Search

Neonatal intensive care unit (NICU), particularly in treating developmental and epileptic encephalopathy (DEE) and metabolic epilepsy (ME), requires a deep understanding of their complex etiologies and treatment responses. After excluding treatable cases such as infectious or autoimmune encephalitis, our focus shifted to a more challenging subgroup of 59 patients for in-depth genetic analysis using exome sequencing (ES). The ES analysis identified 40 genetic abnormalities, significantly including de novo variants. Notably, we found structural variation as duplications in regions 2q24.3, including SCN1A and SCN2A were observed in 7 cases. These genetic variants, impacting ion channels, glucose transport, transcription regulation, and kinases, play a crucial role in determining medication efficacy. More than one-third (34.2%) of patients with DEE had an unfavorable response to anti-seizure medications (ASMs) in the chronic phase. However, since the ketogenic supplementary diet showed a positive effect, more than three-quarters (80%) of these drug-resistant patients improved during a 3-month follow-up. In contrast, the ME had a lower adverse reaction rate of 9.1% (2/22) to specialized medications, yet there were 5 fatalities and 10 cases with unidentified genetic etiologies. This study suggests the potential of categorizing drug-resistant variants and that a ketogenic diet could be beneficial in managing DEE and ME. It also opens new perspectives on the mechanisms of the ketogenic diet on the discovered genetic variants., (© 2024. The Author(s).)

Variants in voltage-gated sodium channel (VGSC) genes are implicated in seizures, epilepsy, and neurodevelopmental disorders, constituting a significant aspect of hereditary epilepsy in the Chinese population. Through retrospective analysis utilizing next-generation sequencing (NGS), we examined the genotypes and phenotypes of VGSC-related epilepsy cases from a cohort of 691 epilepsy subjects. Our findings revealed that 5.1% of subjects harbored VGSC variants, specifically 22 with SCN1A, 9 with SCN2A, 1 with SCN8A, and 3 with SCN1B variants; no SCN3A variants were detected. Among these, 14 variants were previously reported, while 21 were newly identified. SCN1A variant carriers predominantly presented with Dravet Syndrome (DS) and Genetic Epilepsy with Febrile Seizures Plus (GEFS + ), featuring a heightened sensitivity to fever-induced seizures. Statistically significant disparities emerged between the SCN1A-DS and SCN1A-GEFS+ groups concerning seizure onset and genetic diagnosis age, incidence of status epilepticus, mental retardation, anti-seizure medication (ASM) responsiveness, and familial history. Notably, subjects with SCN1A variants affecting the protein's pore region experienced more frequent cluster seizures. All SCN2A variants were of de novo origin, and 88.9% of individuals with SCN2A variations exhibited cluster seizures. This research reveals a significant association between variations in VGSC-related genes and the clinical phenotype diversity of epilepsy subjects in China, emphasizing the pivotal role of NGS screening in establishing accurate disease diagnoses and guiding the selection of ASM., (© 2024. The Author(s), under exclusive licence to The Japan Society of Human Genetics.)

Abstract: The SCN2A gene encodes a subunit that forms part of voltage-gated sodium channels in the brain. Gain-of-function mutations are associated with epilepsy as well as numerous movement/motor abnormalities. Loss-of-function mutations may also cause epilepsy in addition to a variety of neurodevelopmental anomalies, including autism and intellectual disability. The occurrence of catatonia has also been described in 1 previous report that involved a 4-year-old boy. We describe a 20-year-old intellectually disabled female patient who developed recurrent catatonic symptoms in her teenage years that remitted with electroconvulsive therapy. This is only the second report of catatonia occurring in relation to an SCN2A mutation and the first involving a female. Moreover, this case is unique given our patient's later age of symptom onset and given that her symptoms responded well to electroconvulsive therapy., Competing Interests: Conflicts of interest: MC has no conflicts of interest directly relevant to this paper. He is a co-investigator for a RCT in generalized anxiety disorder sponsored by Sunovion and Sumitomo, and a study physician for a RCT in major depressive disorder partially funded by Otsuka (part of CAN-BIND). He has not received any money from these companies for this work. TP has no conflicts of interest to disclose., (Copyright © 2024 Wolters Kluwer Health, Inc. All rights reserved.)

Autism spectrum disorder (ASD) is a major neurodevelopmental disorder affecting 1 in 36 children in the United States. While neurons have been the focus of understanding ASD, an altered neuro-immune response in the brain may be closely associated with ASD, and a neuro-immune interaction could play a role in the disease progression. As the resident immune cells of the brain, microglia regulate brain development and homeostasis via core functions including phagocytosis of synapses. While ASD has been traditionally considered a polygenic disorder, recent large-scale human genetic studies have identified SCN2A deficiency as a leading monogenic cause of ASD and intellectual disability. We generated a Scn2a-deficient mouse model, which displays major behavioral and neuronal phenotypes. However, the role of microglia in this disease model is unknown. Here, we reported that Scn2a-deficient mice have impaired learning and memory, accompanied by reduced synaptic transmission and lower spine density in neurons of the hippocampus. Microglia in Scn2a-deficient mice are partially activated, exerting excessive phagocytic pruning of post-synapses related to the complement C3 cascades during selective developmental stages. The ablation of microglia using PLX3397 partially restores synaptic transmission and spine density. To extend our findings from rodents to human cells, we established a microglia-incorporated human cerebral organoid model carrying an SCN2A protein-truncating mutation identified in children with ASD. We found that human microglia display increased elimination of post-synapse in cerebral organoids carrying the SCN2A mutation. Our study establishes a key role of microglia in multi-species autism-associated models of SCN2A deficiency from mouse to human cells., (© 2024. The Author(s), under exclusive licence to Springer Nature Limited.)

SCN2A-related disorders secondary to altered function in the voltage-gated sodium channel Nav1.2 are rare, with clinically heterogeneous expressions that include epilepsy, autism and multiple severe to profound impairments and other conditions. To advance understanding of the clinical phenotypes and their relationship to channel function, 81 patients (36 female, 44%, median age 5.4 years) with 69 unique SCN2A variants were systematically phenotyped and their Nav1.2 channel function systematically assessed. Participants were recruited through the FamileSCN2A Foundation. Primary phenotype (epilepsy of neonatal onset, n = 27; infant onset, n = 18; and later onset n = 24; and autism without seizures, n = 12) was strongly correlated with a non-seizure severity index (P = 0.002), which was based on presence of severe impairments in gross motor, fine motor, communication abilities, gastrostomy tube dependence and diagnosis of cortical visual impairment and scoliosis. Non-seizure severity was greatest in the neonatal-onset group and least in the autism group (P = 0.002). Children with the lowest severity indices were still severely impaired, as reflected by an average Vineland Adaptive Behavior composite score of 49.5 (>3 standard deviations below the norm-referenced mean of the test). Epileptic spasms were significantly more common in infant-onset (67%) than in neonatal (22%) or later-onset (29%) epilepsy (P = 0.007). Primary phenotype was also strongly correlated with variant function (P < 0.0001); gain-of-function and mixed function variants predominated in neonatal-onset epilepsy, shifting to moderate loss of function in infant-onset epilepsy and to severe and complete loss of function in later-onset epilepsy and autism groups. Exploratory cluster analysis identified five groups, representing: (i) primarily later-onset epilepsy with moderate loss-of-function variants and low severity indices; (ii) mostly infant-onset epilepsy with moderate loss-of-function variants but higher severity indices; and (iii) late-onset and autism only, with the lowest severity indices (mostly zero) and severe/complete loss-of-function variants. Two exclusively neonatal clusters were distinguished from each other largely on non-seizure severity scores and secondarily on variant function. The relationship between primary phenotype and variant function emphasizes the role of developmental factors in the differential clinical expression of SCN2A variants based on their effects on Nav1.2 channel function. The non-seizure severity of SCN2A disorders depends on a combination of the age at seizure onset (primary phenotype) and variant function. As precision therapies for SCN2A-related disorders advance towards clinical trials, knowledge of the relationship between variant function and clinical disease expression will be valuable for identifying appropriate patients for these trials and in selecting efficient clinical outcomes., (© The Author(s) 2024. Published by Oxford University Press on behalf of the Guarantors of Brain.)

