Search

Bone marrow (BM) lymphocyte subsets are evaluated by flow cytometry or immunohistochemistry for diagnostic purposes; however, CD4:CD8 T lymphocyte ratios are often erroneously interpreted using peripheral blood ranges. There are few and no recent studies describing the composition of lymphocytes within the marrow space, or normal reference ranges. Lymphocyte subsets in cytopenic patients and hospital autopsy BM specimens were evaluated to better characterize CD4:CD8 ratios. Ten patients with a history of cytopenia were identified from 2017 to 2021. Clinical history, cytogenetic testing, and results of a next generation sequencing panel were reviewed to rule out hematolymphoid disease. Thirty-five decedents who underwent a hospital autopsy from 2018 to 2019 were identified. History of hematolymphoid disease was ruled out by chart review. Immunohistochemical staining for CD3, CD20, CD4, and CD8 was evaluated with digital image analysis. Findings were compared to peripheral blood flow cytometry in a group of 20 living patients. BM CD4:CD8 ratios by image analysis were significantly lower than peripheral blood, mean in cytopenic patients 0.37:1 and mean in decedents 0.51:1 versus 2.6:1 (p = 0.99). Lymphoid aggregates were encountered with increasing frequency in older individuals. These findings aid in the evaluation of BM lymphocyte subsets and distribution both in living patients and autopsy evaluation. We also present a practical approach to image analysis.

Chronic inflammation is frequently associated with myeloproliferative neoplasms (MPN), but the role of inflammation in the pathogenesis of MPN remains unclear. Expression of the proinflammatory cytokine interleukin-1 (IL-1) is elevated in patients with MPN as well as in Jak2V617F knock-in mice. Here, we show that genetic deletion of IL-1 receptor 1 (IL-1R1) normalizes peripheral blood counts, reduces splenomegaly and ameliorates bone marrow fibrosis in homozygous Jak2V617F mouse model of myelofibrosis. Deletion of IL-1R1 also significantly reduces Jak2V617F mutant hematopoietic stem/progenitor cells. Exogenous administration of IL-1β enhances myeloid cell expansion and accelerates the development of bone marrow fibrosis in heterozygous Jak2V617F mice. Furthermore, treatment with anti-IL-1R1 antibodies significantly reduces leukocytosis and splenomegaly, and ameliorates bone marrow fibrosis in homozygous Jak2V617F mice. Collectively, these results suggest that IL-1 signaling plays a pathogenic role in MPN disease progression, and targeting of IL-1R1 could be a useful strategy for the treatment of myelofibrosis.

Histiocytic sarcoma is a rare malignant neoplasm that may occur de novo or in the context of a previous hematologic malignancy or mediastinal germ cell tumor. Here, we performed whole exome sequencing and RNA-sequencing (RNA-Seq) on 21 archival cases of primary histiocytic sarcoma. We identified a high number of genetic alterations within the RAS/RAF/MAPK pathway in 21 of 21 cases, with alterations in NF1 (6 of 21), MAP2K1 (5 of 21), PTPN11 (4 of 21), BRAF (4 of 21), KRAS (4 of 21), NRAS (1 of 21), and LZTR1 (1 of 21), including single cases with homozygous deletion of NF1, high-level amplification of PTPN11, and a novel TTYH3-BRAF fusion. Concurrent NF1 and PTPN11 mutations were present in 3 of 21 cases, and 5 of 7 cases with alterations in NF1 and/or PTPN11 had disease involving the gastrointestinal tract. Following unsupervised clustering of gene expression data, cases with NF1 and/or PTPN11 abnormalities formed a distinct tumor subgroup. A subset of NF1/PTPN11 wild-type cases had frequent mutations in B-cell lymphoma associated genes and/or clonal IG gene rearrangements. Our findings expand the current understanding of the molecular pathogenesis of this rare tumor and suggest the existence of a distinct subtype of primary histiocytic sarcoma characterized by NF1/PTPN11 alterations with predilection for the gastrointestinal tract.

Lymphoproliferative processes which occur in the gastrointestinal tract range from benign reactive processes such as follicular hyperplasia (rectal tonsil) to high grade malignant lymphomas and histiocytic sarcoma. The WHO Classification of Tumors: Digestive System Tumors, 5th Edition was published in 2019 and shows several impactful changes as compared to the 4th Edition published in 2010. WHO Classification of Tumors of Hematopoietic and Lymphoid Tissues 2017 also included detailed changes in hematopoietic neoplasms within the gastrointestinal tract. New entities or renamed hematolymphoid lesions include monomorphic epitheliotropic intestinal T-cell lymphoma, duodenal-type follicular lymphoma, intestinal T-cell lymphoma, NOS and indolent T-cell lymphoproliferative disorder of the gastrointestinal tract. A brief overview of WHO classification of digestive tumors and WHO classification of tumors of hematopoietic and lymphoid tissue is discussed focusing on the changes in the most recent WHO texts. In depth discussions will be presented in other papers in this series.

False kappa light chain restriction on hematogones (normal B-lineage precursors) has been described in patients on the therapeutic anti-CD38 monoclonal antibody daratumumab. In this article, we present a novel case report of pseudo-kappa light chain restriction on lambda-restricted neoplastic plasma cells in a patient with progressive plasma cell myeloma while on daratumumab. Flow cytometric technologists and pathologists need to be aware of this potential diagnostic pitfall.

T-cell lymphoproliferative processes in the spleen are rare and it is important to study normal T cell subsets in the spleen to understand the splenic milieu in which they arise. True malignant T-cell processes including hepatosplenic T-cell lymphoma and T-cell large granular lymphocytic leukemia occur in the spleen, but other atypical reactive T-cell proliferations and those of uncertain significance also have been described. Proper distinction of florid T cell responses from malignant T-cell neoplasms has important therapeutic implications for the patient.

Helicobacter infection is considered the major predisposing factor for gastric mucosa-associated lymphoid tissue (MALT) lymphoma with initial infection likely occurring in childhood. Primary gastric MALT lymphoma most commonly occurs in patients older than 50 years which is attributed to the lengthy chronic infection time required before the development of MALT lymphoma. Our study analyzes the histologic features and presence of immunoglobulin heavy chain (IGH) clonality in Helicobacter-associated chronic gastritis (62 cases) and Helicobacter-negative chronic gastritis (17 cases) biopsies within the pediatric population, diagnosed between 1996 and 2018. Helicobacter-associated gastritis was more likely to show active inflammation (P=0.01), with no significant difference in number of germinal centers or the strength, linear property, or depth of the inflammatory infiltrate. In total, 47% (29/62) of the Helicobacter-associated cases had at least 1 lymphoepithelial lesion, equivocal or definitive (a modified Wotherspoon score of 3 to 5), compared with 24% (4/17) of the Helicobacter-negative cases (P=0.5). All cases with lymphoepithelial lesions were assessed for IGH clonality, showing the presence of monoclonality in 27% (8/30) of evaluable cases. None of our patients were diagnosed with gastric lymphoma within available follow-up data. Although 4% of our cases could be considered MALT lymphoma in an adult patient based on prominent lymphoepithelial lesions and IGH monoclonality, caution is advised when diagnosing lymphoma in the pediatric population given the good prognosis of Helicobacter-associated gastritis in this age group. It is unclear if these monoclonal lymphoid proliferations require close follow-up.

