Search

Abstract The present study investigated the Zinc finger BED-type containing 3 (ZBED3) mRNA expression levels, diagnostic and prognostic values, co-expressed and differentially expressed genes, immune infiltration, and functional enrichment analysis in patients with kidney renal clear cell carcinoma (KIRC) using various public databases such as The Cancer Genome Atlas, Genotype-Tissue Expression Project, LinkedOmics, Gene Set Enrichment Analysis databases, and the Xiantao academic tool. Through extensive data mining, our study revealed differential expression of ZBED3 in various tumor and paired normal tissues. Specifically, ZBED3 expression was found to be significantly decreased in KIRC, particularly in advanced pathologic stages and histologic grades, when compared to corresponding control tissues. Our analysis revealed that the overexpression of ZBED3 is associated with a favorable overall survival outcome in KIRC patients. Moreover, functional enrichment analysis identified key pathways related to inflammation response and DNA methylation of ZBED3 in KIRC. Additionally, our findings suggest that the upregulation of ZBED3 leads to the inhibition of cell proliferation by modulating cell-cycle progression in KIRC cell lines. Taken together, these results suggest that ZBED3 may serve as a promising biomarker and prognostic indicator for individuals diagnosed with KIRC.

Abstract Background Severe fever with thrombocytopenia syndrome (SFTS) is an emerging global infectious disease with a high mortality rate. Clinicians lack a convenient tool for early identification of critically ill SFTS patients. The aim of this study was to construct a simple and accurate nomogarm to predict the prognosis of SFTS patients. Methods We retrospectively analyzed the clinical data of 372 SFTS patients collected between May 2015 and June 2023, which were divided 7:3 into a training set and an internal validation set. We used LASSO regression to select predictor variables and multivariable logistic regression to identify independent predictor variables. Prognostic nomograms for SFTS were constructed based on these factors and analysed for concordance index, calibration curves and area under the curve (AUC) to determine the predictive accuracy and consistency of the model. Results In the training set, LASSO and multivariate logistic regression analyses showed that age, SFTSV RNA, maximum body temperature, pancreatitis, gastrointestinal bleeding, pulmonary fungal infection (PFI), BUN, and PT were independent risk factors for death in SFTS patients. There was a strong correlation between neurological symptoms and mortality (P

Abstract More recently, increased studies have revealed that antioxidants can cure osteoporosis by inhibiting oxidative stress. Tauroursodeoxycholic acid (TUDCA) and Selenium (Se) have been confirmed to possess potent anti-oxidative effects and accelerate bone regeneration. In addition, very little is currently known about the effects of a combination with Se and TUDCA on bone defects in osteoporotic states. We, therefore, aimed to assess the protective effect of combination with Se and TUDCA on bone regeneration and investigate the effect and underlying mechanisms. When MC3T3-E1 was cultured in the presence of H2H2, Se, TUDCA and Se/TUDCA therapy could increase the matrix mineralization and promote expression of anti-oxidative stress markers in MC3T3-E1, while reducing intracellular reactive oxygen species (ROS) and mitochondrial ROS levels. Meanwhile, silent information regulator type 1 (SIRT1) was upregulated in response to Se, TUDCA and Se/TUDCA exposures in H2H2 treated-MC3T3-E1. In the OVX rat model, Se, TUDCA and Se/TUDCA showed a clear positive effect against impaired bone repair in osteoporosis. The results above demonstrate that Se/TUDCA exhibits superior efficacy in both cellular and animal experiments, as compared to Se and TUDCA. In conclusion, combination with Se and TUDCA stimulates bone regeneration and is a promising candidate for promoting bone repair in osteoporosis. Graphical abstract The release of TUDCA and Se during the degradation of Se/TUDCA can improve the local bone repair ability. At the same time, it can also inhibit cell ROS, and ultimately greatly promote local bone repair.

Abstract Analysing non-stationarity in runoff and sediment load is crucial for effective water resource management in the Dongting Lake basin amid climate change and human impacts. Using the Mann-Kendall test, Generalized Additive Models for Location, Scale, and Shape framework, and Random Forest models, we evaluated non-stationarity and its drivers in the annual runoff and annual sediment load series at eight hydrological stations from 1961 to 2021. These stations include three inflow sites at the Jingjiang Three Outlets (Ouchi, Songzi, and Hudu Rivers), four inflow sites in the Four Rivers basin (Xiang, Zi, Yuan, and Li Rivers), and one outflow site at Chenglingji. Results revealed a significant decrease in annual runoff at the Three Outlets and Chenglingji, while the Four Rivers basin showed no significant trend. The non-stationary models with multiple physically-based covariates better captured non-stationarity compared to single covariate models. Annual rainfall was a key contributor to annual runoff in the Four Rivers basin, while reservoir storage capacity played a more dominant role in the Three Outlets. At Chenglingji station, both factors significantly influenced annual runoff. For annual sediment load, reservoir storage capacity emerged as the most critical factor across all regions. These findings provide a basis for improving runoff and sediment regulation in the Dongting Lake basin.

Abstract Purpose The essence of this scholarly work was to carefully outline the key factors intensifying the virulence and protracted contagion of COVID-19, particularly among individuals afflicted with hematologic malignancies (HM), in an epoch predominantly governed by the Omicron variant. Methods Adults with HM diagnosed with COVID-19 from November 2022 to February 2023 were monitored in this retrospective study. Patient blood samples yielded biochemical data, and COVID-19 was confirmed through RNA or antigen testing. The factors affecting severity and infection duration were examined using both univariate and multivariate logistic regression analyses. For calculating the overall survival probabilities, the Kaplan–Meier product limit approach was employed. Results In the examined cohort, 133 individuals diagnosed with HM and concomitantly infected with COVID-19 were scrutinized. Of the participants, 29.3% (39 patients) were classified as Severe/Critical, while the other 70.7% (94 patients) were categorized as Non-severe. A significant difference was observed in vaccination status: 61.7% of patients in the Non-severe group had received at least a two-dose vaccine regimen, whereas 61.5% of the Severe/Critical group had either minimal or only one dose of vaccination. The data analysis revealed that elevated C-reactive protein levels (≥ 100 mg/L) significantly raised the risk of severe/critical conditions in HM patients with COVID-19, as determined by advanced multivariate logistic regression. The odds ratio was 3.415 with a 95% confidence interval of 1.294–9.012 (p = 0.013). Patients who continued to have positive nucleic acid tests and ongoing symptoms beyond 30 days were categorized as having a persistent infection, whereas those who achieved infection control within this timeframe were categorized as having infection recovery. Of the HM cohort, 11 did not survive beyond 30 days after diagnosis. The results from a competing risk model revealed that increased interleukin-6 levels (HR: 2.626, 95% CI: 1.361–5.075; p = 0.004) was significantly associated with persistent infection. Conversely, receiving more than two vaccine doses (HR: 0.366, 95% CI: 0.158–0.846; p = 0.019), and having high IgG levels (≥ 1000 mg/dl) (HR: 0.364, 95% CI: 0.167–0.791; p = 0.011), were associated with infection recovery. There was a notable disparity in survival rates between patients with persistent infections and infection recovery, with those in the non-persistent group demonstrating superior survival outcomes (P

