, P =0.04; genotype-wise, P =0.049), between COMT Val158Met (rs4680G/A) and the suspiciousness subscale (genotype-wise, P =0.024), and between BDNF Val66Met and the Factor 2 interpersonal measure (genotype-wise, P =0.027) before correction. Furthermore, we found SNP Val158Met (rs4680) of the COMT gene significantly influenced the scores of some of schizotypal traits including total SPQ score, the disorganization factor and the constricted affect subscale in male subjects only. However, the effect was in the opposite direction of an earlier association with the SPQ reported by Avramopoulos et al. [Avramopoulos, D., Stefanis, N.C., Hantoumi, I., Smyrnis, N., Evdokimidis, I., Stefanis, C.N., 2002. Higher scores of self reported schizotypy in healthy young males carrying the COMT high activity allele. Molecular Psychiatry 7, 706–711]. We conclude that SNP Val158Met (rs4680) in the COMT gene may be associated with some schizotypal traits in male subjects, but our results are not conclusive. [Copyright &y& Elsevier]

Fragilariopsis cylindrus (Grunow) Willi Krieger, a bipolar psychrophilic and highly abundant diatom, experiences strong shifts in salinity during the formation of sea ice. We investigated the effects of osmotic stress due to an increased salt concentration from 34 to 70 practical salinity units (PSU) in conjunction with a temperature decrease from 0°C to −4°C on the anabolic and catabolic pathways of proline metabolism. Gene expression levels of Δ1-pyrroline-5-carboxylate synthase ( P5CS) strongly decreased by a factor of 17.3 in the 70 PSU/0°C treatment, whereas copy numbers of ornithine δ-aminotransferase (δ- OAT) increased 7.6-fold. Transcript levels of Δ1-pyrroline-5-carboxylate reductase ( P5CR) and proline dehydrogenase ( ProDH) were also slightly up-regulated by 2.5 and 2.88, respectively. This contrasts with findings in higher plants where a reverse regulation of P5CS and δ-OAT was observed and indicates that under elevated external salinities, the ornithine route is preferred to the glutamate pathway in F. cylindrus. Photosynthetic quantum yield at PSII instantly dropped from 0.61 to 0.24 after the upshift in salinity, which confirmed a detrimental effect of elevated salt concentrations on the photosynthetic machinery. Reduced photosynthetic energy capture might explain the preference for the ornithine route over the more energyconsuming proline route. Salt proved to be the dominating stressor, while an additional temperature decrease appeared to have an ameliorating effect. [ABSTRACT FROM AUTHOR]

Abstract: Synergistic interaction between genes on chromosome 22q11 recently has been proposed as a possible mechanism which could confer increased risk for schizophrenia. Based on this hypothesis, our study aimed to explore main, cis- and trans-interacting effects of three candidate genes on 22q11, ProDH, COMT and ZDHHC8. We selected four putative risk variants, residing within these genes, ProDH 1945, ProDH 2026, COMT ValMet and ZDHHC8 rs175174, and studied these in a large family-based schizophrenia association sample of European origin (488 Bulgarian parent–offspring trios). The presence of interaction between the variants was tested by conditional logistic regression analysis based on a case–pseudocontrol design. Our study did not find statistical evidence for allelic (investigation of ProDH markers only), genotypic, haplotypic, or interactive effects between ProDH, COMT and ZDHHC8. Our data do not support the hypothesis that an interaction between these genes influences susceptibility to schizophrenia. [Copyright &y& Elsevier]

DNA sequence variations within the 22q11 DiGeorge chromosomal region are likely to confer susceptibility to psychotic disorders. In a previous report, we identified several heterozygous alterations, including a complete deletion, of the proline dehydrogenase (PRODH) gene, which were associated with moderate hyperprolinemia in a subset of DSM III schizophrenic patients. Our objective was (i) to determine whether hyperprolinemia is associated with increased susceptibility for any of three psychiatric conditions (schizophrenia, schizoaffective disorder and bipolar disorder) and (ii) to establish a correlation between hyperprolinemia and PRODH genotypes. We have conducted a case-control study including 114 control subjects, 188 patients with schizophrenia, 63 with schizoaffective disorder and 69 with bipolar disorder. We report that, taking into account a confounding effect due to valproate treatment, hyperprolinemia is a risk factor for DSM IIIR schizoaffective disorder (P=0.02, Odds ratio=4.6, 95%confidence interval 1.3-16.3). We did not detect 22q11 interstitial deletions associated with the DiGeorge syndrome among the 320 patients of our sample and we found no association between common PRODH polymorphisms and any of the psychotic disorders. In contrast, we found that five rare PRODH alterations (including a complete PRODH deletion and four missense substitutions) were associated with hyperprolinemia. In several cases, two variations were present simultaneously, either in cis or trans in the same subject. A total of 11 from 30 hyperprolinemic subjects bore at least one genetic variation associated with hyperprolinemia. This study demonstrates that moderate hyperprolinemia is an intermediate phenotype associated with certain forms of psychosis.Molecular Psychiatry (2005) 10, 479-485. doi:10.1038/sj.mp.4001597 Published online 19 October 2004 [ABSTRACT FROM AUTHOR]