Background and Purpose: Sodium channel blockers (SCBs) have traditionally been utilized as anti-seizure medications by primarily targeting the inactivation process. In a drug discovery project aiming at finding potential anticonvulsants, we have identified arbidol, originally an antiviral drug, as a potent SCB. In order to evaluate its anticonvulsant potential, we have thoroughly examined its biophysical properties as well as its effects on animal seizure models., Experimental Approach: Patch clamp recording was used to investigate the electrophysiological properties of arbidol, as well as the binding and unbinding kinetics of arbidol, carbamazepine and lacosamide. Furthermore, we evaluated the anticonvulsant effects of arbidol using three different seizure models in male mice., Key Results: Arbidol effectively suppressed neuronal epileptiform activity by blocking sodium channels. Arbidol demonstrated a distinct mode of action by interacting with both the fast and slow inactivation of Na v 1.2 channels compared with carbamazepine and lacosamide. A kinetic study suggested that the binding and unbinding rates might be associated with the specific characteristics of these three drugs. Arbidol targeted the classical binding site of local anaesthetics, effectively inhibited the gain-of-function effects of Na v 1.2 epileptic mutations and exhibited varying degrees of anticonvulsant effects in the maximal electroshock model and subcutaneous pentylenetetrazol model but had no effect in the pilocarpine-induced status epilepticus model., Conclusions and Implications: Arbidol shows promising potential as an anticonvulsant agent, providing a unique mode of action that sets it apart from existing SCBs., (© 2024 British Pharmacological Society.)

The signaling complex around voltage-gated sodium (Nav) channels includes accessory proteins and kinases crucial for regulating neuronal firing. Previous studies showed that one such kinase, WEE1-critical to the cell cycle-selectively modulates Nav1.2 channel activity through the accessory protein fibroblast growth factor 14 (FGF14). Here, we tested whether WEE1 exhibits crosstalk with the AKT/GSK3 kinase pathway for coordinated regulation of FGF14/Nav1.2 channel complex assembly and function. Using the in-cell split luciferase complementation assay (LCA), we found that the WEE1 inhibitor II and GSK3 inhibitor XIII reduce the FGF14/Nav1.2 complex formation, while the AKT inhibitor triciribine increases it. However, combining WEE1 inhibitor II with either one of the other two inhibitors abolished its effect on the FGF14/Nav1.2 complex formation. Whole-cell voltage-clamp recordings of sodium currents (I Na ) in HEK293 cells co-expressing Nav1.2 channels and FGF14-GFP showed that WEE1 inhibitor II significantly suppresses peak I Na density, both alone and in the presence of triciribine or GSK3 inhibitor XIII, despite the latter inhibitor's opposite effects on I Na . Additionally, WEE1 inhibitor II slowed the tau of fast inactivation and caused depolarizing shifts in the voltage dependence of activation and inactivation. These phenotypes either prevailed or were additive when combined with triciribine but were outcompeted when both WEE1 inhibitor II and GSK3 inhibitor XIII were present. Concerted regulation by WEE1 inhibitor II, triciribine, and GSK3 inhibitor XIII was also observed in long-term inactivation and use dependency of Nav1.2 currents. Overall, these findings suggest a complex role for WEE1 kinase-in concert with the AKT/GSK3 pathway-in regulating the Nav1.2 channelosome.

SCN2A loss-of-function variants cause a range of neurodevelopmental disorders. Here, we present a protocol to induce severe Scn2a insufficiency in mice. We describe steps for intracerebroventricular (ICV) antisense oligonucleotide (ASO) injection that causes a selective downregulation of Scn2a and ASO-mediated mRNA degradation. We then detail procedures for qPCR and western blot protocol to measure Scn2a mRNA and protein. This protocol can be used as a mouse model for behavioral and in vivo two-photon Ca 2+ imaging., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Objective: Epilepsy patients exhibit considerable differences in their response to sodium valproate (VPA) therapy, a phenomenon that might be attributed to individual genetic variances. The role of genetic variations, specifically in sodium channels encoded by SCN1A and SCN2A genes, in influencing the effectiveness of VPA in treating epilepsy is still debated. This research focuses on examining the impact of these genetic polymorphisms on the efficacy of VPA therapy among pediatric epilepsy patients in China., Methods: Five single nucleotide polymorphisms (SNPs), including SCN1A (rs10188577, rs2298771, rs3812718) and SCN2A (rs2304016, rs17183814), were genotyped in 233 epilepsy patients undergoing VPA therapy. The associations between genotypes and the antiepileptic effects of VPA were assessed, with 128 patients categorized as VPA responders and 105 as VPA non-responders., Results: In the context of VPA monotherapy, SCN1A rs2298771 and SCN2A rs17183814 were found to be significantly associated with VPA response (P< 0.05)., Conclusion: Our study suggests the findings of this investigation indicate that the polymorphisms SCN1A rs2298771 and SCN2A rs17183814 could potentially act as predictive biomarkers for the responsiveness to VPA among Chinese epilepsy patients., Competing Interests: The authors have declared that no competing interests exist., (Copyright: © 2024 Bao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.)

We aimed to identify unique constellations of sensory phenotypes for genetic etiologies associated with diagnoses of autism spectrum disorder (ASD) and intellectual disability (ID). Caregivers reported on sensory behaviors via the Sensory Profile for 290 participants (younger than 25 years of age) with ASD and/or ID diagnoses, of which ~ 70% have a known pathogenic genetic etiology. Caregivers endorsed poor registration (i.e., high sensory threshold, passive behaviors) for all genetic subgroups relative to an "idiopathic" comparison group with an ASD diagnosis and without a known genetic etiology. Genetic profiles indicated prominent sensory seeking in ADNP, CHD8, and DYRK1A, prominent sensory sensitivities in SCN2A, and fewer sensation avoidance behaviors in GRIN2B (relative to the idiopathic ASD comparison group)., (© 2023. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Children diagnosed with autism spectrum disorder (ASD) commonly present with sensory hypersensitivity or abnormally strong reactions to sensory stimuli. Such hypersensitivity can be overwhelming, causing high levels of distress that contribute markedly to the negative aspects of the disorder. Here, we identify a mechanism that underlies hypersensitivity in a sensorimotor reflex found to be altered in humans and in mice with loss of function in the ASD risk-factor gene SCN2A. The cerebellum-dependent vestibulo-ocular reflex (VOR), which helps maintain one's gaze during movement, was hypersensitized due to deficits in cerebellar synaptic plasticity. Heterozygous loss of SCN2A-encoded Na V 1.2 sodium channels in granule cells impaired high-frequency transmission to Purkinje cells and long-term potentiation, a form of synaptic plasticity important for modulating VOR gain. VOR plasticity could be rescued in mice via a CRISPR-activator approach that increases Scn2a expression, demonstrating that evaluation of a simple reflex can be used to assess and quantify successful therapeutic intervention., Competing Interests: Declaration of interests N.A. is the cofounder and on the scientific advisory board of Regel Tx. K.J.B. is on the scientific advisory board of Regel Tx. N.A. and K.J.B. receive funding from BioMarin Pharmaceutical Incorporated., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Dysfunction in sodium channels and their ankyrin scaffolding partners have both been implicated in neurodevelopmental disorders, including autism spectrum disorder (ASD). In particular, the genes SCN2A, which encodes the sodium channel Na V 1.2, and ANK2, which encodes ankyrin-B, have strong ASD association. Recent studies indicate that ASD-associated haploinsufficiency in Scn2a impairs dendritic excitability and synaptic function in neocortical pyramidal cells, but how Na V 1.2 is anchored within dendritic regions is unknown. Here, we show that ankyrin-B is essential for scaffolding Na V 1.2 to the dendritic membrane of mouse neocortical neurons and that haploinsufficiency of Ank2 phenocopies intrinsic dendritic excitability and synaptic deficits observed in Scn2a +/- conditions. These results establish a direct, convergent link between two major ASD risk genes and reinforce an emerging framework suggesting that neocortical pyramidal cell dendritic dysfunction can contribute to neurodevelopmental disorder pathophysiology., Competing Interests: Declaration of interests K.J.B. and S.J.S. receive research funding from BioMarin Pharmaceutical Inc. K.J.B. is on the SAB for Regel Tx and receives research support from Regel Tx., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Many developmental and epileptic encephalopathies (DEEs) result from variants in cation channel genes. Using mRNA transfection, we generated and characterised an induced pluripotent stem cell (iPSC) line from the fibroblasts of a male late-onset DEE patient carrying a heterozygous missense variant (E1211K) in Na v 1.2(SCN2A) protein. The iPSC line displays features characteristic of the human iPSCs, colony morphology and expression of pluripotency-associated marker genes, ability to produce derivatives of all three embryonic germ layers, and normal karyotype without SNP array-detectable abnormalities. We anticipate that this iPSC line will aid in the modelling and development of precision therapies for this debilitating condition., Competing Interests: Declaration of competing interest Steven Petrou is an equity holder of RogCon, Inc. and Praxis Precision Medicine, Inc., Cambridge, MA, USA. Orrin Devinsky has equity and/or compensation from the following companies: Hitch Biosciences, Tevard Biosciences, Regel Biosciences, Script Biosciences, Actio Biosciences, Empatica, SilverSpike, Ajna Biosciences, and California Cannabis Enterprises (CCE).  He has received consulting fees or equity options from Emotiv, Zogenix, Ultragenyx, and GeneMedicine. He holds patents for the use of cannabidiol in treating neurological disorders but these are owned by GW Pharmaceuticals and he has waived any financial interests. He holds other patents in molecular biology. He is the managing partner of the PhiFund Ventures. Kelley Dalby is an equity holder of RogCon, Inc. and Praxis Precision Medicines, Inc., Cambridge, MA, USA. Dmitry A. Ovchinnikov is a Lab Resource editor at the Stem Cell Research (Elsevier, B.V.). Other authors declare no relevant interests/relationships., (Copyright © 2024 The Authors. Published by Elsevier B.V. All rights reserved.)