Context.—Even though immunohistochemistry is routinely used by pathologists, evaluation of immunohistochemistry in splenic lesions remains difficult for many. Classification of benign and splenic lesions often requires a combination of hematoxylin-eosin evaluation, immunophenotyping, and sometimes molecular testing. Immunohistochemical staining is essential in evaluating many splenic lesions, and requires an understanding of the normal compartments of the spleen.Objective.—To address different immunohistochemical features used for identification and subclassification of different lesions of the spleen, as well as in the normal compartments of the spleen.Data Sources.—The information outlined in this review article is based on our experiences with a variety of spleen cases, on the current World Health Organization classification of hematopoietic and lymphoid tumors, and on a review of English-language articles published during 2018.Conclusions.—Features for phenotyping normal spleen as well as a variety of splenic lesions, including littoral cell angioma and splenic marginal zone lymphoma, are discussed. Suggested immunopanels are provided to assist in the diagnosis of different lesions of the spleen.

Post-transplant lymphoproliferative disorders (PTLD) are a known risk for both solid organ transplant and stem cell transplant recipients. Overall transplant recipients have a six fold increase in risk for developing any kind of non-Hodgkin lymphoma and PTLDs occur in up to 10% of SOT recipients. Several new entities have been accepted or renamed in the 2018 update of the WHO classification of tumors of hematopoietic and lymphoid neoplasms, including florid follicular hyperplasia and extranodal marginal zone lymphomas of mucosa-associated lymphoid tissue (MALT-lymphoma) (excluding common locations such as stomach and salivary gland). Other more rare types of PTLD have been reclassified including EBV-positive mucocutaneous ulcer, which is now a recognized diagnosis in its own right and should not be considered polymorphous PTLD. In this paper newly recognized PTLD entities and more unusual PTLDs will be examined.

The diagnosis of lymphoplasmacytic lymphoma is often challenging, especially in extramedullary tissues where the differential diagnosis includes nodal marginal zone lymphoma, splenic marginal zone lymphoma, or other small B-cell neoplasms with plasmacytic differentiation. The MYD88 L265P mutation has been recently identified in >90% of bone-marrow-based lymphoplasmacytic lymphoma, but the incidence of this abnormality and corresponding morphologic correlates in nodal lymphoplasmacytic lymphoma have not been established. We analyzed 87 cases of extramedullary lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, unclassifiable splenic B-cell lymphomas, nodal marginal zone lymphoma with plasmacytic differentiation, and chronic lymphocytic leukemia/small lymphocytic lymphoma with plasmacytic differentiation for MYD88 L265P. Eighteen cases (21%) were positive, including 9/9 (100%) lymphoplasmacytic lymphomas with classic histologic features, 5/12 (42%) cases that met 2008 WHO criteria for lymphoplasmacytic lymphoma but with atypical morphologic features, 3/15 (20%) cases initially considered nodal marginal zone lymphoma with plasmacytic differentiation, and 1/6 (17%) unclassifiable splenic B-cell lymphomas. The presence of MYD88 L265P was associated with IgM paraprotein (P

Epstein Barr virus (EBV)-related lymphoproliferative processes occur in the head and neck ranging from reactive processes such as infectious mononucleosis to high grade malignant lymphomas. EBV is a ubiquitous herpes virus that infects more than 90% of adults worldwide, and is generally transferred though saliva. Primary infection can occur throughout life. EBV is the first virus linked to malignancies, both epithelial and lymphoid. Both T and B cell lymphomas can be associated with EBV and evidence shows that an individual's response to the acute EBV infection may be critical in the development of subsequent lymphoma. Currently, in situ hybridization for EBER is the most sensitive available test to detect EBV and should be routinely performed in lymphoproliferative lesions of the head and neck. Immunohistochemistry for EBV related proteins, such as LMP1, is much less sensitive than EBER in situ hybridization, but can help determine latency patterns of EBV infection. Although relatively rare, primary EBV-related lymphomas must be considered in the differential of atypical lymphoid proliferations in the head and neck. We present selected EBV-related disorders of the head and neck discussing etiology as well as differential diagnosis.

ContextB-cell non-Hodgkin lymphoma is a heterogeneous group of lymphoproliferative malignancies with different clinical behaviors and treatments. It is important to differentiate individual B-cell lymphoma to apply the best treatment and management. Morphology and immunohistochemistry are the primary tools used for diagnosing lymphoma. There is a characteristic pattern of expression with immunohistochemical antibodies in most well-defined B-cell lymphomas. Some cases of B-cell lymphoma, however, show unusual morphologic and immunophenotypic features. The new and sometimes more specific antibodies have been developed recently, which may further define those lymphomas. Only with use of the antibodies over time does their true nature and specificity become evident.ObjectivesTo present new antibodies for B-cell lymphoma that enhance the probability for diagnosis or can act as alternate markers in unusual cases, in which a B-cell lymphoma does not present with characteristic immunohistochemical staining, and to present prognostic markers that allow for better management of patients with specific B-cell lymphomas.Data SourcesData were obtained from literature review and figures from slides in personal practice.ConclusionsThe immunohistochemical antibodies presented in this article increase our ability to understand, diagnosis, and manage patients with B-cell lymphoma.