Abstract Background Our previous study has demonstrated a decreased colonic CD8+CD39+ T cells, enrichment of granzyme A (GZMA), was found in pediatric-onset colitis and inflammatory bowel disease (IBD) characterized by impaired intestinal barrier function. However, the influence of GZMA on intestinal barrier function remains unknown. Methods Western blotting(WB), real-time PCR (qPCR), immunofluorescence (IF) and in vitro permeability assay combined with intestinal organoid culture were used to detect the effect of GZMA on intestinal epithelial barrier function in vivo and in vitro. Luciferase, immunoprecipitation (IP) and subcellular fractionation isolation were performed to identify the mechanism through which GZMA modulated intestinal epithelial barrier function. Results Herein, we, for the first time, demonstrated that CD8+CD39+ T cells promoted intestinal epithelial barrier function through GZMA, leading to induce Occludin(OCLN) and Zonula Occludens-1(ZO-1) expression, which was attributed to enhanced CDX2-mediated cell differentiation caused by increased glutathione peroxidase 4(GPX4)-induced ferroptosis inhibition in vivo and in vitro. Mechanically, GZMA inhibited intestinal epithelial cellular PDE4B activation to trigger cAMP/PKA/CREB cascade signaling to increase CREB nuclear translocation, initiating GPX4 transactivity. In addition, endogenous PKA interacted with CREB, and this interaction was enhanced in response to GZMA. Most importantly, administration of GZMA could alleviate DSS-induced colitis in vivo. Conclusion These findings extended the novel insight of GZMA contributed to intestinal epithelial cell differentiation to improve barrier function, and enhacement of GZMA could be a promising strategy to patients with IBD.

The focus of this article lies in the existence of global mild solutions for Hilfer fractional stochastic evolution equations (HFSEEs) on the positive semi-axis (0,+∞) with a derivative order greater than 32 and less than 2. A significant challenge, which also presents novelty here, is to extend the generalized Ascoli–Arzela (A–A) theorem established in Zhou and He (2022) to the stochastic case under the associated sine family {S(t)}t≥0 not necessary compact. Then, by relying on our newly established generalized A–A theorem, standard stochastic analysis theory and Schauder’s fixed point principle, we derive the existence of global mild solutions for the addressed system. Finally, we demonstrate the feasibility of our obtained results through an illustrative example.

Iron is essential in various life processes, and its imbalance is closely related to disorders in multiple systems such as the nervous, cardiovascular, and immune systems, as well as many chronic diseases such as infections and cancer. Therefore, accurately assessing the status of iron in the body is of great significance for both basic and clinical research. The gold standard for iron status is still bone marrow stainable iron, but its actual application is very limited due to its invasive sampling and high cost. Other traditional biomarkers such as serum iron, ferritin, and related composite indicators are all affected to varying degrees by factors such as inflammation, age, and circadian fluctuations, but they also have their own suitable application scenarios. However, biomarkers that can fully assess iron status are far from perfect, leading to inaccurate diagnosis and treatment of iron imbalance in many cases. Although new biomarkers such as hepcidin, reticulocyte hemoglobin content, and erythroferrone have emerged, and with the rapid advancement of high-throughput technologies, multi-omics may help diagnose iron status in the future, more exploration and mining are still needed to expand the widespread and rational application of these potential markers. This article reviews the research progress of iron biomarkers, aiming to provide more references and directions for future related research.

Pattern recognition is critical to map data handling and their applications. This study presents a model that combines the Shape Context (SC) descriptor and Graph Convolutional Neural Network (GCNN) to classify the patterns of interchanges, which are indispensable parts of urban road networks. In the SC-GCNN model, an interchange is modeled as a graph, wherein nodes and edges represent the interchange segments and their connections, respectively. Then, a novel SC descriptor is implemented to describe the contextual information of each interchange segment and serve as descriptive features of graph nodes. Finally, a GCNN is designed by combining graph convolution and pooling operations to process the constructed graphs and classify the interchange patterns. The SC-GCNN model was validated using interchange samples obtained from the road networks of 15 cities downloaded from OpenStreetMap. The classification accuracy was 87.06%, which was higher than that of the image-based AlexNet, GoogLeNet, and Random Forest models.

Abstract Background The utilization of ultrapure dialysate has been shown to decrease dialysate contamination and mitigate inflammatory responses. The central dialysate delivery system (CDDS) has the potential to attain a level of purity similar to ultrapure dialysate. Nevertheless, there is limited research examining the impact of CDDS on inflammation in comparison to single-patient dialysis fluid delivery system(SPDDS). This study aims to investigate the effects of CDDS utilizing ultrapure dialysate on ameliorating the microinflammatory state in hemodialysis patients. Method A retrospective cohort clinical study enrolled a total of 125 hemodialysis patients, with 58 patients from the CDDS unit and 67 patients from the SPDDS unit. Each participant was monitored for a period of 6 months, and the repeated measurement data was analyzed using a generalized linear mixed models (GLMM). Results The average age of the studty cohort was 56.22 ± 12.64 years. The GLMM analysis showed a significant time*group interaction effect on hs-CRP changes over the follow-up period (β = -1.966, FTime* CDDS group = 13.389, P

Abstract Background The Medium and Long-Term Plan for the Prevention and Treatment of Chronic Diseases (2017–2025) in China has highlighted the importance of reducing fat, sodium, and sugar in foods. However, front-of-pack labeling, which enables consumers to assess the health levels of prepackaged foods, is lacking in China. In response to the Zhejiang Provincial Health Commission’s request, we sought to develop a method for efficiently evaluating the health level of prepackaged foods. Methods Through a comprehensive literature review, we established a systematic framework: the Prepackaged Foods Healthiness Ranking Index (PHRI). We determined specific threshold values and grading criteria and conducted two rounds of Delphi survey to refine the index. Using a measurement dataset, we aimed to determine the optimal limit values for assessing the health level of prepackaged foods in real-world settings. Results After two rounds of Delphi surveys, the PHRI underwent multiple revisions until consensus among experts was reached. The final decision regarding the upper limit values set 30% Nutrient Reference Values as the limit for solid foods and 15% Nutrient Reference Values for liquid foods. The calculation of PHRI values was successfully implemented with the dataset, in accord with current nutrition awareness and real-world conditions. Conclusions The PHRI provides a valuable tool for assessing the healthiness of prepackaged foods. This front-of-pack labeling system provides a convenient method for evaluating the nutritional quality of prepackaged foods. Ultimately, the PHRI has the potential to contribute to advancements in health policy, practice, and education in China.

Abstract Determination of high sulfur content in sulfide minerals is crucial for various applications, including geochemistry, mining, and environmental monitoring. While inductively coupled plasma optical emission spectrometry (ICP-OES) is the preferred method for sulfur analysis, conventional sample preparation techniques often fall short when dealing with high sulfur concentrations. This study investigated optimized digestion conditions for accurate sulfur determination in sulfide minerals using ICP-OES. We employed anti-corrosion acid digestion bombs, an aqua regia–hydrofluoric acid system, and a digestion temperature of 180 °C, achieving exceptional results. Certified reference material recoveries ranged from 99.9 to 100.5%, with relative standard deviations between 0.42 and 0.84%. These results demonstrate the high accuracy and precision of the method. The optimized digestion protocol presented in this study provides a robust and reliable approach for accurate sulfur analysis in sulfide minerals, particularly for high concentrations.