SCN2A encodes Na V 1.2, an excitatory neuron voltage-gated sodium channel and a major monogenic cause of neurodevelopmental disorders, including developmental and epileptic encephalopathies (DEE) and autism. Clinical presentation and pharmocosensitivity vary with the nature of SCN2A variant dysfunction and can be divided into gain-of-function (GoF) cases with pre- or peri-natal seizures and loss-of-function (LoF) patients typically having infantile spasms after 6 months of age. We established and assessed patient induced pluripotent stem cell (iPSC) - derived neuronal models for two recurrent SCN2A DEE variants with GoF R1882Q and LoF R853Q associated with early- and late-onset DEE, respectively. Two male patient-derived iPSC isogenic pairs were differentiated using Neurogenin-2 overexpression yielding populations of cortical-like glutamatergic neurons. Functional properties were assessed using patch clamp and multielectrode array recordings and transcriptomic profiles obtained with total mRNA sequencing after 2-4 weeks in culture. At 3 weeks of differentiation, increased neuronal activity at cellular and network levels was observed for R1882Q iPSC-derived neurons. In contrast, R853Q neurons showed only subtle changes in excitability after 4 weeks and an overall reduced network activity after 7 weeks in vitro. Consistent with the reported efficacy in some GoF SCN2A patients, phenytoin (sodium channel blocker) reduced the excitability of neurons to the control levels in R1882Q neuronal cultures. Transcriptomic alterations in neurons were detected for each variant and convergent pathways suggested potential shared mechanisms underlying SCN2A DEE. In summary, patient iPSC-derived neuronal models of SCN2A GoF and LoF pathogenic variants causing DEE show specific functional and transcriptomic in vitro phenotypes., (Copyright © 2024 the authors.)

Alternating hemiplegia of childhood (AHC) is a rare neurodevelopment disorder that is typically characterized by debilitating episodic attacks of hemiplegia, seizures, and intellectual disability. Over 85% of individuals with AHC have a de novo missense variant in ATP1A3 encoding the catalytic α3 subunit of neuronal Na +/ K + ATPases. The remainder of the patients are genetically unexplained. Here, we used next-generation sequencing to search for the genetic cause of 26 ATP1A3-negative index patients with a clinical presentation of AHC or an AHC-like phenotype. Three patients had affected siblings. Using targeted sequencing of exonic, intronic, and flanking regions of ATP1A3 in 22 of the 26 index patients, we found no ultra-rare variants. Using exome sequencing, we identified the likely genetic diagnosis in 9 probands (35%) in five genes, including RHOBTB2 (n = 3), ATP1A2 (n = 3), ANK3 (n = 1), SCN2A (n = 1), and CHD2 (n = 1). In follow-up investigations, two additional ATP1A3-negative individuals were found to have rare missense SCN2A variants, including one de novo likely pathogenic variant and one likely pathogenic variant for which inheritance could not be determined. Functional evaluation of the variants identified in SCN2A and ATP1A2 supports the pathogenicity of the identified variants. Our data show that genetic variants in various neurodevelopmental genes, including SCN2A, lead to AHC or AHC-like presentation. Still, the majority of ATP1A3-negative AHC or AHC-like patients remain unexplained, suggesting that other mutational mechanisms may account for the phenotype or that cases may be explained by oligo- or polygenic risk factors., (© 2023. The Author(s), under exclusive licence to European Society of Human Genetics.)

Dysfunction in the gene SCN2A , which encodes the voltage-gated sodium channel Na v 1.2, is strongly associated with neurodevelopmental disorders including autism spectrum disorder and intellectual disability (ASD/ID). This dysfunction typically manifests in these disorders as a haploinsufficiency, where loss of one copy of a gene cannot be compensated for by the other allele. Scn2a haploinsufficiency affects a range of cells and circuits across the brain, including associative neocortical circuits that are important for cognitive flexibility and decision-making behaviors. Here, we tested whether Scn2a haploinsufficiency has any effect on a dynamic foraging task that engages such circuits. Scn2a +/- mice and wild-type (WT) littermates were trained on a choice behavior where the probability of reward between two options varied dynamically across trials and where the location of the high reward underwent uncued reversals. Despite impairments in Scn2a -related neuronal excitability, we found that both male and female Scn2a +/- mice performed these tasks as well as wild-type littermates, with no behavioral difference across genotypes in learning or performance parameters. Varying the number of trials between reversals or probabilities of receiving reward did not result in an observable behavioral difference, either. These data suggest that, despite heterozygous loss of Scn2a , mice can perform relatively complex foraging tasks that make use of higher-order neuronal circuits., Competing Interests: K.J.B. is on the scientific advisory board of Regel Tx and receives funding from BioMarin Pharmaceutical Incorporated. A.C.K. has served as a scientific advisor or consultant for Biohaven Pharmaceuticals, Empyrean Neuroscience, Freedom Biosciences, and Psylo. A.C.K. has also received research support from Intra-Cellular Therapies. These duties had no influence on the content of this article. All other authors declare no competing financial interests., (Copyright © 2023 Schamiloglu et al.)

Objective: SCN2A gene pathogenic variants are associated with a wide phenotypic spectrum, encompassing epilepsy, developmental delay, and autism spectrum disorder. Researches conducted in Denmark have revealed a disease frequency of approximately 1/78,608 (0.0012%) live births in this population. We estimated the frequency of SCN2A-related disorder in the birth cohort of Brescia and its province between 2002 and 2021., Methods: Frequency was calculated by ratio between patients with SCN2A pathogenic variant and the total number of live births at the Regional Epilepsy Center of Brescia, between 2002 and 2021. The number of births in Brescia and province was obtained from the Italian National Institute of Statistics (ISTAT)., Results: A frequency of 11/23,2678 births (0.0047%) was found. In comparison with Danish data, we noticed a higher frequency of the pathogenic variant in our population, even considering the same time frame (0.0035% of subjects born between 2006 and 2014)., Conclusion: The frequency of SCN2A pathogenic variant among live births in Brescia and its Province between 2006 and 2014 was about three times that of Danish population; this difference was about four times if we consider the period from 2002 to 2021. More studies are needed to further delineate the frequency of SCN2A pathogenic variant in Italian population., Competing Interests: Declaration of Competing Interest The authors have no conflicts of interest to declare., (Copyright © 2023 Elsevier B.V. All rights reserved.)