Background Although the majority of post-transplant lymphoproliferative disorder (PTLD) cases are associated with Epstein–Barr virus (EBV), 20–42% of cases are EBV negative (EBV-N). The antigenic stimulus that drives EBV-N PTLD is unknown, but is likely heterogeneous. A common feature of PTLD, regardless of EBV status, is an abnormal polytypic lymphoplasmacytic infiltrate. Immunglobulin-G4 (IgG4) syndrome is also characterized by a polytypic lymphoplasmacytic infiltrate with a predominance of IgG4-positive (IgG4-P) plasma cells. Methods We investigated the possibility of an association between EBV-N PTLD and IgG4 syndrome. Of 33 evaluated PTLD cases, 9 (27%) were EBV-N. EBV-N PTLD cases showed longer transplantation-to-diagnosis times than EBV-positive cases. Results A single patient had a preceding benign duodenal biopsy with focally prominent IgG4-P plasma cells; however, no clinical data supported IgG4 syndrome, precluding an association between IgG4 syndrome and subsequent EBV-N PTLD in this patient. Conclusion As none of 29 evaluable cases of PTLD (including all 9 EBV-N cases) were associated with an increase in IgG4-P plasma cells, IgG4 syndrome does not appear to play a role in the etiology of EBV-N PTLD. The significance of these findings and the current understanding of the etiology of EBV-N PTLD are discussed.

Early death (ED) occurs in 10–30% of patients with acute promyelocytic leukemia (APL). Is all-trans retinoic acid (ATRA) promptly given and does it decrease overall early mortality? ATRA was administered within 24 h of morphological suspicion in only 44% of the 120 consecutive patients treated in the four collaborating centers. Absence of disseminated intravascular coagulation (p = 0.012) and admission to a non-university-affiliated hospital (p = 0.032) were independent predictors of ATRA delay. ED occurred in 17% of patients, and was independently correlated only with ICU admission (p = 0.002). Our results do not demonstrate that prompt (versus delayed) ATRA administration decreases overall early death.

Aims Studies have indicated that the t(14;18)(q32;q21)/IGH–MALT1 translocation is present in extranodal marginal zone lymphomas of mucosa-associated lymphoid tissue (MALT lymphoma). However, only a few studies have investigated the incidence of t(14;18)/IGH–MALT1 in primary gastrointestinal MALT lymphomas or in diffuse large B-cell lymphomas (DLBCL). The overall significance of t(14;18)/IGH–MALT1 in gastrointestinal MALT lymphomas is not clear. We examined 41 gastrointestinal MALT lymphoma and 23 DLBCL cases, with the aim of further understanding the role of t(14;18)/IGH–MALT1 in these diseases. Methods and results Fluorescence in-situ hybridization (FISH) assays for the detection of t(14;18)/IGH–MALT1 and t(11;18)(q21;q21)/API2–MALT1, along with immunostaining and histological evaluations, were performed on selected cases. Of the 64 analysed cases, one gastric MALT lymphoma and one colonic MALT lymphoma were positive for t(14;18)/IGH–MALT1. Conclusions We describe what are, to our knowledge, the first reported primary colonic MALT lymphoma carrying t(14;18)(q32;q21)/IGH–MALT1, and one of the few reported cases of gastric MALT lymphoma with this translocation. As this translocation is seen in only a few gastrointestinal MALT lymphomas, it is not useful as a diagnostic marker for routine clinical services. Although these findings suggest that t(14;18)/IGH–MALT1 is a rare molecular event in gastrointestinal MALT lymphomas and DLBCLs, further studies to elucidate the role of this genetic alteration in these diseases are indicated.

Aims Autoimmune diseases (AD) are associated with lymphadenopathy and splenomegaly. Changes in the spleen have not been characterized completely in AD; we describe splenectomy specimens from five patients with chronic AD, highlighting the presence of necrotizing histiocytosis. Methods and results Of the patients (three males and two females; mean 40 years), four had systemic lupus erythematosus; one had rheumatoid arthritis. All had moderate splenomegaly (213–803 g, mean 421 g). Four cases exhibited necrosis with apoptosis and karyorrhectic debris occurring in the white pulp and minimal acute inflammation; one showed florid follicular hyperplasia. Splenic involvement ranged from focal to extensive. Plasma cells were negative for IgG4. Haematoxylin bodies were not identified. Stains for infectious organisms were negative. Immunohistochemical studies showed that lymphocytes surrounding the necrosis were a mixture of CD4+ and CD8+ T cells; CD123-positive plasmacytoid dendritic cells were not present, and staining for kappa and lambda light chains showed no clonality. 16S rDNA PCR was performed; no amplification was seen in three of four cases tested for bacteria specific rDNA. Epstein–Barr virus-encoded RNA (EBER) in situ hybridization studies highlighted rare positive cells in four cases. Conclusions Splenomegaly in AD is thought to be hyperplasic, but we present four cases showing histiocytic necrosis, a finding which should be considered part of the spectrum of AD in the spleen.

The objective of this study was to describe the CT and MRI features of sclerosing angiomatoid nodular transformation of the spleen with pathologic correlation.Nine patients with surgically resected and pathologically confirmed sclerosing angiomatoid nodular transformation were included in the study. Clinical history was reviewed to determine patient demographics and symptoms at presentation. Gross pathologic, histologic, and immunohistochemical findings were recorded. CT (n = 9) and MRI (n = 4) examinations were evaluated for lesion shape and margins, intrinsic characteristics, and enhancement pattern.Patients included were six women and three men, with a mean age of 41.2 years. Pathologic features of sclerosing angiomatoid nodular transformation included multiple angiomatous nodules in a radiating pattern with a central stellate fibrous scar and evidence of hemosiderin deposition. On imaging, the lesions were solitary and round, 78% having a lobulated margin. They were heterogeneously hypoenhancing during the arterial and portal venous phases of contrast-enhanced CT or MRI, with peripheral enhancing radiating lines in 88% of lesions. They showed progressive enhancement and were isoenhancing or hyperenhancing in the delayed phase. A hypoenhancing central scar was shown on imaging in 22% of lesions. All lesions were hypointense on T2-weighted images.Sclerosing angiomatoid nodular transformation shows characteristic CT and MRI findings reflecting the underlying pathology. Typical features are a solitary, round, lobulated mass with early peripheral enhancing radiating lines and progressive enhancement of the angiomatous nodules; delayed enhancement of the fibrous tissue; and hypo-intense T2 signal intensity from hemosiderin deposition.

Context.—Activation-induced cytidine deaminase, necessary for immunoglobulin somatic hypermutation and class switch recombination, is usually expressed within the follicular dendritic network but is also expressed in a population of interfollicular large B cells outside the germinal center. Objective.—To report 7 cases of diffuse large B-cell lymphoma with a distinct paracortical distribution. Expression of activation-induced cytidine deaminase, previously described in interfollicular large B cells, was evaluated. Design.—A panel of immunohistochemical markers, including double staining for activation-induced cytidine deaminase and CD20, was used to illustrate the cases. Molecular studies were performed by polymerase chain reaction in the paraffin-embedded tissue for t(14;18) chromosomal translocation and immunoglobulin heavy chain and T-cell receptor rearrangements. Results.—Patients included 3 males and 4 females ranging in age from 11 to 59 years (mean, 39 years). All specimens were lymph nodes (4 from the groin, 2 from the neck, and 1 from the axilla). Malignant lymphocytes were positive for CD20 and negative for CD5 and CD10. Staining for CD30, CD43, and BCL-2 was variable. The malignant cells showed at least focal staining with activation-induced cytidine deaminase. All cases were found to be monoclonal by immunoglobulin heavy-chain gene rearrangement or showed light-chain restriction. None of the tested cases showed t(14;18). Conclusions.—Diffuse large B-cell lymphoma with a paracortical distribution is unusual and may be a distinct morphologic variant. More study is necessary to determine the stage of B-cell development and the cell of origin of these tumors. However, activation-induced cytidine deaminase expression suggests they may arise from a putative interfollicular large B cell.