Objective To explore the influencing factors of incision infection in elderly patients with traumatic limb fracture after surgery, and to construct a nomographic model. Methods A total of 360 elderly patients with traumatic limb fracture who received surgical treatment in the First Affiliated Hospital of Chengdu Medical College from May 2021 to September 2023 were selected as the study subjects and divided into the modeling group (n = 252) and the verification group (n = 108) by the computer random number table. LASSO regression and logistic regression were used to analyze the influencing factors of postoperative incision infection, and column line diagrams were constructed according to the influencing factors, and the predictive performance and effect of the risk prediction model were evaluated by ROC curve and calibration curve. Results Twenty-seven research variables were included in the LASSO regression model for screening, and two models were constructed based on minimum values and standardization. Model 1 included 12 variables, including body mass index (BMI), use of steel plate, diabetes, drainage tube placement time, incision type, operation time, incision length, the ratio of peripheral blood C-reactive protein to albumin (CAR), serum procalcitonin (PCT)/albumin (ALB), interleukin-6 (IL-6), neutrophil to lymphocyte ratio (NLR), and serum erythrocyte sedimentation rate (ESR) three days after operation. Seven variables were included in model 2, including diabetes, drainage tube placement time, and peripheral blood CAR, PCT/ ALB, IL-6, NLR, ESR 3 days after surgery. The logistic regression analysis models were constructed with the dependent variable of whether the incision infection occurred after surgery, and the variables screened by LASSO regression in model 1 and model 2 as independent variables. The results of model 1 showed that BMI ≥28 kg/ m2, combined with diabetes, incision type Ⅲ, operation time, incision length, use of steel plate, placement time of drainage tube ≥ 6 days, and peripheral blood CAR, PCT/ ALB, IL-6, NLR, ESR 3 days after surgery were independent risk factors for postoperative incision infection in elderly patients with traumatic limb fracture (P < 0.05) . The results of model 2 showed that the combination of diabetes, the placement time of drainage tube ≥6 days and the peripheral blood CAR, PCT/ ALB, IL-6, NLR, ESR 3 days after operation were independent risk factors for postoperative incision infection in elderly patients with traumatic limb fracture (P < 0.05) . The area under the ROC curve of Model 1 in the modeling and validation groups was respectively 0.949 (95% CI: 0.898 - 1.000) and 0.981 (95% CI: 0.956 - 1.000), respectively. The results of the Hosmer Lemeshow test for Model 1 in the modeling and validation groups showed that the model did not deviate from a perfect fit, and the consistency of the calibration curve was good. The area under the ROC curve of Model 2 in the modeling and validation groups was respectively 0.882 (95% CI: 0.787 - 0.977) and 0.921 (95% CI: 0.843 - 1.000), respectively. Furthermore, the Hosmer Lemeshow test of Model 2 in the modeling and validation groups showed that the model deviated from a perfect fit and the consistency of the calibration curve was poor. Conclusion BMI, combined diabetes, incision type, operation time, incision length, use of steel plate, placement time of drainage tube, CAR, PCT/ ALB, IL-6, NLR and ESR of peripheral blood 3 days after operation are the influencing factors of postoperative incision infection in elderly patients with traumatic limb fracture.

Abstract Background Although the patient survival rate for many malignancies has been improved with immune checkpoint inhibitors (ICIs), some patients experience various immune-related adverse events (irAEs). IrAEs impact several organ systems, including the kidney. With anti-programmed cell death protein 1 (PD-1) therapy (pembrolizumab), kidney-related adverse events occur relatively rarely compared with other irAEs. However, the occurrence of AKI usually leads to anti-PD-1 therapy interruption or discontinuation. Therefore, there is an urgent need to clarify the mechanisms of renal irAEs (R-irAEs) to facilitate early management. This study aimed to analyse the characteristics of peripheral blood mononuclear cells (PBMCs) in R-irAEs. Methods PBMCs were collected from three patients who developed R-irAEs after anti-PD-1 therapy and three patients who did not. The PBMCs were subjected to scRNA-seq to identify cell clusters and differentially expressed genes (DEGs). Kyoto Encyclopedia of Genes and Genomes (KEGG) and gene ontology (GO) enrichment analyses were performed to investigate the most active biological processes in immune cells. Results Fifteen cell clusters were identified across the two groups. FOS, RPS26, and JUN were the top three upregulated genes in CD4+ T cells. The DEGs in CD4+ T cells were enriched in Th17 differentiation, Th1 and Th2 cell differentiation, NF-kappa B, Nod-like receptor, TNF, IL-17, apoptosis, and NK cell-mediated cytotoxicity signaling pathways. RPS26, TRBV25-1, and JUN were the top three upregulated genes in CD8+ T cells. The DEGs in CD8+ T cells were enriched in Th17 cell differentiation, antigen processing and presentation, natural killer cell-mediated cytotoxicity, the intestinal immune network for IgA production, the T-cell receptor signalling pathway, Th1 and Th2 cell differentiation, the phagosome, and cell adhesion molecules. Conclusions In conclusion, R-irAEs are associated with immune cell dysfunction. DEGs and their enriched pathways identified in CD4+ T cells and CD8+ T cells play important roles in the development of renal irAEs related to anti-PD-1 therapy. These findings offer fresh perspectives on the pathogenesis of renal damage caused by anti-PD-1 therapy.

Abstract Beige fat activation involves a fuel switch to fatty acid oxidation following chronic cold adaptation. Mitochondrial acyl-CoA synthetase long-chain family member 1 (ACSL1) localizes in the mitochondria and plays a key role in fatty acid oxidation; however, the regulatory mechanism of the subcellular localization remains poorly understood. Here, we identify an endosomal trafficking component sortilin (encoded by Sort1) in adipose tissues that shows dynamic expression during beige fat activation and facilitates the translocation of ACSL1 from the mitochondria to the endolysosomal pathway for degradation. Depletion of sortilin in adipocytes results in an increase of mitochondrial ACSL1 and the activation of AMPK/PGC1α signaling, thereby activating beige fat and preventing high-fat diet (HFD)-induced obesity and insulin resistance. Collectively, our findings indicate that sortilin controls adipose tissue fatty acid oxidation by substrate fuel selection during beige fat activation and provides a potential targeted approach for the treatment of metabolic diseases.

Abstract Purpose This study aimed to develop a Quality of Life (QOL) assessment scale for older patients with Neuro-co-Cardiological Diseases (NCCD) and to evaluate the reliability and validity of the scale. Method The study participants were derived from the Elderly Individuals with NCCD Registered Cohort Study (EINCCDRCS), a multicenter registry of patients with NCCD. The preliminary testing of the questionnaire was conducted among 10 older individuals aged 65 years and older who had NCCD and were recruited from the registry. Other patients who met the inclusion criteria participated in the field testing. After verifying the unidimensionality, local independence, and monotonicity assumptions of the scale, we employed the Rasch model within Item Response Theory framework to assess the quality of the scale through methods including internal consistency, criterion validity, Wright map, and item functioning differential. Subsequently, we assessed the construct validity of the scale by combining exploratory factor analysis with confirmatory factor analysis. Results Based on well-validated scales such as the short-form WHOQOL-OLD, HeartQOL, IQCODE, and SF-36, an original Neuro-co-Cardiological Diseases Quality of Life scale (NCCDQOL) was developed. 196 individuals from the EINCCDRCS were included in the study, with 10 participating in the preliminary testing and 186 in the field testing. Based on the results of the preliminary testing, the original questionnaire was refined through item deletion and adjustment, resulting in an 11-item NCCDQOL questionnaire. The Rasch analysis of the field testing data led to the removal of 21 misfitting individuals. The NCCDQOL demonstrated a four-category structure, achieved by combining two response categories. This structure aligned with the assumptions of unidimensionality, local independence, and monotonicity. The NCCDQOL also exhibited good validity and reliability. Conclusion The revised NCCDQOL questionnaire demonstrated good reliability and validity in the Rasch model, indicating promising potential for clinical application.