Pathogenic variants in voltage-gated sodium (NaV) channel genes including SCN2A, encoding NaV1.2, are discovered frequently in neurodevelopmental disorders with or without epilepsy. SCN2A is also a high-confidence risk gene for autism spectrum disorder (ASD) and nonsyndromic intellectual disability (ID). Previous work to determine the functional consequences of SCN2A variants yielded a paradigm in which predominantly gain-of-function variants cause neonatal-onset epilepsy, whereas loss-of-function variants are associated with ASD and ID. However, this framework was derived from a limited number of studies conducted under heterogeneous experimental conditions, whereas most disease-associated SCN2A variants have not been functionally annotated. We determined the functional properties of SCN2A variants using automated patch-clamp recording to demonstrate the validity of this method and to examine whether a binary classification of variant dysfunction is evident in a larger cohort studied under uniform conditions. We studied 28 disease-associated variants and 4 common variants using two alternatively spliced isoforms of NaV1.2 expressed in HEK293T cells. Automated patch-clamp recording provided a valid high throughput method to ascertain detailed functional properties of NaV1.2 variants with concordant findings for variants that were previously studied using manual patch clamp. Many epilepsy-associated variants in our study exhibited complex patterns of gain- and loss-of-functions that are difficult to classify by a simple binary scheme. The higher throughput achievable with automated patch clamp enables study of variants with greater standardization of recording conditions, freedom from operator bias, and enhanced experimental rigor. This approach offers an enhanced ability to discern relationships between channel dysfunction and neurodevelopmental disorders., (© 2023 Thompson et al.)

A range of epilepsies, including the most severe group of developmental and epileptic encephalopathies (DEEs), are caused by gain-of-function variants in voltage-gated channels. Here we report the generation and characterisation of an iPSC cell line from the fibroblasts of a girl with early infantile DEE carrying heterozygous missense gain-of-function mutation (R1882Q) in Na v 1.2(SCN2A) protein, using transient transfection with a single mRNA molecule. The established iPSC line displays typical human primed pluripotent stem cell characteristics: typical colony morphology and robust expression of pluripotency-associated marker genes, ability to give rise to derivatives of all three embryonic germ layers, and normal karyotype without any SNP array-detectable copy number variations. We anticipate that this iPSC line will be useful for the development of neuronal hyperactivity-caused human stem cell-based DEE models, advancing both understanding and potential therapy development for this debilitating condition., Competing Interests: Declaration of Competing Interest Steven Petrou is an equity holder of RogCon, Inc. and Praxis Precision Medicine, Inc., Cambridge, MA, USA.., (Copyright © 2023 The Authors. Published by Elsevier B.V. All rights reserved.)

Purpose: Early recognition of seizures in neonates secondary to pathogenic variants in potassium or sodium channel coding genes is crucial, as these seizures are often resistant to commonly used anti-seizure medications but respond well to sodium channel blockers. Recently, a characteristic ictal amplitude-integrated electroencephalogram (aEEG) pattern was described in neonates with KCNQ2-related epilepsy. We report a similar aEEG pattern in seizures caused by SCN2A- and KCNQ3-pathogenic variants, as well as conventional EEG (cEEG) descriptions., Methods: International multicentre descriptive study, reporting clinical characteristics, aEEG and cEEG findings of 13 neonates with seizures due to pathogenic SCN2A- and KCNQ3-variants. As a comparison group, aEEGs and cEEGs of neonates with seizures due to hypoxic-ischemic encephalopathy (n = 117) and other confirmed genetic causes affecting channel function (n = 55) were reviewed., Results: In 12 out of 13 patients, the aEEG showed a characteristic sequence of brief onset with a decrease, followed by a quick rise, and then postictal amplitude attenuation. This pattern correlated with bilateral EEG onset attenuation, followed by rhythmic discharges ending in several seconds of post-ictal amplitude suppression. Apart from patients with KCNQ2-related epilepsy, none of the patients in the comparison groups had a similar aEEG or cEEG pattern., Discussion: Seizures in SCN2A- and KCNQ3-related epilepsy in neonates can usually be recognized by a characteristic ictal aEEG pattern, previously reported only in KCNQ2-related epilepsy, extending this unique feature to other channelopathies. Awareness of this pattern facilitates the prompt initiation of precision treatment with sodium channel blockers even before genetic results are available., Competing Interests: Declaration of Competing Interest C. M. P. C. D. Peeters-Scholte is founder and consultant at Neurophyxia BV. She holds several patents and stocks of Neurophyxia BV. None of this work has a relationship with the current manuscript. The other authors report no conflicts of interest, according to ICMJE recommendations., (Copyright © 2023 The Author(s). Published by Elsevier Ltd.. All rights reserved.)

PRRT2 is a neuronal protein that controls neuronal excitability and network stability by modulating voltage-gated Na + channel (Nav). PRRT2 pathogenic variants cause pleiotropic syndromes including epilepsy, paroxysmal kinesigenic dyskinesia and episodic ataxia attributable to loss-of-function pathogenetic mechanism. Based on the evidence that the transmembrane domain of PRRT2 interacts with Nav1.2/1.6, we focused on eight missense mutations located within the domain that show expression and membrane localization similar to the wild-type protein. Molecular dynamics simulations showed that the mutants do not alter the structural stability of the PRRT2 membrane domain and preserve its conformation. Using affinity assays, we found that the A320V and V286M mutants displayed respectively decreased and increased binding to Nav1.2. Accordingly, surface biotinylation showed an increased Nav1.2 surface exposure induced by the A320V mutant. Electrophysiological analysis confirmed the lack of modulation of Nav1.2 biophysical properties by the A320V mutant with a loss-of-function phenotype, while the V286M mutant displayed a gain-of-function with respect to wild-type PRRT2 with a more pronounced left-shift of the inactivation kinetics and delayed recovery from inactivation. The data confirm the key role played by the PRRT2-Nav interaction in the pathogenesis of the PRRT2-linked disorders and suggest an involvement of the A320 and V286 residues in the interaction site. Given the similar clinical phenotype caused by the two mutations, we speculate that circuit instability and paroxysmal manifestations may arise when PRRT2 function is outside the physiological range., Competing Interests: Declaration of Competing Interest The authors declare that they have no conflicts of interest with the contents of this article., (Copyright © 2023. Published by Elsevier Inc.)

Pathogenic heterozygous variants in SCN2A, which encodes the neuronal sodium channel NaV1.2, cause different types of epilepsy or intellectual disability (ID)/autism without seizures. Previous studies using mouse models or heterologous systems suggest that NaV1.2 channel gain-of-function typically causes epilepsy, whereas loss-of-function leads to ID/autism. How altered channel biophysics translate into patient neurons remains unknown. Here, we investigated iPSC-derived early-stage cortical neurons from ID patients harboring diverse pathogenic SCN2A variants [p.(Leu611Valfs*35); p.(Arg937Cys); p.(Trp1716*)] and compared them with neurons from an epileptic encephalopathy (EE) patient [p.(Glu1803Gly)] and controls. ID neurons consistently expressed lower NaV1.2 protein levels. In neurons with the frameshift variant, NaV1.2 mRNA and protein levels were reduced by ~ 50%, suggesting nonsense-mediated decay and haploinsufficiency. In other ID neurons, only protein levels were reduced implying NaV1.2 instability. Electrophysiological analysis revealed decreased sodium current density and impaired action potential (AP) firing in ID neurons, consistent with reduced NaV1.2 levels. In contrast, epilepsy neurons displayed no change in NaV1.2 levels or sodium current density, but impaired sodium channel inactivation. Single-cell transcriptomics identified dysregulation of distinct molecular pathways including inhibition of oxidative phosphorylation in neurons with SCN2A haploinsufficiency and activation of calcium signaling and neurotransmission in epilepsy neurons. Together, our patient iPSC-derived neurons reveal characteristic sodium channel dysfunction consistent with biophysical changes previously observed in heterologous systems. Additionally, our model links the channel dysfunction in ID to reduced NaV1.2 levels and uncovers impaired AP firing in early-stage neurons. The altered molecular pathways may reflect a homeostatic response to NaV1.2 dysfunction and can guide further investigations., (© The Author(s) 2023. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