Lennert lymphoma (LL), or the lymphoepithelioid variant of peripheral T-cell lymphoma, is an uncommon entity with rarely seen or reported presentations in the skin. Cutaneous involvement of LL has been characterized by asymptomatic, non-ulcerated, red to violet papules, nodules and small plaques (less than 5 cm) on the trunk and extremities. Histologically, there are localized cellular lymphoid infiltrates in the dermis that tend to localize around blood vessels or skin appendages. Key to the diagnosis of LL is the presence of epithelioid histiocytes and atypical small lymphoid cells without increased vascularity or epidermotropism. Immunophenotyping shows a dense monoclonal T-cell population commonly associated with aberrant loss of T-cell-associated antigens. T-cell receptor gene rearrangements are also identified. Patients typically present with advanced stage and have a low 5-year survival. Herein, we present a case of cutaneous involvement by LL at the time of initial presentation that persisted after initiation of chemotherapy and was finally verified as secondary cutaneous involvement of LL 1 year later histologically, immunophenotypically and by T-cell receptor gene rearrangement studies.

Cyclin D1 protein expression in lymphocytes is classically associated with mantle cell lymphoma. Although increasingly recognized in other lymphoproliferative disorders, cyclin D1 expression and CCND1 gene abnormalities have not been well studied in nodular lymphocyte-predominant Hodgkin lymphoma (NLPHL). Using a double stain for CD20/cyclin D1, we quantified cyclin D1 expression in 10 cases of NLPHL and correlated those findings with SOX11 expression, CCND1 gene abnormalities, and clinical data. For comparison, we examined 5 cases of T cell-/histiocyte-rich large B-cell lymphoma (THRLBCL). All cases of NLPHL stained for cyclin D1 showed at least rare positivity in lymphocyte-predominant (LP) cells. In 4 cases, at least 20% of LP cells were positive for CD20/cyclin D1. Neither SOX11 expression nor CCND1 gene rearrangement was found in any of the cases, but fluorescence in situ hybridization showed a proportion of the large cells with 3 to 4 copies of nonfused IGH and CCND1 signals or 3 intact CCND1 break-apart signals. Further study with CCND1/CEP11 showed polysomy in 6 of 9 cases with cyclin D1 expression and 5 of 16 NLPHL not examined for cyclin D1. Two of 5 cases of THRLBCL showed rare positive staining for CD20/cyclin D1; 1 case showed polysomy with CCND1/CEP11. Results show that cyclin D1 may be expressed in LP cells without SOX11 expression or CCND1 translocation. Polysomy with increased copies of CCND1 may account for cyclin D1 expression in some cases. Cyclin D1 expression is not useful for distinguishing NLPHL from THRLBCL and has no apparent clinical significance in NLPHL.

Primary vascular neoplasms of the spleen constitute the majority of nonhematolymphoid splenic tumors. The benign primary vascular tumors include hemangioma, hamartoma, and lymphangioma, whereas those of variable or uncertain biologic behavior include littoral cell angioma, hemangioendothelioma, and hemangiopericytoma. The primary malignant vascular neoplasm of the spleen is angiosarcoma. Peliosis is a rare lesion of unknown cause that is usually found incidentally in asymptomatic patients but may be associated with hematologic or metastatic disease. Although these vascular neoplasms of the spleen are uncommon, their importance lies in that they must be differentiated from the more common neoplastic disorders of the spleen, such as lymphoma and metastasis. The most common echogenic solid or complex cystic mass in an asymptomatic patient is splenic hemangioma. However, the imaging appearance of splenic hemangiomas may be complex, and differentiation of these lesions from malignant disease may not be possible. The diagnosis of splenic hamartoma may be suggested when findings of increased blood flow on color Doppler images are seen in association with a homogeneous solid echogenic mass. A large subcapsular solitary cystic abnormality discovered incidentally in a child in association with internal septations and tiny mural nodules favors the diagnosis of lymphangioma. Any invasion of the surrounding splenic parenchyma by a splenic lesion should indicate a more aggressive or malignant process. Evaluation of a focal splenic abnormality identified on sonograms should be followed up with computed tomography or magnetic resonance imaging with and without contrast material enhancement. Splenectomy may be required for definitive evaluation of a splenic mass with atypical features.

Cutaneous follicle center lymphoma (FCL) is reported to have a unique immunophenotype and clinical course as compared with nodal FCL. We studied 19 cases of FCL of the skin using paraffin embedded tissue. An immunohistochemistry panel included CD45, CD3, CD20, CD43, CD21, bcl-2, bcl-6, CD5, and CD10. Molecular studies were performed by polymerase chain reaction for immunoglobulin heavy chain (IgH) and t(14;18). Trisomy 3 was performed by fluorescent in situ hybridization (FISH) in 13 cases. Follow up was obtained in 17 cases (range 3 to 137 months). Patients included 10 females and 9 males ranging in age from 33 to 88 years at first presentation (mean, 64). Twelve of 19 presented in the head and neck and 6 in the trunk and 1 on the arm. All had no known lymph node disease at presentation. Seventeen patients had no nodal disease with a minimum 3 month follow-up; 2/19 had unknown lymph node status with no follow-up. All cases were immunoreactive with CD20 and negative with CD3. Bcl-2 was immunoreactive in 11/18 cases, bcl-6 in 15/15, CD10 in 14/17, CD43 in 2/16 (both were CD10 immunoreactive) and CD5 in 1/15 (it was also bcl-6 immunoreactive). Eight of 18 cases were monoclonal for IgH. Three of 17 showed the presence of t(14;18). FISH was positive in 4 cases for trisomy 3 ranging from 16 to 22% (12% threshold). Follow-up showed no evidence of disease in 14/17 patients (4 to 137 mos). 3/17 patients are alive with disease (17 to 100 mo), and no patients died of disease.