Eriocheir sinensis, commonly known as the Chinese mitten crab, is widely distributed in China from the Liaohe River in the north to the Pearl River in the south and in the shallow waters of the estuary into the sea, among which the population in the Yangtze River system has the largest yield and the most delicious taste, and is favored by domestic consumers. It is an important breeding species in the Chinese fishing industry. Since artificial breeding began in the 1980s, the production of Chinese mitten crabs has increased, and this species has become one of the most economically important crabs in the world and the most economically important freshwater crab in China. From the perspective of aquaculture areas, the Yangtze River Basin region accounts for over 80% of the total output in China, with Jiangsu and Anhui provinces ranking first and third, respectively. Therefore, the culture of Chinese mitten crabs in Jiangsu and Anhui plays a pivotal role in the country. After more than 30 years of development, China has established ecological and large-scale breeding systems for juvenile crabs. Therefore, artificial seedlings dominate the market but are mainly distributed in coastal areas such as Jiangsu. However, to reduce production costs, some breeding farms blindly introduce Chinese mitten crabs to one another, and do not perform germplasm detection during breeding, causing germplasm resources to be random and mixed, which directly affects the quality of juvenile crabs and results in the risk of germplasm decline. To evaluate the genetic background of cultured Chinese mitten crab populations in Jiangsu and Anhui in odd-number years, and to provide a scientific basis for subsequent genetic improvement and breeding of new varieties, 10 pairs of highly polymorphic microsatellite markers (simple sequence repeats) were used to analyze the genetic diversity and genetic structure of six cultured populations with 177 individuals in total. Each population contained 28–30 adult individuals with an approximate sex ratio. The leg muscle of the sampled crabs was extracted, and genomic DNA was extracted according to the instructions of the genome extraction kit (TianGen DP304). The microsatellite primers were modified using fluorescent labels (FAM and HEX) prior to PCR, and the PCR products were subjected to capillary electrophoresis. Genemarker 2.2 software was used to interpret typing results. The number of alleles (Na), effective number of alleles (Ne), expected heterozygosity (He), observed heterozygosity (Ho), inbreeding coefficient (Fis), and genetic distance (Dn) were calculated using Popgene 1.32 software, and Hardy-Weinberg equilibrium analysis was performed using the Markov chain method. PIC_CALC 0.6 software calculates polymorphism information content (PIC). Analysis of molecular variance (AMOVA) and the coefficient of genetic differentiation (Fst) were performed using Arlequin 3.5 software. A UPGMA tree was constructed based on inter-population genetic distance using MEGA 4.0 software. According to the frequency of alleles, mutation-drift equilibrium was detected using Bottleneck software. Genetic structure analysis was performed using the Structure 2.3.4 software. The results showed that the genetic diversity levels of the six cultured populations of E. sinensis were high and similar (Na=16.0–18.4, Ne=10.1–12.4, Ho=0.759–0.836, He=0.897–0.916, PIC=0.870–0.892). Genetic distance among populations (0.015–0.277) and the coefficient of genetic differentiation (Fst: 0.001–0.011) were low, and genetic variation among populations accounted for only 0.47% of the total variation in AMOVA. These analyses consistently indicated no significant genetic differentiation among the populations. The phylogenetic tree showed that the six cultured populations had a common ancestor and that the Gaochun population had further relationships with the other populations. Owing to its high genetic diversity, the Gaochun population can be used as a base population for mass selection. Genetic structure analysis showed that the genetic composition of each cultured population was diverse, and the proportions were similar. In this study, the inbreeding coefficient (Fis) of 10 loci in six populations had 43 positive values and 17 negative values, and there were both positive and negative values in each population, indicating that there was not only inbreeding to a certain extent but also a small amount of distant breeding in the six cultured populations of Chinese mitten crabs.The results of genetic structure analysis showed that the number of optimal genetic cluster groups was K=3. However, the chaotic genetic structures among the three groups failed to gather into a relatively independent group. Furthermore, each population had a genetic composition similar to those of the three genetic lineage sources. Considering the high level of genetic diversity in these populations, it is possible that the parental population sources are more complex. This indicated that the cultured population of Chinese mitten crabs had a large number of exogenous genetic hybrids.In conclusion, the genetic diversity of cultured Chinese mitten crab populations in the Jiangsu and Anhui areas is still high, which has potential development and utilization value, but there may be germplasm confounding. Therefore, it is necessary to conduct further studies on the breeding population during the subsequent breeding of improved varieties, such as using molecular markers with high sensitivity that can be used to identify different water systems to analyze the sources of mixed germplasm, and conducting germplasm detection before breeding to purify the germplasm and make reasonable and sustainable use of its germplasm resources.

Abstract Background/objectives The hemoglobin glycation index (HGI) has been demonstrated to serve as a substitute for the individual bias in glycosylated hemoglobin A1c (HbA1c). Our objective was to assess the correlation between HGI and cardiovascular (CV) outcomes in patients with diabetes and coronary artery disease (CAD). Subjects/methods We sequentially recruited 11921 patients with diabetes and CAD at Fuwai Hospital. The patients were categorized into five groups based on their HGI quintiles, ranging from Q1 to Q5. The primary endpoint was the occurrence of major adverse cardiac events (MACEs), which included CV death and nonfatal myocardial infarction. Results During the median 3-year follow-up, 327 (2.7%) MACEs were observed. A U-shaped relationship between HGI and 3-year MACEs was demonstrated by restricted cubic spline (RCS) after multivariable adjustment (nonlinear P = 0.014). The Kaplan-Meier curves demonstrated that the Q2 group had the lowest risk of MACE (P = 0.006). When comparing the HGI Q2 group, multivariable Cox regression models showed that both low (Q1) and high (Q4 or Q5) HGI were linked to a higher risk of MACEs (all P

Abstract Dysregulation of splicing factor expression plays a crucial role in the progression of hepatocellular carcinoma (HCC). Our research found that the expression level of splicing factor ZMAT2 was increased in HCC, promoting the proliferation of HCC cells. RNAseq data indicated that the absence of ZMAT2 induced skipping exon of mRNA, while RIPseq data further revealed the mRNA binding motifs of ZMAT2. A comprehensive analysis of RNAseq and RIPseq data indicateed that ZMAT2 played a crucial role in the maturation process of TRIM28 mRNA. Knocking down of ZMAT2 led to the deletion of 25 bases in exon 11 of TRIM28, ultimately resulting in nonsense-mediated decay (NMD). Our data revealed that ZMAT2 could regulate TRIM28 to reduce the accumulation of ROS in HCC cells, thereby promoting their proliferation. Our research also discovered that ZMAT2 was capable of undergoing phase separation, resulting in the formation of liquid droplet condensates within HCC cells. Additionally, it was found that ZMAT2 was able to form protein-nucleic acid condensates with TRIM28 mRNA. In summary, this study is the first to reveal that ZMAT2 and TRIM28 mRNA form protein-nucleic acid condensates, thereby regulating the splicing of TRIM28 mRNA. The increased expression of ZMAT2 in HCC leads to upregulated TRIM28 expression and reduced ROS accumulation, ultimately accelerating the proliferation of HCC cells.

