Back to Search Start Over

Identification of a p53-response element in the promoter of the proline oxidase gene

Authors :
Maxwell, Steve A.
Kochevar, Gerald J.
Source :
Biochemical & Biophysical Research Communications. May2008, Vol. 369 Issue 2, p308-313. 6p.
Publication Year :
2008

Abstract

Abstract: Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5′ flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at −1161 to −1188bp upstream of the POX transcriptional start site. [Copyright &y& Elsevier]

Details

Language :
English
ISSN :
0006291X
Volume :
369
Issue :
2
Database :
Academic Search Index
Journal :
Biochemical & Biophysical Research Communications
Publication Type :
Academic Journal
Accession number :
31396603
Full Text :
https://doi.org/10.1016/j.bbrc.2008.01.171