Context.—Inflammatory pseudotumor is an uncommon and enigmatic lesion. The spindle cells found in this tumor have features of myofibroblasts. Because of the indefinite relationship of these lesions with inflammatory fibrosarcoma and their indefinite biologic behavior, inflammatory pseudotumor is currently classified as inflammatory myofibroblastic tumor (IMT). To date, only case reports or small series have been published on these tumors, which are primary in the spleen. Design.—In this study, we describe the clinical, morphologic, and immunophenotypic findings of 12 cases of splenic IMT and examine their relationship to Epstein-Barr virus (EBV). Results.—The patients included 8 women and 3 men, ranging from 19 to 77 years of age (mean, 53 years; median, 60 years). Demographic data were unavailable for 1 patient. Patients generally presented with abdominal pain (n = 5) and fever (n = 4). Associated lesions included renal cell carcinoma (n = 2), colonic adenocarcinoma (n = 1), and cholecystitis (n = 1). All tumors were composed of a bland spindle cell proliferation in association with a variable mixed inflammatory component. There were 2 growth patterns, namely, a cellular spindle cell pattern and a hypocellular fibrous pattern. An immunohistochemical panel confirmed the myofibroblastic nature of the spindle cells. The spindle cells of 2 cases were immunoreactive for EBV latent membrane protein 1, whereas 6 of 10 cases were positive for EBV-encoded RNA using in situ hybridization. Follow-up was available for 8 patients; 6 were alive with no evidence of recurrence and 2 were dead of other causes. Conclusion.—Splenic IMTs are uncommon lesions that can be distinguished from other conditions using a combination of clinical, histologic, and immunophenotypic findings. Epstein-Barr virus may play a role in the pathogenesis of splenic IMT, and there may be an association of splenic IMT with concomitant disease or malignancy. Most splenic IMTs have an excellent long-term prognosis.

Background: The t(11;14)(q13;q32) translocation present in the majority of mantle cell lymphomas (MCLs) places the cyclin D1 gene under the control of immunoglobulin transcriptional regulatory elements, causing overexpression of cyclin D1. Quantification of cyclin D1 expression can distinguish MCL from other lymphomas. Methods: A quantitative real-time reverse transcription (RT)-PCR assay was developed for cyclin D1 mRNA suitable for use with RNA extracted from fresh and formalin-fixed, paraffin-embedded tissues. Specimens were amplified in an Applied Biosystems Model 7700 Sequence Detection System in reactions containing primers and probes for cyclin D1 and a control gene, β2-microglobulin. Relative expression of the two genes was standardized against a control MCL cell line, [M02058.][1] Results: The range of cyclin D1 expression among 20 MCLs was substantially higher than that in other lymphomas and reactive lymph nodes. By choosing an optimal cutoff point for assessing overexpression, the sensitivity and specificity of the assay for the diagnosis of MCL in lymph node specimens both approached 100%: Overexpression was detected in 20 of 20 MCLs, but in none of 21 non-mantle-cell lymphomas or 10 reactive lymph nodes. Conclusions: Quantitative real-time RT-PCR for cyclin D1 overexpression provides a rapid diagnostic test with clinical utility in the diagnosis of MCL. [1]: /lookup/external-ref?link_type=GEN&access_num=M02058.&atom=%2Fclinchem%2F47%2F2%2F195.atom

Interfollicular small lymphocytic lymphoma (I-SLL) has not been well characterized and its relationship to small lymphocytic lymphoma (SLL) or chronic lymphocytic leukemia (CLL) is uncertain. Moreover, two different proliferation center growth patterns have been described with respect to reactive germinal centers. In this study, we evaluate the histological and immunophenotypic features of 13 cases of I-SLL and immunoglobulin heavy chain variable (VH) gene sequences from 10 cases. Immunophenotypic analyses indicate that cases showing either growth pattern have the same CD5-positive B cell phenotype typical of SLL or CLL. Sequence analysis revealed the use of VH, D, and J gene segments often found in CLL, although there may be more frequent use of J6. Similar to recent studies of CLL, there were approximately equal numbers of cases with either mutated or unmutated VH genes without evidence of ongoing mutation, consistent with I-SLL having either a naïve or memory B cell origin. Interestingly, the mutational status of the I-SLL VH genes seemed to correlate with the two different histological growth patterns. These studies support the proposal that I-SLL represents SLL/CLL and suggest the recently proposed two types of CLL originating from either memory or naïve B cells may have different histological patterns of growth in lymph nodes that show architectural preservation.

Context.—CD10 was originally reported in non–T-cell lymphoblastic lymphomas/leukemias. It has since been identified, however, in a minority of cases of T-lympho-blastic lymphoma/leukemia and other hematopoietic and nonhematopoietic entities. The usual method for the detection of CD10 previously required fresh tissue. A new antibody for CD10 (56C6) in paraffin embedded tissue sections, however, has recently become available. Objective.—To study the expression of CD10 in paraffin sections of T-lymphoblastic lymphoma/leukemia using monoclonal antibody 56C6. Design.—Twenty-four cases of T-lymphoblastic lymphoma/leukemia in various anatomic sites were studied. Immunohistochemical analysis with CD10 and a panel of other hematolymphoid antibodies was performed in all 24 cases. Gene rearrangement studies for the T-cell receptor by the polymerase chain reaction were performed in 18 of 24 cases. Results.—All cases were positive with at least 2 T-cell markers. In 15 (63%) of 24 cases CD10 was positive. T-cell receptor gene rearrangement was detected in 10 of 18 cases. Conclusions.—Immunodetection of CD10 in T-lympho-blastic lymphoma/leukemia using monoclonal antibody 56C6 is common. This finding is useful in the evaluation of T-cell neoplasms.

Inhibitors of apoptosis may regulate tissue differentiation and promote cell survival in neoplasia. A new apoptosis inhibitor of the bcl-2 gene family, bcl-X(L), was recently found in some types human neoplasia but not in normal tissue. We investigated bcl-X(L) expression in 419 cases of normal and neoplastic lymphoid lesions using immunohistochemistry with the monoclonal antibody bcl-X(L) (YTH-2H12). Ninety-four percent (141/150) of classic Hodgkin's disease (HD) were positive for bcl-X(L) with strong intensity in most Reed-Sternberg (RS) cells. Forty-eight percent (38/80) of nodular lymphocyte predominance (LPHD) were positive. In the non-Hodgkin's lymphomas (NHL), bcl-X(L) was expressed in a low percentage of cases (< 20%), with the exception of follicle center lymphoma, grade III/III (78%). All reactive hyperplastic lesions were negative for bcl-X(L). RS cells, which expressed bcl-X(L), were not labeled by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL). We found RS cells expressing bcl-X(L) were absent of DNA fragmentation (apoptosis). Our data provide evidence that bcl-X(L) is abnormally expressed in the RS cells of HD and some types of NHL raising speculation that inhibition of apoptosis may be important in the pathogenesis of lymphoma, specifically HD. In addition, the previously reported correlation between bcl-X(L) and Epstein-Barr virus expression in HD was not supported by this study.