The utilization of Bacillus sp. for the production of bio-CaCO3 in concrete crack repair and strength enhancement has attracted considerable attention. However, microbial-induced calcium carbonate precipitation (MICP) has yet to be explored as a precedent with activated sludge. Here calcium sourced from concrete slurry waste (CSW) and carbon from sludge microbial β-oxidation under alkaline were used to generate micro/nano CaCO3. The results indicate that the main crystalline form of the generated precipitated particles is calcite, with a particle size ranging from 0.7 to 10 μm. Minimal heavy metals were found in the supernatant following settling. And at the optimum pH of 8.5–9, carbon capture reached 743 mg L−1, and CaCO3 production reached 1,191 mg L−1, and dominant phylum were Proteobacteria and Bacteroidota, with Thauera being a prevalent genus adept in β-oxidation. Mass balance analysis showed that alkali promotes microbial β-oxidation of organisms to produce CO2 and facilitate storage. Thus, the alkaline regulation of metabolism between microbe and CSW provides a novel way of sludge to initiate MICP. HIGHLIGHTS Utilizing concrete slurry waste as a calcium source and sludge β-oxidation as a carbon source can successfully produce bio-CaCO3.; pH 8.5–9 is the optimal alkaline control for Thauera to be the dominant genus undergoing β-oxidation to produce CO2.; Bio-CaCO3 is a 0.7–10 μm calcite particle, which is an excellent material for repairing concrete.; There is no risk of heavy metal leakage during operation.;

Abstract There is limited research on risk factors for chronic endometritis regarding reproductive history and clinical symptoms. Thus, this nested case–control study identified risk factors for chronic endometritis in women who have undergone hysteroscopy. Endometrial tissue sections were obtained from 502 women with intrauterine disorders who underwent hysteroscopy. Chronic endometritis was diagnosed via CD138 immunostaining. The women were divided into two groups: 271 women without chronic endometritis and 231 women with chronic endometritis. The prevalence of chronic endometritis was 46%. Univariate logistic regression revealed that prolonged menstruation and intermenstrual bleeding were associated with chronic endometritis, and subsequent multivariate logistic regression analyses showed that these were further independently associated. With univariable logistic regression, the gravidity and abortion history were correlated with chronic endometritis; however, no significant correlation was found with the adjusted odds ratio (OR) of 0.74 (95% confidence interval [CI] 0.46–1.19) or 0.76 (95% CI 0.58–1.11), respectively. No significant correlation was found between caesarean section history and the rates of chronic endometritis. No significant difference was found in all other variables between the three groups with > 5, ≤ 5 plasma cells and in a unknown group. Prolonged menstruation and intermenstrual bleeding were risk factors associated with chronic endometritis. Chronic endometritis should be considered and CD138 immunohistochemical examination should be recommended in women with these symptoms.

Abstract The optimal treatment endpoints and duration of continuous therapy for multicentric Castleman disease (MCD) remain controversial. We retrospectively analyzed data from 123 patients with Human Herpesvirus (HHV)-8 negative MCD. We demonstrated that continuous therapy significantly enhanced progression-free survival (PFS) in patients who achieved an optimal response after initial treatment. These findings underscore the critical role of continuous therapy in HHV-8 negative MCD. Further studies with larger cohorts are required to validate these findings.

Owing to their limited accuracy and narrow applicability, current antimicrobial peptide (AMP) prediction models face obstacles in industrial application. To address these limitations, we developed and improved an AMP prediction model using Comparing and Optimizing Multiple DEep Learning (COMDEL) algorithms, coupled with high-throughput AMP screening method, finally reaching an accuracy of 94.8% in test and 88% in experiment verification, surpassing other state-of-the-art models. In conjunction with COMDEL, we employed the phage-assisted evolution method to screen Sortase in vivo and developed a cell-free AMP synthesis system in vitro, ultimately increasing AMPs yields to a range of 0.5–2.1 g/L within hours. Moreover, by multi-omics analysis using COMDEL, we identified Lactobacillus plantarum as the most promising candidate for AMP generation among 35 edible probiotics. Following this, we developed a microdroplet sorting approach and successfully screened three L. plantarum mutants, each showing a twofold increase in antimicrobial ability, underscoring their substantial industrial application values.

BackgroundBacteria are the most diverse and widely sourced microorganisms in the indoor air of subway stations, where pathogenic bacteria can spread through the air, leading to increased health risks. ObjectiveTo understand the status and distribution characteristics of indoor air bacterial pollution in subway stations and compartments in a city of Central South China, and to provide a scientific basis for formulating intervention measures to address indoor air bacteria pollution in subways. MethodsThree subway stations and the compartments of trains parking there in a city in Central South China were selected according to passenger flow for synchronous air sampling and monitoring. Temperature, humidity, wind speed, carbon dioxide (CO2), fine particulate matter (PM2.5), and inhalable particulate matter (PM10) were measured by direct reading method. In accordance with the requirements of Examination methods for public places-Part 3: Airborne microorganisms (GB/T 18204.3-2013), air samples were collected at a flow rate of 28.3 L·min−1, and total bacterial count was estimated. Bacterial microbial species were identified with a mass spectrometer and pathogenic bacteria were distinguished from non-pathogenic bacteria according to the Catalogue of pathogenic microorganisms transmitted to human beings issued by National Health Commission. Kruskal-Wallis H test was used to compare the subway hygiene indicators in different regions and time periods, and Bonferroni test was used for pairwise comparison. Spearman correlation test was used to evaluate the correlation between CO2 concentration and total bacterial count. ResultsThe pass rates were 100.0% for airborne total bacteria count, PM2.5, and PM10 in the subway stations and train compartments, 94.4% for temperature and wind speed, 98.6% for CO2, but 0% for humidity. The overall median (P25, P75) total bacteria count was 177 (138,262) CFU·m−3. Specifically, the total bacteria count was higher in station halls than in platforms, and higher during morning peak hours than during evening peak hours (P

Abstract Background Idiopathic short stature (ISS) is characterized by short stature with unknown causes. Recent studies showed different gut microbiota flora and reduced fecal short-chain fatty acids in ISS children. However, the roles of the microbiome and metabolites in the pathogenesis of ISS remains largely unknown. Methods We recruited 51 Chinese subjects, comprising 26 ISS children and 25 normal-height control individuals. Untargeted metabolomics was performed to explore the fecal metabolic profiles between groups. A shotgun metagenomic sequencing approach was used to investigate the microbiome at the strains level. Mediation analyses were done to reveal correlations between the height standard deviation (SD) value, the gut microbiome and metabolites. Results We detected marked differences in the composition of fecal metabolites in the ISS group, particularly a significant increase in erucic acid and a decrease in spermidine, adenosine and L-5-Hydroxytryptophan, when compared to those of controls. We further identified specific groups of bacterial strains to be associated with the different metabolic profile. Through mediation analysis, 50 linkages were established. KEGG pathway analysis of microbiota and metabolites indicated nutritional disturbances. 13 selected features were able to accurately distinguish the ISS children from the controls (AUC = 0.933 [95%CI, 79.9–100%]) by receiver operating characteristic (ROC) analysis. Conclusion Our study suggests that the microbiome and the microbial-derived metabolites play certain roles in children’s growth. These findings provide a new research direction for better understanding the mechanism(s) underlying ISS.