Variants in SCN2A, encoding the voltage-gated sodium channel Nav1.2, are commonly associated with developmental and epileptic encephalopathy. Although animal studies demonstrated a role for Nav1.2 in intraventricular conduction, heart anomalies have been only occasionally described in patients with SCN2A variants. In this report we trace the prenatal and neonatal history of a fetus/newborn with a de novo pathogenic variant in the SCN2A gene identified by prenatal trio whole-exome sequencing (WES). In addition to more typically SCN2A-associated neurological manifestations, the patient showed sustained tachyarrhythmia, potentially expanding the phenotypic spectrum associated with SCN2A variants and raising the question of whether cardiological assessment and prompt pharmacological intervention in SCN2A channelopathies to avoid heart complications might be beneficial. To the best of our knowledge, this represents the first clinical description of a SCN2A phenotype in a prenatal setting, as well as the first SCN2A diagnosis achieved by prenatal trio-WES approach., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier Masson SAS. All rights reserved.)

Background: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis., Methods: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation., Results: Within SCN1A gene we found that the rs6432861 ( p  = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p  = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy., Conclusion: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Objective: Opening of voltage-gated sodium channels is crucial for neuronal depolarization. Proper channel opening and influx of Na + through the ion pore, is dependent upon binding of Na + ion to a specific amino-acid motif (DEKA) within the pore. In this study we used molecular dynamic simulations, an advanced bioinformatic tool, to research the dysfunction caused by pathogenic variants in SCN1a, SCN2a and SCN8a genes., Method: Molecular dynamic simulations were performed in six patients: three patients with Dravet syndrome (p.Gly177Ala,p.Ser259Arg and p.Met1267Ile, SCN1a), two patients with early onset drug resistant epilepsy(p.Ala263Val, SCN2a and p.Ile251Arg, SCN8a), and a patient with autism (p.Thr155Ala, SCN2a). After predicting the 3D-structure of mutated proteins by homology modeling, time dependent molecular dynamic simulations were performed, using the Schrödinger algorithm. The opening of the sodium channel, including the detachment of the sodium ion to the DEKA motif and pore diameter were assessed. Results were compared to the existent patch clamp analysis in four patients, and consistency with clinical phenotype was noted., Results: The Na + ion remained attached to DEKA filter longer when compared to wild type in the p.Gly177Ala, p.Ser259Arg,SCN1a, and p.Thr155Ala, SCN2a variants, consistent with loss-of-function. In contrast, it detached quicker from DEKA than wild type in the p.Ala263Val,SCN2a variant, consistent with gain-of-function. In the p.Met1267Ile,SCN1a variant, detachment from DEKA was quicker, but pore diameter decreased, suggesting partial loss-of-function. In the p.Leu251Arg,SCN8a variant, the pore remained opened longer when compared to wild type, consistent with a gain-of-function. The molecular dynamic simulation results were consistent with the existing patch-clamp analysis studies, as well as the clinical phenotype., Significance: Molecular dynamic simulation can be useful in predicting pathogenicity of variants and the disease phenotype, and selecting targeted treatment based on channel dysfunction. Further development of these bioinformatic tools may lead to "virtual patch-clamp analysis"., Competing Interests: Conflict of interest statement The following authors declare competing interests: Noa Bielopolski is an employee in QR Genetics. Shane Wald Altman holds equity in and is an employee of QR Genetics. The rest of the authors have no other competing interests to disclose., (Copyright © 2022 Elsevier B.V. All rights reserved.)

Genetic variants in SCN2A, encoding the NaV1.2 voltage-gated sodium channel, are associated with a range of neurodevelopmental disorders with overlapping phenotypes. Some variants fit into a framework wherein gain-of-function missense variants that increase neuronal excitability lead to developmental and epileptic encephalopathy, while loss-of-function variants that reduce neuronal excitability lead to intellectual disability and/or autism spectrum disorder (ASD) with or without co-morbid seizures. One unique case less easily classified using this framework is the de novo missense variant SCN2A-p.K1422E, associated with infant-onset developmental delay, infantile spasms and features of ASD. Prior structure-function studies demonstrated that K1422E substitution alters ion selectivity of NaV1.2, conferring Ca2+ permeability, lowering overall conductance and conferring resistance to tetrodotoxin (TTX). Based on heterologous expression of K1422E, we developed a compartmental neuron model incorporating variant channels that predicted reductions in peak action potential (AP) speed. We generated Scn2aK1422E mice and characterized effects on neurons and neurological/neurobehavioral phenotypes. Cultured cortical neurons from heterozygous Scn2aK1422E/+ mice exhibited lower current density with a TTX-resistant component and reversal potential consistent with mixed ion permeation. Recordings from Scn2aK1442E/+ cortical slices demonstrated impaired AP initiation and larger Ca2+ transients at the axon initial segment during the rising phase of the AP, suggesting complex effects on channel function. Scn2aK1422E/+ mice exhibited rare spontaneous seizures, interictal electroencephalogram abnormalities, altered induced seizure thresholds, reduced anxiety-like behavior and alterations in olfactory-guided social behavior. Overall, Scn2aK1422E/+ mice present with phenotypes similar yet distinct from other Scn2a models, consistent with complex effects of K1422E on NaV1.2 channel function., (© The Author(s) 2022. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.)

Autism spectrum disorder (ASD) affects ~2% of the population in the US, and monogenic forms of ASD often result in the most severe manifestation of the disorder. Recently, SCN2A has emerged as a leading gene associated with ASD, of which abnormal sleep pattern is a common comorbidity. SCN2A encodes the voltage-gated sodium channel Na V 1.2. Predominantly expressed in the brain, Na V 1.2 mediates the action potential firing of neurons. Clinical studies found that a large portion of children with SCN2A deficiency have sleep disorders, which severely impact the quality of life of affected individuals and their caregivers. The underlying mechanism of sleep disturbances related to Na V 1.2 deficiency, however, is not known. Using a gene-trap Scn2a-deficient mouse model (Scn2a trap ), we found that Scn2a deficiency results in increased wakefulness and reduced non-rapid-eye-movement (NREM) sleep. Brain region-specific Scn2a deficiency in the suprachiasmatic nucleus (SCN) containing region, which is involved in circadian rhythms, partially recapitulates the sleep disturbance phenotypes. At the cellular level, we found that Scn2a deficiency disrupted the firing pattern of spontaneously firing neurons in the SCN region. At the molecular level, RNA-sequencing analysis revealed differentially expressed genes in the circadian entrainment pathway including core clock genes Per1 and Per2. Performing a transcriptome-based compound discovery, we identified dexanabinol (HU-211), a putative glutamate receptor modulator, that can partially reverse the sleep disturbance in mice. Overall, our study reveals possible molecular and cellular mechanisms underlying Scn2a deficiency-related sleep disturbances, which may inform the development of potential pharmacogenetic interventions for the affected individuals., (Copyright © 2022 The Authors. Published by Elsevier Inc. All rights reserved.)

In SCN2A-related disorders, there is an urgent demand to establish efficient methods for determining the gain- (GoF) or loss-of-function (LoF) character of variants, to identify suitable candidates for precision therapies. Here we classify clinical phenotypes of 179 individuals with 38 recurrent SCN2A variants as early-infantile or later-onset epilepsy, or intellectual disability/autism spectrum disorder (ID/ASD) and assess the functional impact of 13 variants using dynamic action potential clamp (DAPC) and voltage clamp. Results show that 36/38 variants are associated with only one phenotypic group (30 early-infantile, 5 later-onset, 1 ID/ASD). Unexpectedly, we revealed major differences in outcome severity between individuals with the same variant for 40% of early-infantile variants studied. DAPC was superior to voltage clamp in predicting the impact of mutations on neuronal excitability and confirmed GoF produces early-infantile phenotypes and LoF later-onset phenotypes. For one early-infantile variant, the co-expression of the α 1 and β 2 subunits of the Na v 1.2 channel was needed to unveil functional impact, confirming the prediction of 3D molecular modeling. Neither DAPC nor voltage clamp reliably predicted phenotypic severity of early-infantile variants. Genotype, phenotypic group and DAPC are accurate predictors of the biophysical impact of SCN2A variants, but other approaches are needed to predict severity., (© 2022. The Author(s).)