Background : Clonal rearrangement of genes encoding the immunoglobulins (Ig) and T-cell antigen receptors (TCR) are considered to be useful markers for the diagnosis of lymphoma and for determining the clonal origins of B- and T-cell populations in lymphoid neoplasms. Methods and Results : Polymerase chain reaction-based clonality assays for TCR γ , TCRβ, and immunoglobulin (Ig) heavy chain (IgH) gene rearrangements were evaluated for diagnostic sensitivity and specificity in 569 formalin-fixed, paraffin-embedded (FFPE) tissues. Combined TCRβ and TCRγ assays enhanced the routine detection of TCR clonality to 90% of all peripheral T-cell lymphoma (PTCL) cases. IgH clonality was detected in 59% of 241 peripheral T-cell lymphoma (BCL) cases and 6% of 169 PTCL cases. Of 452 lymphomas, 5% could not be classified phenotypically as B or T lineage after immunohistochemical and clonality studies. Of all BCL cases analyzed, 24% had detectable TCRβ and/or TCR γ clonality. Of these BCL with biclonal results, 47% were extranodal lymphomas from skin and various tissues. Conclusions : Clonality assays were useful for distinguishing reactive or benign lymph nodes from neoplastic lymphoid infiltrates in most cases. The inclusion of TCRβ and TCR γ assays in the assessment of lymphomas results in a significant increase in the sensitivity of clonality detection, but is of limited utility in assessing the T- or B-cell phenotype of the tumor.

Small lymphocytic lymphoma (SLL) and mantle cell lymphoma (MCL) are small B-cell lymphomas that share many morphological and immunophenotypic features, both expressing the T-cell antigen CD5. Because of this, there is speculation that these two lymphomas may have a common origin, both arising from the mantle zone of the lymph node. CD44 (HCAM), a glycoprotein "homing receptor," has been reported as a marker of small B-cell lymphomas for determining behavior as well as the nodal cell of origin. Intensity of CD44 expression also has been correlated with dissemination of lymphoma. We studied 50 cases with classic features of SLL (30 cases) or MCL (20 cases). Immunophenotypic analysis was performed on paraffin sections. All cases of MCL and SLL were CD20 positive; CD5 was expressed in 19 of 25 (76%) SLL and 11 of 15 (73%) MCL. Cyclin D1 was expressed in 11 of 17 (76%) MCL and no cases of SLL. CD43 coexpression was seen in 27 of 29 (93%) SLL and 17 of 19 (89%) MCL. CD23 was positive in 25 of 28 (89%) SLL and 2 of 20 (10%) MCL. Bcl-2 was positive in 18 of 22 (82%) SLL and 15 of 16 (94%) MCL. CD44 was positive with moderate to strong intensity in 11 of 30 SLL and 15 of 20 MCL. Peripheral blood involvement did not correlate with CD44 immunoreactivity. MCL tended to have intense CD44 immunoreactivity, whereas SLL tended to show weaker CD44 intensity. This trend in the intensity of CD44 in MCL suggests that CD44 may be helpful in distinguishing SLL from MCL and possibly elucidating the origin of these CD5-positive B-cell neoplasms.

We present three cases of blastic mantle cell lymphoma with an unusual initial manifestation in Waldeyer's ring with methods for differentiating it from other blastic neoplasms of the head and neck. All cases presented with a feeling of fullness inthe area of the mass. Morphologically, the tumours were blastic with a high mitotic rate (three to nine per high power field). All were B-cell phenotype with coexpression of CD43. In all cases cyclin Dl and bcl-2 were positive and CD23 negative. Blastic mantle cell lymphoma occurring in Waldeyer's tonsillar ring may be mistaken for other high grade haematopoietic neoplasms. Immunohistochemistry and awareness of this type of lymphoma arehelpful in differentiating it from other neoplasms.

We describe the clinical, histologic, immunophenotypic, and genotypic features of five cases of histologically discordant lymphomas with B-cell and T-cell components. Three patients presented with B-cell lymphoma; T-cell lymphoma subsequently developed. One patient presented with T-cell lymphoma; B-cell lymphoma subsequently developed. One patient presented with synchronous B-cell and T-cell lymphomas. There were three men and two women. The median age at the initial diagnosis of lymphoma was 66 years. The mean interval between the development of the two lymphomas was 83 months. All patients died of disease. The mean survival was 96 months after the initial diagnosis of lymphoma and 14 months after the diagnosis of the histologically discordant lymphoma. Epstein-Barr virus was found in two cases--the B-cell lymphoma in the patient who presented with synchronous lymphomas, and the subsequent T-cell lymphoma in one of the patients who presented with B-cell lymphoma. Based on the results of immunophenotypic and genotypic analyses, these cases likely represent the occurrence of two distinct lymphoid neoplasms rather than histologic progression of the same neoplastic clone. Furthermore, a subset of these cases are Epstein-Barr virus-associated.

[Figure][1] A previously healthy 62-year-old woman was taken to surgery for partial thyroidectomy for a suspected colloid nodule. A small level VI lymph node was found incidentally during surgery. The lymph node was 0.5 cm in greatest dimension. The architecture was effaced by a nodular

The coexpression of CD5 and CD10 has previously been reported in cases of intermediate- and high-grade lymphomas and in precursor B cells in normal or regenerating bone marrow. We report 3 cases of low-grade B-cell lymphoma that were found to coexpress CD5 and CD10 at the time of initial diagnosis. The first case was classified as small lymphocytic lymphoma; the second as follicle center lymphoma, follicular grade 1; and the third as small B-cell lymphoma otherwise not specified. Currently, the clinical implication of the coexpression of CD5 and CD10 is not known. We describe this finding to highlight the difficulty that may be encountered in classifying lymphomas in cases where this coexpression is present.