Abstract Intrahepatic accumulation dominates organ distribution for most nanomedicines. However, obscure intrahepatic fate largely hampers regulation on their in vivo performance. Herein, PEGylated liposomal doxorubicin is exploited to clarify the intrahepatic fate of both liposomes and the payload in male mice. Kupffer cells initiate and dominate intrahepatic capture of liposomal doxorubicin, following to deliver released doxorubicin to hepatocytes with zonated distribution along the lobule porto-central axis. Increasing Kupffer cells capture promotes doxorubicin accumulation in hepatocytes, revealing the Kupffer cells capture-payload release-hepatocytes accumulation scheme. In contrast, free doxorubicin is overlooked by Kupffer cells, instead quickly distributing into hepatocytes by directly crossing fenestrated liver sinusoid endothelium. Compared to free doxorubicin, liposomal doxorubicin exhibits sustained metabolism/excretion due to the extra capture-release process. This work unveils the pivotal role of Kupffer cells in intrahepatic traffic of PEGylated liposomal therapeutics, and quantitively describes the intrahepatic transport/distribution/elimination process, providing crucial information for guiding further development of nanomedicines.

Amorphophallus paeoniifolius (Dennst.) Nicolson, 1885, often known as elephant foot yam, is a tropical tuber crop that originates from south-east Asia and belongs to the Araceae family. It is known for its high production potential and popularity as a medicinal plant. However, the phylogeny and genes for this species are still unavailable. In this study, the first complete chloroplast genome of A. paeoniifolius was reported and phylogenetic analysis was conducted with Araceae species. The chloroplast genome was 176,258 bp in length with 34.80% overall GC content and includes a large single-copy (LSC) region (93,951 bp), a small single-copy (SSC) region (15,013 bp), and a pair of inverted repeat (IRs) regions (33,647 bp). The chloroplast genome has 130 genes, which include 85 protein-coding genes, 37 tRNA genes, and eight rRNA genes. A maximum-likelihood (ML) phylogenetic analysis indicated that all Amorphophallus species formed a single monophyletic clade with a high bootstrap value and A. paeoniifolius was closely related to A. konjac, A. albus, A. krausei, and A. titanum. The chloroplast genome reported in this study will be useful for further taxonomic and evolutionary studies of Amorphophallus.

Background: Hepatic immune tolerance might contribute to the development of therapeutic resistance to immunotherapy. However, addressing this issue is challenging since the efficacy of immunotherapy in the context of liver metastasis (LM) remains poorly studied. Here, we aimed to establish an LM common immune feature (LMCIF) score to quantify the characteristics of LM immunotolerance across cancer types for assisting clinical disease management. Methods: Large-scale clinical data were collected to identify the prognosis of LM. Multi-omics datasets of metastatic cancers with LM special immune-related pathways (LMSIPs) from the Molecular Signatures Database (MSigDB) were used to obtain an LMCIF cluster. Based on differential expression genes (DEGs), a novel LMCIF score for the LMCIF cluster was constructed. In addition, multi-omics, and immunohistochemistry (IHC) data from the public and in-house cohorts were used to explore the features of LM, and LMCIF score. Results: Patients with LM had a worse prognosis and significantly lower infiltration of immune cells than patients with metastasis to other organs when analyzed with combined clinical and RNA sequencing data. After extracting the LMCIF cluster from 373 samples by utilizing 29 LMSIPs and validating them in a microarray cohort, an LMCIF score was established to confirm the role of the immunosuppressive environment as a contributor to the poor prognosis of LM across cancer types. Moreover, this LMCIF score could be used to predict the immune response of cancer patients undergoing immunotherapy. Finally, we identified that the majority of the 31 LMCIF genes exhibited a negative correlation with TME cells in LM patients, one of them, KRT19, which possessed the strongest positive correlation with LMCIF score, was confirmed to have an immunosuppressive effect through IHC analysis. Conclusions: Our results suggest that LM across cancer types share similar immunological profiles that induce immunotolerance and escape from immune monitoring. The novel LMCIF score represents a common liver metastasis immune cluster for predicting immunotherapy response, the results of which might benefit clinical disease management.

Abstract This study aimed to develop a pan-genotypic and multifunctional small interfering RNA (siRNA) against hepatitis B virus (HBV) with an efficient delivery system for treating chronic hepatitis B (CHB), and explore combined RNA interference (RNAi) and immune modulatory modalities for better viral control. Twenty synthetic siRNAs targeting consensus motifs distributed across the whole HBV genome were designed and evaluated. The lipid nanoparticle (LNP) formulation was optimized by adopting HO-PEG2000-DMG lipid and modifying the molar ratio of traditional polyethylene glycol (PEG) lipid in LNP prescriptions. The efficacy and safety of this formulation in delivering siHBV (tLNP/siHBV) along with the mouse IL-2 (mIL-2) mRNA (tLNP/siHBVIL2) were evaluated in the rAAV-HBV1.3 mouse model. A siRNA combination (terms “siHBV”) with a genotypic coverage of 98.55% was selected, chemically modified, and encapsulated within an optimized LNP (tLNP) of high efficacy and security to fabricate a therapeutic formulation for CHB. The results revealed that tLNP/siHBV significantly reduced the expression of viral antigens and DNA (up to 3log10 reduction; vs PBS) in dose- and time-dependent manners at single-dose or multi-dose frequencies, with satisfactory safety profiles. Further studies showed that tLNP/siHBVIL2 enables additive antigenic and immune control of the virus, via introducing potent HBsAg clearance through RNAi and triggering strong HBV-specific CD4+ and CD8+ T cell responses by expressed mIL-2 protein. By adopting tLNP as nucleic acid nanocarriers, the co-delivery of siHBV and mIL-2 mRNA enables synergistic antigenic and immune control of HBV, thus offering a promising translational therapeutic strategy for treating CHB.

This study sought to determine the effects of rosemary leaf powder (RP) on laying performance, egg quality, serum indices, gut barrier function, and cecal microbiota and metabolites of late-phase laying hens. A total of 84 “Jing Tint 6” laying hens at 65-week old were randomly divided into 2 groups and fed either a basal diet (CON) or a basal diet supplemented with 0.3% RP. Our study revealed that RP improved the Haugh unit and decreased yolk n-6/n-3 polyunsaturated fatty acid (PUFA) ratio of laying hens, increased serum superoxide dismutase (SOD), jejunal activities of SOD and catalase (CAT), and jejunal zonula occludens-1 (ZO-1) expression, as well as decreased serum tumor necrosis factor-α (TNF-α) level and jejunal TNF-α mRNA expression. Rosemary leaf powder markedly enhanced (P

Objective To evaluate the feasibility of an online evidence-based leadership training programme for nurse leaders and its potential effectiveness in improving nurse leaders’ evidence-based leadership competencies.Design This is a two-arm, parallel, feasibility randomised controlled trial.Methods We screened all 160 nurse leaders from two Chinese hospitals. Eligible participants who gave their informed consent were randomly assigned to either an evidence-based leadership training group or a conventional online training group at each site and received a 7-month intervention. Pre-test and post-test assessments gauged feasibility and potential effectiveness. Descriptive and inferential statistics were employed for data analysis.Results Of the 160 screened participants, 119 (74%) were assigned to the intervention group (n=59, 50%) or active control group (n=60, 50%). In the intervention group, the number of participant logins in the modules ranged from 21 (36%) to 58 (98%), while in the control group, it ranged from 20 (33%) to 57 (95%). Participants in the intervention group (n=59) completed 42% of the 531 assigned tasks, while the control group (n=60) completed 41% of their 540 assigned tasks. Regarding course task adherence, participants in the intervention group returned 3.8 (SD=3.2) tasks (out of 9 tasks), while the control group returned 3.7 (SD=3.5) tasks (out of 9 tasks). A total of 22 (18%) out of 119 participants dropped out of the study, with 9 (15%) out of 59 from the intervention group and 13 (22%) out of 60 from the control group.Conclusions While the intervention demonstrated a degree of feasibility, measures can still be taken to improve intervention acceptability, course adherence and course task adherence. A full and powered randomised controlled trial is needed to test the intervention’s effectiveness and to ensure the feasibility of the study in clinical settings.Trail registration number ClinicalTrials.gov, numbers NCT05244499.