SCN2A encodes a voltage-gated sodium channel (Na V 1.2) expressed throughout the central nervous system in predominantly excitatory neurons. Pathogenic variants in SCN2A are associated with epilepsy and neurodevelopmental disorders. Genotype-phenotype correlations have been described, with loss-of-function variants typically being associated with neurodevelopmental delay and later-onset seizures, whereas gain-of-function variants more often result in early infantile-onset epilepsy. However, the true electrophysiological effects of most disease-causing SCN2A variants have yet to be characterized. We report an infant who presented with migrating focal seizures in the neonatal period. She was found to have a mosaic c.2635G>A, p.Gly879Arg variant in SCN2A . Voltage-clamp studies of the variant expressed on adult and neonatal Na V 1.2 isoforms demonstrated a mixed gain and loss of function, with predominantly a loss-of-function effect with reduced cell surface expression and current density. Additional small electrophysiological alterations included a decrease in the voltage dependence of activation and an increase in the voltage dependence of inactivation. This finding of a predominantly loss-of-function effect was unexpected, as the infant's early epilepsy onset would have suggested a predominantly gain-of-function effect. This case illustrates that our understanding of genotype-phenotype correlations is still limited and highlights the complexity of the underlying electrophysiological effects of SCN2A variants. NEW & NOTEWORTHY Voltage-gated sodium channels play an important role in the central nervous system, mutations in which have been reported to be responsible for epilepsy. We report here an infant presenting with epilepsy of infancy with migrating focal seizures (EIMFS) in the neonatal period with a mosaic c.2635G>A, resulting in a p.Gly879Arg missense mutation on the SCN2A gene encoding Na V 1.2 sodium channels. Biophysical characterization of this variant revealed a mixture of gain- and loss-of-function effects.

This study was aimed to analyze the commonalities and distinctions of voltage-gated sodium channels, Nav1.2, Nav1.6, in neurodevelopmental disorders. An observational study was performed including two patients with neurodevelopmental disorders. The demographic, electroclinical, genetic, and neuropsychological characteristics were analyzed and compared with each other and then with the subjects carrying the same genetic variants reported in the literature. The clinical features of one of them argued for autism spectrum disorder and developmental delay, the other for intellectual disability, diagnoses confirmed by the neuropsychological assessment. The first patient was a carrier of SCN2A (p.R379H) variant while the second was carrier of SCN8A (p.E936K) variant, both involving the pore loop of the two channels. The results of this study suggest that the neurodevelopmental disorders without overt epilepsy of both patients can be the consequences of loss of function of Nav1.2/Nav1.6 channels. Notably, the SCN2A variant, with an earlier expression timing in brain development, resulted in a more severe phenotype as autism spectrum disorder and developmental delay, while the SCN8A variant, with a later expression timing, resulted in a less severe phenotype as intellectual disability., (© 2022 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)

SCN2A-related disorders include intellectual disability, autism spectrum disorder, seizures, episodic ataxia, and schizophrenia. In this study, the phenotype-genotype association in SCN2A-related disorders was further delineated by collecting detailed clinical and molecular characteristics. Using previously proposed genotype-phenotype hypotheses based on variant function and position, the potential of phenotype prediction from the variants found was examined. Patients were identified through the Deciphering Developmental Disorders study and gene matching strategies. Phenotypic information and variant interpretation evidence were collated. Seventeen previously unreported patients and five patients who had been previously reported (but with minimal phenotypic and segregation data) were included (10 males, 12 females; median age 10.5 years). All patients had developmental delays and the majority had intellectual disabilities. Seizures were reported in 15 of 22 (68.2%), four of 22 (18.2%) had autism spectrum disorder and no patients were reported with episodic ataxia. The majority of variants were de novo. One family had presumed gonadal mosaicism. The correlation of the use of sodium channel-blocking antiepileptic drugs with phenotype or genotype was variable. These data suggest that variant type and position alone can provide some predictive information about the phenotype in a proportion of cases, but more precise assessment of variant function is needed for meaningful phenotype prediction., (© 2021 Wiley Periodicals LLC.)

Objective: To explore the clinical manifestations and genetic characteristics of patients with epilepsy and episodic ataxia caused by SCN2A gene variation. Methods: The clinical data of seizure manifestation, imaging examination and genetic results of 5 patients with epilepsy and (or) episodic ataxia because of SCN2A gene variation admitted to the Department of Pediatrics, the Third Affiliated Hospital of Zhengzhou University from July 2017 to January 2021 were analyzed retrospectively. Results: Among 5 patients, 4 were female and 1 was male. The onset age of epilepsy ranged from 4 days to 8 months. There were 2 cases of benign neonatal or infantile epilepsy and 3 cases of epileptic encephalopathy, in whom 1 case had development retardation,1 case transformed from West syndrome to infantile spasm and another one transformed from infantile spasm to Lennox-Gastaut syndrome. One case of benign neonatal-infantile epilepsy was characterized by neonatal onset seizures and episodic ataxia developed at the age of 78 months. Electroencephalograms at first visit of 5 cases showed that 2 cases were normal, 1 case had focal epileptic discharge, and 2 cases had multi-focal abnormal discharge with peak arrhythmia. The brain magnetic resonance imaging (MRI) of 3 cases were nomal, 1 case was abnormal (brain atrophy with decreased white matter) and the results of 1 case was unknown. The follow-up time ranged from 17 months to 89 months. Four cases of epilepsy were controlled and 1 case died at 2 years of age. Two cases had normal intelligence and motor development, 2 had moderate to severe intelligence retardation and motor critical state, and 1 had moderate to severe intelligence and motor development retardation. SCN2A gene variations were identified in all cases. There were 4 missense variations and 1 frameshift variation. Three variations had not been reported so far, including c.4906A>G,c.3643G>T,c.638delT. Conclusions: Variations in SCN2A gene can cause benign neonatal or infantile epilepsy and epileptic encephalopathy. Some children develop episodic ataxia with growing age. The variation of SCN2A gene is mainly missense variation.

Background: Febrile Seizures (FS) are the most common seizures in children younger than 5 years. In the last decade, various coding and noncoding sequence variations of voltage-gated sodium channels SCN2A have been identified in patients with seizures, implying their genetic base. We aimed to evaluate the association between SCN2A c. G/A genetic polymorphism among Egyptian children with febrile seizure plus., Methods: The present cross-sectional study was carried out on 100 epileptic infants and children, attendants of the Neurology Unit, pediatric department, Menoufia University Hospitals (Group Ι). The patients were sub-classified into two groups, according to response to anti-epileptic treatment; Group Ι a (drug responder) and Group Ι b (drug-resistant). Evenly divided number of apparently healthy, age and gender-matched children were selected as controls (Group II). A complete history, throughout the systemic examination and radiological & metabolic assessment, whenever needed was provided, all participants were genotyped for SCN2A rs17183814 polymorphism by Restriction Fragment Length Polymorphism (PCR-RFLP)., Results: Both of A allele and AA, GA genotypes of SCN2A c. 56 G/A were detected more in patients with febrile seizure plus comparison to the control group with a statistically significant difference at frequencies of 17% and 11% and 12% respectively; OR (CI95%): 10.04 (3.49-28.87) and p <0.001. On classifying epileptic patients into 2 subgroups, carriers of SCN2A rs17183814 AA genotype tended to respond poorly to Anti-epileptic Drugs (AEDs). Moreover, multivariate analysis revealed that rs17183814 A allele and positive family history of epilepsy were considered the highest predicted risk factors for the development of epilepsy; p<0.05., Conclusion: SCN2A rs17183814 (A) allele was specifically associated with developing febrile seizure plus and could modulate the patient's response to anti-epileptic medications., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.)