A 6-bp sequence, ACTCAT, acts as a cis-acting element involved in hypoosmolarity- and proline-responsive expression of an Arabidopsis proline dehydrogenase (ProDH) gene. Search of the database for plant cis-acting elements revealed that the ACTCAT sequence is similar to the GCN4 motif [ATGA(C/G)TCAT] that is recognized by bZIP transcription factors. To identify transcription factor(s) for regulation of ProDH, we examined whether Arabidopsis bZIPs function as transcription factors for the ACTCAT sequence. Transient expression analysis revealed that the four proteins in Group S bZIPs, AtbZIP11/ATB2, AtbZIP44, AtbZIP2/GBF5 and AtbZIP53, formed an ATB2 subgroup that activated expression of the GUS reporter gene driven by the ACTCAT sequence while other bZIPs and different families of plant transcription factors did not. The transactivation activity of the ATB2 subgroup was enhanced in a hypoosmotic condition. In a gel mobility shift assay, the recombinant proteins of the ATB2 subgroup specifically bound to the ACTCAT sequence. RNA gel blot analysis indicated that the expression of AtbZIP2/GBF5 and AtbZIP53, as well as that of ProDH, is induced by hypoosmolarity. Moreover, we showed that the sGFP::AtbZIP11/ATB2 fusion protein is localized in the nucleus. These results suggest that the ATB2 subgroup functions as a transcriptional activator for hypoosmolarity-inducible ProDH in Arabidopsis. [ABSTRACT FROM AUTHOR]

The fluctuation of proline content, and protein and mRNA levels of Δ1-pyrroline-5-carboxylate synthetase (P5CS) and proline dehydrogenase (ProDH), both of which are involved in proline biosynthesis and degradation, in the shoots of Arabidopsis grown in light/dark cycles were demonstrated under salt-stressed and unstressed conditions. Proline content, as well as proteins and mRNAs of these enzymes, clearly oscillated in the light/dark cycles under the stressed and unstressed conditions. A reciprocal relationship between P5CS and ProDH was observed. Protein levels of P5CS and ProDH were well synchronized with their mRNA levels, although the fluctuation of protein levels was not as significant as that of their mRNA levels. Both mRNA and protein levels of the two enzymes as well as the proline content did not oscillate under the continuous light or the dark conditions. Thus, P5CS and ProDH gene expressions seemed to be involved in light irradiation. Moreover, relative water content (RWC) in the plants oscillated in the light/dark cycles. The fluctuations of proline content in shoot reversely responded to that of RWC. It is suggested that the expression of two genes responds sensitively to a subtle change of cellular water status, and accumulated proline keeps the osmotic balance between cells and the outer environment. [ABSTRACT FROM PUBLISHER]

Simple Summary: Reactive oxygen species that accumulate during liquid storage of boar semen lead to oxidative stress to sperm. In this study, we found that proline significantly improved boar sperm quality and protected sperm against oxidative damages during liquid storage at 17 °C. Using the model of artificially induced oxidative stress, we found that proline exerted an antioxidative role by modulating redox homeostasis in boar sperm. The secondary amine structure of proline and proline dehydrogenase-mediated metabolism are involved in the antioxidative role. We suggest that addition of proline to the extender would be beneficial to improve boar sperm quality. Proline was reported to improve sperm quality in rams, stallions, cynomolgus monkeys, donkeys, and canines during cryopreservation. However, the underlying mechanism remains unclear. The aim of this study was to investigate the effect of proline on boar semen during liquid storage at 17 °C and explore the underlying mechanism. Freshly ejaculated boar semen was supplemented with different concentrations of proline (0, 25, 50, 75, 100, 125 mM) and stored at 17 °C for nine days. Sperm motility patterns, membrane integrity, ATP (adenosine triphosphate), reactive oxygen species (ROS), and GSH (glutathione) levels, and the activities of catalase (CAT) and superoxide dismutase (SOD) were evaluated after storage for up to five days. It was observed that boar sperm quality gradually decreased with the extension of storage time, while the ROS levels increased. Addition of 75 mM proline not only significantly improved sperm membrane integrity, motility, and ATP levels but also maintained the redox homeostasis via increasing the GSH levels and activities of CAT and SOD. When hydrogen peroxide (H2O2) was used to induce oxidative stress, addition of proline significantly improved sperm quality and reduced ROS levels. Moreover, addition of proline also improved sperm quality during the rapid cooling process. Notably, addition of DL-PCA (DL-pipecolinic acid) rescued the reduction of progressive motility and total motility caused by H2O2, and THFA (tetrahydro-2-furoic acid) failed to provide protection. Furthermore, addition of proline at 75 mM increased the activity of proline dehydrogenase (PRODH) and attenuated the H2O2-induced reduction in progressive motility. These data demonstrate that proline protects sperm against oxidative stress through the secondary amine structure and proline dehydrogenase-mediated metabolism. [ABSTRACT FROM AUTHOR]

22q11.2 deletion is a common microdeletion that causes an array of developmental defects including 22q11.2 deletion syndrome (22q11DS) or DiGeorge syndrome and velocardiofacial syndrome. About 30% of patients with 22q11.2 deletion develop schizophrenia. Mice with deletion of the ortholog region in mouse chromosome 16qA13 exhibit schizophrenia-like abnormal behaviors. It is suggested that the genes deleted in 22q11DS are involved in the pathogenesis of schizophrenia. Among these genes, COMT, ZDHHC8, DGCR8, and PRODH have been identified as schizophrenia susceptibility genes. And DGCR2 is also found to be associated with schizophrenia. In this review, we focused on these five genes and reviewed their functions in the brain and the potential pathophysiological mechanisms in schizophrenia, which will give us a deeper understanding of the pathology of schizophrenia., (© The Author(s) 2020. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)