Cytokine of interferon-gamma (IFNγ) plays a vital role in the immune response against Mycobacteria tuberculosis (Mtb) infection, yet the specific function of T cells producing IFNγ in this process remains unclear. In this study, we first isolated IFNγ+CD3+ T cells induced by Mtb antigens using surface staining assays. which showed a strong ability to inhibit the growth of intracellular mycobacteria in macrophages. Peripheral blood mononuclear cells (PBMCs) from healthy individuals were then challenged with Bacillus Calmette–Guérin (BCG) or Mtb, respectively, to sort IFNγ-secreting T cells for mRNA sequencing to analyze the gene expression patterns. The results of the integrated data analysis revealed distinct patterns of gene expression between IFNγ+CD3+ T cells induced by the BCG vaccine and those induced by Mtb pathogens. Further, unlike Mtb-induced cells, BCG-induced IFNγ+CD3+ T cells expressed high levels of interleukin-2 (IL-2), which increased the frequencies of these cells and the production of effector cytokines IFNγ and IL-2. Our findings suggested that IFNγ+CD3+ T cells with high IL-2 expression presented potent effector functions to inhibit intracellular Mtb growth, while Mtb infection impaired IL-2 expression in IFNγ+CD3+ T cells.

This study examines the impact of political connections on charitable giving by private enterprises in China in the business environment context. The study constructs a nested structure model and empirically analyzes 1,426 sample enterprises from the 13th China Private Enterprise Survey (2018) data using stata15.1 software. The findings indicate that the business environment influences political connections, charitable giving, and their interaction. Political connections at the individual level of enterprise owners and core managers partly have a positive impact on the charitable giving of Chinese private enterprises. At the enterprise level, the formation of political connections, including the establishment of party organizations, cost-sharing, and receiving government subsidies, also enhances charitable giving. Additionally, certain attributes of private enterprises and entrepreneurs, such as age, year-on-year growth in net profit, and total bank loans, positively influence their charitable giving. However, a high debt-to-asset ratio may adversely affect a company’s charitable giving. These insights are invaluable for local entrepreneurs, authorities, and policymakers in understanding how to effectively conduct charitable giving within specific business and political environments. Academically, this study contributes to the corporate sociology literature by offering new perspectives and data support for future research.

Abstract Diabetes mellitus (DM) has become a major chronic disease seriously affecting human health. Type 2 diabetes mellitus (T2DM) accounts for about 90% of DM patients, which is the largest type. Approximately 25–35% of T2DM patients develop kidney disease, which not only impacts the survival rate and quality of life but also, to the family and society, are of great economic burden. Early identification of high‐risk T2DM patients with kidney disease is crucial for initiating targeted prevention and treatment measures in time to reduce or delay the occurrence and progression of diabetic kidney disease. Previous studies have identified a variety of clinical predictors for the progression of renal function in T2DM patients, including proteinuria, estimated glomerular filtration rate, blood glucose, blood pressure, serum uric acid, dyslipidemia, obesity, smoking, duration of DM, age, gender, race, family history of DM, and diabetic retinopathy. Clinical prediction models based on conventional clinical indicators are instrumental in evaluating the risk of kidney disease in T2DM patients, assisting in patient risk stratification. This article systematically reviews the clinical prediction factors and prediction models associated with the progression of renal function in T2DM patients, providing a comprehensive and current reference for improved clinical assessment of the risk of renal function progression.

Voltage-gated potassium channel (VGKC) complex autoimmunity associated with nerve hyperexcitability is an uncommon clinical spectrum. It is mostly characterized by limbic encephalitis, continuous neuromyotonia, and dysautonomia. Pain, however, has rarely been reported as the first symptom. The present study describes a case of persistent neuropathic pain as the only symptom associated with a positive serum contactin-associated protein-like 2 (CASPR2) auto-antibody in a 41-year-old female patient. Her pain was completely relieved with steroids and intravenous immunoglobulin (IVIG) therapy. Nevertheless, the pain recurred 1 year later, consistent with an immunofluorescence titer of the CASPR2 antibody. Our case shows that neuropathic pain may occur as the first and only manifestation of a VGKC complex autoimmunity disorder. VGKC antibody titers might be an indication of pain severity. Steroids coupled with IVIG are effective, but relapse may still occur.

IntroductionForests are closely linked to human health, particularly about lung cancer incidence. However, there is currently limited research on how forest coverage and different types of forests influence lung cancer rates. This study aims to address this gap by examining how the coverage of various forest types impacts lung cancer incidence in Southwest China, thereby providing theoretical support for health-oriented forest structure planning.MethodsWe focused on 438 counties in Southwest China, employing spatial autocorrelation analysis (Moran’s I) and spatial regression models [including Spatial Lag Model (SLM), Spatial Error Model (SEM), and Spatial Durbin Model (SDM)] to explore the effects of forest coverage and internal forest structure on lung cancer incidence. We used ArcGIS to visualize lung cancer incidence and forest coverage rates across the study area.ResultsThe study found a significant negative correlation between forest coverage and lung cancer incidence. Specifically, for every 1% increase in forest coverage, lung cancer incidence decreased by 0.017 levels. Evergreen forests and mixed forests showed a significant negative impact on lung cancer rates, with evergreen forests having a particularly strong effect; a 1% increase in evergreen forest coverage was associated with a 0.027 level decrease in lung cancer incidence. In contrast, deciduous forests had no significant impact. Additionally, the study revealed a marked spatial heterogeneity in lung cancer incidence and forest coverage across Southwest China: higher lung cancer rates were observed in the eastern regions, while forest coverage was predominantly concentrated in the western and southern regions.DiscussionThis study demonstrates that increasing forest coverage, particularly of evergreen and mixed forests, can help reduce lung cancer incidence. This effect may be related to the ability of forests to absorb harmful gasses and particulate matter from the air. Furthermore, the spatial heterogeneity in lung cancer incidence suggests that regional economic development levels and urbanization processes may also play significant roles in the spatial distribution of lung cancer rates. The findings provide empirical support for the development of targeted forest conservation and development policies aimed at optimizing regional forest structures to reduce the risk of lung cancer.