With the wide adoption of genomic sequencing in children having seizures, an increasing number of SCN2A genetic variants have been revealed as genetic causes of epilepsy. Voltage-gated sodium channel Nav1.2, encoded by gene SCN2A , is predominantly expressed in the pyramidal excitatory neurons and supports action potential (AP) firing. One recurrent SCN2A genetic variant is L1342P, which was identified in multiple patients with epileptic encephalopathy and intractable seizures. However, the mechanism underlying L1342P-mediated seizures and the pharmacogenetics of this variant in human neurons remain unknown. To understand the core phenotypes of the L1342P variant in human neurons, we took advantage of a reference human-induced pluripotent stem cell (hiPSC) line from a male donor, in which L1342P was introduced by CRISPR/Cas9-mediated genome editing. Using patch-clamping and microelectrode array (MEA) recordings, we revealed that cortical neurons derived from hiPSCs carrying heterozygous L1342P variant have significantly increased intrinsic excitability, higher sodium current density, and enhanced bursting and synchronous network firing, suggesting hyperexcitability phenotypes. Interestingly, L1342P neuronal culture displayed a degree of resistance to the anticonvulsant medication phenytoin, which recapitulated aspects of clinical observation of patients carrying the L1342P variant. In contrast, phrixotoxin-3 (PTx3), a Nav1.2 isoform-specific blocker, can potently alleviate spontaneous and chemically-induced hyperexcitability of neurons carrying the L1342P variant. Our results reveal a possible pathogenic underpinning of Nav1.2-L1342P mediated epileptic seizures and demonstrate the utility of genome-edited hiPSCs as an in vitro platform to advance personalized phenotyping and drug discovery. SIGNIFICANCE STATEMENT A mounting number of SCN2A genetic variants have been identified from patients with epilepsy, but how SCN2A variants affect the function of human neurons contributing to seizures is still elusive. This study investigated the functional consequences of a recurring SCN2A variant (L1342P) using human iPSC-derived neurons and revealed both intrinsic and network hyperexcitability of neurons carrying a mutant Nav1.2 channel. Importantly, this study recapitulated elements of clinical observations of drug-resistant features of the L1342P variant, and provided a platform for in vitro drug testing. Our study sheds light on cellular mechanism of seizures resulting from a recurring Nav1.2 variant, and helps to advance personalized drug discovery to treat patients carrying pathogenic SCN2A variant., (Copyright © 2021 the authors.)

Neuronal voltage-gated sodium channel Na V 1.2 C-terminal domain (CTD) binds calmodulin (CaM) constitutively at its IQ motif. A solution structure (6BUT) and other NMR evidence showed that the CaM N domain (CaM N ) is structurally independent of the C-domain (CaM C ) whether CaM is bound to the Na V 1.2 IQp (1,901-1,927) or Na V 1.2 CTD (1,777-1,937) with or without calcium. However, in the CaM + Na V 1.2 CTD complex, the Ca 2+ affinity of CaM N was more favorable than in free CaM, while Ca 2+ affinity for CaM C was weaker than in the CaM + Na V 1.2 IQp complex. The CTD EF-like (EFL) domain allosterically widened the energetic gap between CaM domains. Cardiomyopathy-associated CaM mutants (N53I(N54I), D95V(D96V), A102V(A103V), E104A(E105A), D129G(D130G), and F141L(F142L)) all bound the Na V 1.2 IQ motif favorably under resting (apo) conditions and bound calcium normally at CaM N sites. However, only N53I and A102V bound calcium at CaM C sites at [Ca 2+ ] < 100 μM. Thus, they are expected to respond like wild-type CaM to Ca 2+ spikes in excitable cells., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2021 Elsevier Ltd. All rights reserved.)

Epilepsy is the neurological disorder defined by spontaneous recurrent seizures, which are abnormal patterns of electrical discharge in the brain. A major advance in neurology over the last 20 years is the identification of genetic variation as an important cause of epilepsy, and in particular as a cause of the epileptic encephalopathies, defined by childhood-onset, treatment-resistant epilepsy accompanied by developmental delay leading to intellectual disability. Unfortunately, this progress in genetic diagnosis has yet to translate to effective precision or targeted therapeutics. However, in this issue of the JCI, Li and Jancovski et al. use antisense oligonucleotides (ASO) to treat or prevent epilepsy and epilepsy-associated cognitive and behavioral comorbidities in a mouse model of SCN2A encephalopathy, paralogous to the recurrent human variant SCN2A c.5645G>A (p.R1882Q) associated with epileptic encephalopathy. These findings may inform the development of targeted or personalized therapies for what is currently an incurable and largely untreatable disorder.

Aim: To determine whether genes that cause developmental and epileptic encephalopathies (DEEs) are more commonly implicated in intellectual disability with epilepsy as a comorbid feature than in intellectual disability only., Method: We performed targeted resequencing of 18 genes commonly implicated in DEEs in a cohort of 830 patients with intellectual disability (59% male) and 393 patients with DEEs (52% male)., Results: We observed a significant enrichment of pathogenic/likely pathogenic variants in patients with epilepsy and intellectual disability (16 out of 159 in seven genes) compared with intellectual disability only (2 out of 671) (p<1.86×10 -10 , odds ratio 37.22, 95% confidence interval 8.60-337.0)., Interpretation: We identified seven genes that are more likely to cause epilepsy and intellectual disability than intellectual disability only. Conversely, two genes, GRIN2B and SCN2A, can be implicated in intellectual disability without epilepsy; in these instances intellectual disability is not a secondary consequence of ongoing seizures but rather a primary cause. What this paper adds A subset of genes are more commonly implicated in epilepsy than other neurodevelopmental disorders. GRIN2B and SCN2A are implicated in intellectual disability and epilepsy independently., (© 2021 Mac Keith Press.)

De novo variation in SCN2A can give rise to severe childhood disorders. Biophysical gain of function in SCN2A is seen in some patients with early seizure onset developmental and epileptic encephalopathy (DEE). In these cases, targeted reduction in SCN2A expression could substantially improve clinical outcomes. We tested this theory by central administration of a gapmer antisense oligonucleotide (ASO) targeting Scn2a mRNA in a mouse model of Scn2a early seizure onset DEE (Q/+ mice). Untreated Q/+ mice presented with spontaneous seizures at P1 and did not survive beyond P30. Administration of the ASO to Q/+ mice reduced spontaneous seizures and significantly extended life span. Across a range of behavioral tests, Scn2a ASO-treated Q/+ mice were largely indistinguishable from WT mice, suggesting treatment is well tolerated. A human SCN2A gapmer ASO could likewise impact the lives of patients with SCN2A gain-of-function DEE.

Objective: To report on a family which has two siblings with SCN2A mutation caused by germline mosaicism suffering from autism spectrum disorder/development delay (ASD/DD)., Methods: Clinical data was collected for the proband and his parents. Next generation sequencing (NGS) was carried out on the proband and his parents. Suspected mutations were verified by Sanger sequencing of the proband, his parents and brother. To detect whether there is a low proportion of somatic mosaicism in the parents, a droplet digital PCR was conducted. The result of ddPCR showed that the father was germline mosaicism (0.233%)., Results: NGS has identified a de novo splicing mutation of the SCN2A gene, c.605+1G>A, in the proband and his brother. Combined with its clinical phenotype and inheritance pattern, SCN2A was judged to be the pathogenic gene. Above findings strongly suggested parental germline mosaicism., Conclusion: ASD/DD in siblings with SCN2A mutations caused by germline mosaicism. Paternal mosaicism should be considered as one of the important inheritance patterns for counseling parents with a child carrying SCN2A mutation. The ddPCR can help to reveal very low proportion of germline mosaicism.