Purpose: This study aimed to identify and evaluate molecular targets for the development of a novel combination chemotherapy to treat refractory and recurrent diffuse large B-cell lymphoma (DLBCL). Experimental Design: Lymphoma samples from 38 cases of primary and recurrent DLBCL were analyzed using real-time quantitative PCR of the RPS6KB1 and CDC2 genes, and immunohistochemistry for their gene products p70S6K/p85S6K and cdc2/cdk1. The Farage, Karpas422, Pfeiffer, and Toledo DLBCL cell lines were subsequently treated with rapamycin and UCN-01 alone or in combination. Cell proliferation, apoptosis, and cell cycle progression were analyzed after the drug treatment. In addition, the levels of several key protein kinases involved in the phosphoinositide 3′-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) pathway, apoptosis, and cell cycle progression were analyzed in the presence and absence of the drugs. Results: Amplification of the RPS6KB1 and CDC2 genes was found in both primary and recurrent DLBCL. Moreover, the vast majority of these lymphomas (∼94%) were strongly positive for phospho-p70S6K and cdc2/cdk1 proteins. The combination of rapamycin and UCN-01 synergistically inhibited the DLBCL cell proliferation by inducing G1 arrest as well as apoptosis by suppressing the phosphorylation of p70S6K/p85S6K and CDC2 expression. Conclusion: RPS6KB1 and CDC2 overexpression is common in DLBCL. Simultaneously targeting the RPS6KB1 and CDC2 products phospho-p70S6K/p85S6K and cdc2/cdk1 is very effective in inhibiting DLBCL proliferation and overcoming drug resistance. This work suggests that multilevel inhibition of the PI3K/Akt/mTOR pathway and double-block of cell cycle progression are effective strategies for DLBCL therapy.

Gastric extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue (MZL-MALT) is speculated to be immune mediated and is notable for responding to treatment by Helicobacter pylori eradication. However, the gastric MZL-MALT with t(11;18)(q21;q21) has been shown to be resistant to treatment by H. pylori eradication. We studied the molecular, immunohistochemical, and histological aspects of 48 cases of gastric MZL-MALT and used a reverse transcription real-time PCR assay to assess the presence of a t(11;18)(q21;q21) in formalin-fixed, paraffin-embedded tissue. Florescence in situ hybridization for t(11:18)(q21;q21) was used to confirm the real-time PCR results. Three distinct morphological subtypes were recognized: monocytoid, small lymphocytic, and plasmacytoid. Morphology, immunophenotype, and immunoglobulin heavy chain (IgH) gene rearrangement were correlated with the results of the t(11:18)(q21;q21) assay. Of the 48 analyzed cases, 15 (31%) were positive for t(11;18)(q21;q21) and 33 (69%) were monoclonal for IgH gene rearrangement. Of the 15, 13 (87%) cases with t(11;18)(q21;q21) translocation showed IgH gene rearrangement by PCR. Of the 33 t(11;18)(q21;q21)-negative cases tested, 20 cases (61%) showed IgH gene rearrangement. The 15 t(11;18)(q21;q21) translocation-positive cases had either monocytoid (12 of 15) or small lymphocytic morphology (3 of 15). Aberrant expression of CD43 was observed in 8 of 15 (53%) t(11;18)(q21;q21)-positive cases and 21 of 31 (68%) t(11;18)(q21;q21)-negative cases. Our data show that t(11;18)(q21;q21)-positive MZL-MALTs frequently show monocytoid morphology, less often small lymphocytic morphology, and not purely plasmacytoid morphology. Identification of a t(11;18)(q21;q21) by reverse transcription real-time PCR is highly specific for MZL-MALT and helps in the diagnosis of MZL-MALT. Studying the correlation between this translocation and morphological features may increase our understanding of the role of this translocation in the pathogenesis and the clinical behavior of gastric MZL-MALT.

Histiocytic sarcoma (HS) is a rare but controversial hematopoietic neoplasm. In the past, malignancies have been misclassified as histiocytic tumors due to overlapping histologic features and inadequate phenotypic data. CD163, a recently characterized hemoglobin scavenger receptor, appears to be a 'specific' marker of histiocytic lineage and a promising diagnostic tool for evaluating histiocytic neoplasms. Five cases of HS were studied to further elucidate the clinicopathologic features of these rare tumors and to demonstrate the diagnostic utility of CD163. Criteria for diagnosis included histologic and immunohistochemical evidence of histiocytic differentiation, CD45 positivity, and exclusion of lymphoid, epithelial, melanocytic and dendritic cell phenotype. Sites of disease included the colon (two cases), palate, inguinal lymph node, and testis. The clinical course was aggressive in 4/5 patients (survival=2-15 months). One patient with localized disease of the palate, survived 17 years after diagnosis. All patients with poor survival had tumorsor =3.5 cm. Histologically, all cases showed diffuse architecture with large, discohesive polygonal cells. Spindling of cells was focally noted. Hemophagocytosis was identified in 3/5 cases. A prominent inflammatory background was present in 4/5 tumors. All cases were immunoreactive for CD45, CD163, CD68, and lysozyme. S-100 was focally positive in 4/5 cases. Antibodies for melanocytic, epithelial, lymphoid, and dendritic cell markers were negative. Molecular studies showed monoclonal IgH gene rearrangements in three cases. Our findings suggest that HS is an uncommon neoplasm frequently extranodal in presentation and aggressive in behavior, with rare exceptions. Stage of disease and possibly tumor size are significant prognostic indicators. Molecular studies remain controversial in the diagnosis. The morphologic and phenotypic features are relatively uniform; however, the diagnosis requires exclusion of more common neoplasms by extensive immunophenotypic studies. CD163 appears to be a specific histiocytic marker and is important in establishing the diagnosis of HS.