Key Points: The recurrent SCN2A mutation R853Q is associated with developmental and epileptic encephalopathy with typical onset after the first months of life. Heterologously expressed R853Q channels exhibit an overall loss-of-function as a result of multiple defects in time- and voltage-dependent channel properties. A previously unrecognized enhancement of slow inactivation is conferred by the R853Q mutation and is a major driver of loss-of-function. Enhanced slow inactivation is potentiated in the canonical splice isoform of the channel and this may explain the later onset of symptoms associated with R853Q., Abstract: Mutations in voltage gated sodium (Na V ) channel genes, including SCN2A (encoding Na V 1.2), are associated with diverse neurodevelopmental disorders with or without epilepsy that present clinically with varying severity, age-of-onset and pharmacoresponsiveness. We examined the functional properties of the most recurrent SCN2A mutation (R853Q) to determine whether developmentally-regulated alternative splicing impacts dysfunction severity and to investigate effects of the mutation on slow inactivation. We engineered the R853Q mutation into neonatal and adult Na V 1.2 splice isoforms. Channel constructs were heterologously co-expressed in HEK293T cells with human β1 and β2 subunits. Whole-cell patch clamp recording was used to compare time- and voltage-dependent properties of mutant and wild-type channels. The R853Q mutation exhibits an overall loss-of-function attributed to multiple functional defects including a previously undiscovered enhancement of slow inactivation. The mutation exhibited altered voltage dependence of activation and inactivation, slower recovery from inactivation and decreased channel availability during high-frequency depolarizations. More notable were effects on slow inactivation, including a 10-fold slower rate of recovery from slow inactivation exhibited by mutant channels. The impairments in fast inactivation properties were more severe in the neonatal splice isoform, whereas slow inactivation was more pronounced in the splice isoform of the channel expressed predominantly in later childhood. Enhanced later-onset slow inactivation may be a primary driver of the later onset of neurological features associated with this mutation., (© 2021 The Authors. The Journal of Physiology © 2021 The Physiological Society.)

Alternative splicing plays an important role in brain development, but its global contribution to human neurodevelopmental diseases (NDDs) requires further investigation. Here we examine the relationships between splicing isoform expression in the brain and de novo loss-of-function mutations from individuals with NDDs. We analyze the full-length isoform transcriptome of the developing human brain and observe differentially expressed isoforms and isoform co-expression modules undetectable by gene-level analyses. These isoforms are enriched in loss-of-function mutations and microexons, are co-expressed with a unique set of partners, and have higher prenatal expression. We experimentally test the effect of splice-site mutations and demonstrate exon skipping in five NDD risk genes, including SCN2A, DYRK1A, and BTRC. Our results suggest that the splice site mutation in BTRC reduces translational efficiency, likely affecting Wnt signaling through impaired degradation of β-catenin. We propose that functional effects of mutations should be investigated at the isoform- rather than gene-level resolution., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2021 The Author(s). Published by Elsevier Inc. All rights reserved.)

SCN2A, encoding the neuronal voltage-gated Na+ channel NaV1.2, is one of the most commonly affected loci linked to autism spectrum disorders (ASDs). Most ASD-associated mutations in SCN2A are loss-of-function mutations, but studies examining how such mutations affect neuronal function and whether Scn2a mutant mice display ASD endophenotypes have been inconsistent. We generated a protein truncation variant Scn2a mouse model (Scn2aΔ1898/+) by CRISPR that eliminates the NaV1.2 channel's distal intracellular C-terminal domain, and we analyzed the molecular and cellular consequences of this variant in a heterologous expression system, in neuronal culture, in brain slices, and in vivo. We also analyzed multiple behaviors in WT and Scn2aΔ1898/+ mice and correlated behaviors with clinical data obtained in human subjects with SCN2A variants. Expression of the NaV1.2 mutant in a heterologous expression system revealed decreased NaV1.2 channel function, and cultured pyramidal neurons isolated from Scn2aΔ1898/+ forebrain showed correspondingly reduced voltage-gated Na+ channel currents without compensation from other CNS voltage-gated Na+ channels. Na+ currents in inhibitory neurons were unaffected. Consistent with loss of voltage-gated Na+ channel currents, Scn2aΔ1898/+ pyramidal neurons displayed reduced excitability in forebrain neuronal culture and reduced excitatory synaptic input onto the pyramidal neurons in brain slices. Scn2aΔ1898/+ mice displayed several behavioral abnormalities, including abnormal social interactions that reflect behavior observed in humans with ASD and with harboring loss-of-function SCN2A variants. This model and its cellular electrophysiological characterizations provide a framework for tracing how a SCN2A loss-of-function variant leads to cellular defects that result in ASD-associated behaviors.

Here we report the pharmacologic blockade of voltage-gated sodium ion channels (Na V s) by a synthetic saxitoxin derivative affixed to a photocleavable protecting group. We demonstrate that a functionalized saxitoxin (STX-eac) enables exquisite spatiotemporal control of Na V s to interrupt action potentials in dissociated neurons and nerve fiber bundles. The photo-uncaged inhibitor (STX-ea) is a nanomolar potent, reversible binder of Na V s. We use STX-eac to reveal differential susceptibility of myelinated and unmyelinated axons in the corpus callosum to Na V -dependent alterations in action potential propagation, with unmyelinated axons preferentially showing reduced action potential fidelity under conditions of partial Na V block. These results validate STX-eac as a high precision tool for robust photocontrol of neuronal excitability and action potential generation.

Purpose: Pathogenic variants in SCN2A cause a wide range of neurodevelopmental phenotypes. Reports of genotype-phenotype correlations are often anecdotal, and the available phenotypic data have not been systematically analyzed., Methods: We extracted phenotypic information from primary descriptions of SCN2A-related disorders in the literature between 2001 and 2019, which we coded in Human Phenotype Ontology (HPO) terms. With higher-level phenotype terms inferred by the HPO structure, we assessed the frequencies of clinical features and investigated the association of these features with variant classes and locations within the Na V 1.2 protein., Results: We identified 413 unrelated individuals and derived a total of 10,860 HPO terms with 562 unique terms. Protein-truncating variants were associated with autism and behavioral abnormalities. Missense variants were associated with neonatal onset, epileptic spasms, and seizures, regardless of type. Phenotypic similarity was identified in 8/62 recurrent SCN2A variants. Three independent principal components accounted for 33% of the phenotypic variance, allowing for separation of gain-of-function versus loss-of-function variants with good performance., Conclusion: Our work shows that translating clinical features into a computable format using a standardized language allows for quantitative phenotype analysis, mapping the phenotypic landscape of SCN2A-related disorders in unprecedented detail and revealing genotype-phenotype correlations along a multidimensional spectrum.

Background: Previous studies have investigated the association between rs2304016 and rs17183814 polymorphisms in sodium voltage-gated channel alpha subunit 2 (SCN2A) and epilepsy risk and responsiveness to antiepileptic drugs (AEDs) but with conflicting results. Our aim was to reevaluate the relationship by performing a systematic review and meta-analysis., Methods: By searching PubMed, Medline, and CNKI, 14 studies were selected. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were computed to measure the association between rs17183814 and rs2304016 polymorphisms and the risk of epilepsy and AEDs response using the fixed-effects model or the random-effects model., Results: No significant association between the rs17183814 in SCN2A and the risk of epilepsy was observed (heterozygous comparison: OR = 0.78, 95% CI: 0.61-1.00; homozygous comparison: OR = 1.34, 95% CI: 0.63-2.86; dominant model: OR = 0.82, 95% CI: 0.64-1.04; recessive model: OR = 1.44, 95% CI: 0.68-3.05; allele comparison: OR = 0.88, 95%CI: 0.71-1.10). Moreover, neither the rs17183814 nor the rs2304016 was associated with AEDs response., Conclusion: This meta-analysis suggests that the rs17183814 and rs2304016 polymorphisms in SCN2A are not associated with the risk of epilepsy and response to AEDs.

Abstract: Autism spectrum disorder can be associated with a variety of genetic findings. We report a heterozygous de novo missense variant of SCN2A, the gene coding a voltage-gated sodium ion channel enriched in the axon initial segment and nodes of Ranvier of "immature" neocortical pyramidal neurons. With further understanding of the neurodevelopmental and functional effects of this missense variant on neuronal excitability and neocortical circuitry, there may be targeted pharmacotherapeutic interventions, potentially with "disease-modifying effects.", Competing Interests: Conflicts of Interest and Source of Funding: The authors have no conflicts of interest to declare., (Copyright © 2021 Wolters Kluwer Health, Inc. All rights reserved.)