Epstein-Barr virus (EBV) has been strongly linked with African Burkitt’s lymphoma and nasopharyngeal carcinoma (NPC) and has recently been associated with breast cancer (1). Nine studies of EBV in breast cancer with the use of different methods (1–9) present conflicting results. In the current study, microdissected ductal breast carcinomas were tested for EBV. Only one of 115 cases was positive. This finding stands in contrast to results of studies of ductal carcinoma showing up to 48% EBV positivity by polymerase chain reaction (PCR). Bonnet et al. (1) found 51 of 100 breast cancers of all types to be PCR positive for EBV. EBV positivity was also shown by Southern blot analysis and immunostain in a subset of cases, but in situ hybridization (ISH) for EBER was negative. A similar pattern has been observed previously (2). Our study included 115 breast cancers, chosen for having microdissectable normal, as well as intraductal, invasive, or metastatic tumor components. Intraductal carcinoma specimens were obtained from 84 patients, invasive tumor in 106 patients, metastases in 50 patients, and recurrences in six. Normal lymph node or other normal tissue was also collected, for a total of 361 samples (10). Institutional approval was received for the conduct of the study. Samples were analyzed by 5!nuclease PCR for the EBNA1 gene. Primers were CTGGAAATGGCCTAGGAGAGAA (nucleotides 637–658; GenBank S45894) and TCCATGGTTATCACCCCCTC (nucleotides 709– 728), and the probe was FAM-AGACACATCTGGACCAGAAGGCTCCGTAMRA (nucleotides 662–687). PCR was performed in 50 !L with 200-nm primers and a 100-nm probe. Cycling conditions were as follows: 50 °C for 2 minutes and 95 °C for 10 minutes, followed by 50 cycles at 95 °C for 15 seconds and 60 °C for 1 minute. The assay detected a single viral copy when titrated against dilutions of a quantified EBV DNA control (Advanced Biotechnologies, Columbia, MD). DNA amplifiability was assessed with the use of the HER2 gene as a control. Primers were ATGCAGATTGCCAAGGTATGC (nucleotides 977–997; GenBank M12036) and GGAAGCACCCATGTAGACCTTCT (nucleotides 1098–1120), and the probe was VIC-CCGGAGCAAACC C C T A T G T C C A C A A T A M R A (nucleotides 1021–1045). A kit was used for EBER ISH (Biogenex, San Ramon CA). Immunostaining for LMP1 was performed with monoclonal antibody clones CS1–4 (DAKO A/S, Glostrup, Denmark). Amplifiable DNA was obtained from 278 (77%) of 361 samples. Of these, only six samples were positive for EBNA1. EBV-positive blocks were analyzed by EBER ISH and LMP1 immunohistochemistry. Three were lymph nodes—two from cases without metastases and one from a case with metastatic carcinoma. All of these contained occasional EBERand LMP1-positive lymphocytes; the metastatic tumor itself was negative for both EBER and LMP1. The other three positive specimens were from one patient. In this case, both EBER and LMP1 staining demonstrated that EBV was present in 50%–75% of normal ductal epithelium, as well as in the intraductal and invasive carcinoma components. The expected nuclear location of EBERs was observed (11,12). LMP1 staining was predominantly nuclear, in contrast to positive controls showing typical membrane staining (13,14). The predominant human EBV is the B95.8 strain. Variant strains may be responsible for the epithelial tropism of NPC (15). Theoretically, variants might escape PCR detection, but a study of NPC patients with the use of primers in the variable region of EBNA1 still detected EBV in all 50 cases (16). The sensitivity of our assay was confirmed in an ethnically diverse series of NPC patients. For 13 cases with amplifiable DNA, nine (69%) were positive for EBV. Therefore, it is unlikely that our negative results were due to undetectable EBV variants. Most investigations have used fixed tissue; however, two studies (1,3) used fresh frozen tissue and detected EBV by PCR plus either ISH or immunostain in 25%–48% of ductal carcinomas. Luqmani et al. (2) performed PCR on 48 frozen and 12 fixed samples and found them to be positive in 39% and 33%, respectively. This modest gain in sensitivity in fresh tissue is insufficient to explain the discrepancies in the literature. The PCR target is another potential source of variation. Most studies yielding positive results used targets in the long internal repeat (IR1), where PCR is 10 times more sensitive than for the EBER gene (1). While incomplete reporting and differences in methodology or diagnoses prevent strict meta-analysis, aggregate statistics for EBV detection were compiled. For all studies, PCR detected EBV in 23.8% of all patients and histologies. Given the sensitivity of PCR and the persistence of latent lymphocytic infection, this result is unsurprising. Stable, latently infected lymphocytes contain multiple EBV copies (17), and the overall positivity rate in breast cancer is no higher than that often observed in normal tissues (18–23). Microdissection is a unique advantage of this study, thereby reducing benign lymphocyte contamination. The purity of these microdissections from stromal contamination has been demonstrated by loss-of-heterozygosity analyses (10). The other published investigations (1–9) used lysates from whole tumors. One such study (5) demonstrated by ISH that EBV PCR positivity in breast cancer was due to latently infected lymphocytes.

Primary non-Hodgkin's lymphoma of the breast is uncommon. Most primary breast lymphomas are of B-cell phenotype, with only rare cases showing a T-cell phenotype. In this study, we report the clinicopathologic features of four cases of T-cell lymphoma in the breast. The patients all were female with a mean age of 48 years (range, 13 to 77 years). All cases showed immunoreactivity in paraffin-embedded tissue for T-cell markers CD3, CD45RO, and CD43. beta F1 was positive in three of four cases. The four cases were further subclassified as anaplastic large cell lymphoma (CD30 positive) of T-immunophenotype; natural killer/T-cell lymphoma; peripheral T-cell (CD4 positive), large cell type; and peripheral T-cell (CD8 positive, T-cell intracellular antigen positive), medium cell type. Three of the four cases were monoclonal for T-cell receptor beta and/or T-cell receptor gamma. The one case of natural killer/T-cell lymphoma was negative for monoclonality with both T-cell receptor beta and gamma by molecular diagnostic studies. In all cases, IgH was negative. Follow-up was obtained in three cases. Two patients died within less than 1 year after the diagnosis. The third patient died within 18 months of the diagnosis. Our results suggest an aggressive clinical course for T-cell lymphomas that present in the breast.

Mantle-cell lymphomas are associated with a characteristic chromosomal translocation, t(11;14)(q13;q32). This translocation involves rearrangement of the bcl-1 proto-oncogene from chromosome 11 to the immunoglobulin heavy chain gene on chromosome 14, resulting in an overexpression of cyclin D1 mRNA (also known as bcl-1 and PRAD1). In the current study performed on paraffin-embedded tissue, cyclin D1 mRNA could be detected in 23 of 24 mantle-cell lymphomas by reverse transcription polymerase chain reaction (RT-PCR) whereas only 9 of 24 demonstrated a t(11;14) by PCR. However, we also found that cyclin D1 mRNA could be detected in the majority (11 of 17, 65%) of non-mantle-cell lymphomas and in a minority of atypical lymphoid hyperplasias (3 of 7, 43%). Cyclin D1 mRNA expression was not observed in floridly reactive lymph nodes (0 of 9) or in unstimulated lymph nodes (0 of 20), suggesting that it is a sensitive adjunct marker for malignant lymphoproliferative processes, but not specific for mantle-cell lymphoma. A semiquantitative RT-PCR assay was developed that compared the ratio of cyclin D1 to the constitutively expressed gene beta2-microglobulin. Using this assay on a limited number of our specimens, cyclin D1 overexpression in mantle-cell lymphoma could be reliably distinguished from its expression in other non-Hodgkin's lymphomas. This assay for cyclin D1 expression, designed for formalin-fixed, paraffin-embedded tissue, was a very sensitive and specific marker for mantle-cell lymphoma.