β-nicotinamide mononucleotide (NMN) is a naturally occurring biologically active nucleotide widely present in organisms and an inherent substance in the human body. As a critical intermediate in synthesizing coenzyme I (NAD+), it widely participates in multiple biochemical reactions in the human body and is closely related to immunity, metabolism, and other factors. In recent years, NMN has rapidly developed and made significant progress in medicine, food, and healthcare. However, there is currently a lack of comprehensive reports on the research progress of NMN, as well as exploration and analysis of the current research achievements and progress of NMN. Therefore, this review is based on retrieving relevant research on NMN from multiple databases at home and abroad, with the retrieval time from database establishment to 20 May 2024. Subsequently, literature search, reading, key information extraction, organization, and summarization were conducted with the aim of providing a comprehensive and in-depth analysis of the characteristics, metabolic pathways, pharmacological effects, progress in human clinical trials, and wide applications of NMN in drug development and food applications. Furthermore, it offers personal insights into NMN’s potential future developments and advancements to present the current development state and existing challenges comprehensively. Ultimately, this review aims to provide guidance and serve as a reference for the future application, innovation, and progression of NMN research.

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.

Rice (Oryza sativa L.) is one of the most extensively farmed food crops, but its development and productivity are significantly impacted by cold stress during the budding period. In this study, transcriptome sequencing was conducted on two types of rice: the cold-sensitive indica rice A117 and the substantially cold-tolerant japonica rice B106 under control and cold treatments. Differentially expressed genes between the two materials under cold conditions were analyzed using GO and KEGG enrichment analyses. The results revealed that processes such as the TCA cycle, glycolysis/glycogenesis, oxidative phosphorylation, and glutathione metabolism contribute to B106's cold tolerance. Additionally, an enrichment analysis of cold-induced genes in each material and shared genes identified significant enrichment in pathways such as glutathione metabolism, phenylpropanoid biosynthesis, and photosynthesis-antenna proteins. Initial cold tolerance QTLs at the rice bud stage were collected from published literature, and meta-QTL mapping identified 9 MQTLs. Gene expression profiling led to the identification of 75 potential DEGs within the 9 MQTLs region, from which four candidate genes (Os02g0194100, Os03g0802500, Os05g0129000, and Os07g0462000) were selected using qRT-PCR and gene annotation. These findings provide genetic resources for further research on the molecular mechanisms underlying rice's response to cold stress during the bud stage.

Objective Patients with systemic lupus erythematosus (SLE) have an increased risk of cardiovascular and cerebrovascular events (CCEs). Furthermore, CCE was a significant factor contributing to mortality in patients with SLE. However, no clinical model exists that can predict which patients are at high risk. The purpose of this study was to develop a practical model for predicting the risk of CCE in people with SLE.Methods This study was based on the Chinese SLE Treatment and Research Group cohort. A total of 2399 patients, who had a follow-up period of over 3 years and were diagnosed with SLE for less than 1 year at the start of the study, were included. Cox proportional hazards regression and least absolute shrinkage and selection operator regression were used to establish the model. Internal validation was performed, and the predictive power of the model was evaluated.Results During the follow-up period, 93 patients had CCEs. The prediction model included nine variables: male gender, smoking, hypertension, age of SLE onset >40, cutaneous involvement, arthritis, anti-β2GP1 antibody positivity, high-dose glucocorticoids and hydroxychloroquine usage. The model’s C index was 0.801. Patients with a prognostic index over 0.544 were classified into the high-risk group.Conclusion We have developed a predictive model that uses clinical indicators to assess the probability of CCE in patients diagnosed with SLE. This model has the ability to precisely predict the risk of CCE in patients with SLE. We recommended using this model in the routine assessment of patients with SLE.

To reduce the environmental pollution caused by organic solvents and improve the extraction efficiency, a green and high-effective natural deep eutectic solvent (NADES) was screened out and prepared for the extraction of flavonoids from Fructus aurantii based on the COMOS-RS and experimental verification. The results showed the results of theoretical screening and experimental verification were consistent, and Ch-Lea was the best extraction solvent, which further proved the COMOS-RS was an efficient tool for the solvent screening. Then, the extraction conditions were investigated. The optimum extraction conditions were as follows: molar ratio (1:2), water content (30%), solid–liquid ratio (1/60 g/g) and extraction time (15 min), yet the extraction temperature and power did not significantly affect the extraction yield. Under the optimal extraction condition, the extraction yield of flavonoids was 122.68 mg/g. Compared with the traditional extraction solvents (methanol and ethanol), Ch-Lea has a higher extraction yield. And the green assessment was conducted based on Eco-Scale methodology, which results indicated the Ch-Lea was more environmentally friendly than methanol and ethanol. Meanwhile, the Ch-Lea has good reusability, and the extraction yields from four reuses were 122.68 mg/g, 125.13 mg/g, 122.56 mg/g and 105.63 mg/g, respectively. Moreover, the extraction mechanism was delved into using molecular dynamics (MD) simulation and reduced density gradient (RDG) analysis. The hydrogen bond interaction, particularly the O-H bonds, between Ch-Lea and the naringin molecule emerged as the primary force driving the extraction process. In summary, Ch-Lea is a green, economical, and highly effective solvent, making it a promising candidate for flavonoid extraction from Fructus aurantii. Its potential as an alternative to traditional extraction solvents further underscores its value.

Activated carbon is employed for the adsorption of organic micropollutants (OMPs) from water, typically present in concentrations ranging from ng L−1 to μg L−1. However, the efficacy of OMP removal is considerably deteriorated due to competitive adsorption from background dissolved organic matter (DOM), present at substantially higher concentrations in mg L−1. Interpreting the characteristics of competitive DOM is crucial in predicting OMP adsorption efficiencies across diverse natural waters. Molecular weight (MW), aromaticity, and polarity influence DOM competitiveness. Although the aromaticity-related metrics, such as UV254, of low MW DOM were proposed to correlate with DOM competitiveness, the method suffers from limitations in understanding the interplay of polarity and aromaticity in determining DOM competitiveness. Here, we elucidate the intricate influence of aromaticity and polarity in low MW DOM competition, spanning from a fraction level to a compound level, by employing direct sample injection liquid chromatography coupled with ultrahigh-resolution Fourier-transform ion cyclotron resonance mass spectrometry. Anion exchange resin pre-treatment eliminated 93% of UV254-active DOM, predominantly aromatic and polar DOM, and only minimally alleviated DOM competition. Molecular characterization revealed that nonpolar molecular formulas (constituting 26% PAC-adsorbable DOM) with medium aromaticity contributed more to the DOM competitiveness. Isomer-level analysis indicated that the competitiveness of highly aromatic LMW DOM compounds was strongly counterbalanced by increased polarity. Strong aromaticity-derived π-π interaction cannot facilitate the competitive adsorption of hydrophilic DOM compounds. Our results underscore the constraints of depending solely on aromaticity-based approaches as the exclusive interpretive measure for DOM competitiveness. In a broader context, this study demonstrates an effect-oriented DOM analysis, elucidating counterbalancing interactions of DOM molecular properties from fraction to compound level.

The digital twins concept enhances modeling and simulation through the integration of real-time data and feedback. This review elucidates the foundational elements of digital twins, covering their concept, entities, domains, and key technologies. More specifically, we investigate the transformative potential of digital twins for the wastewater treatment engineering sector. Our discussion highlights the application of digital twins to wastewater treatment plants (WWTPs) and sewage networks, hardware (i.e., facilities and pipes, sensors for water quality and activated sludge, hydrodynamics, and power consumption), and software (i.e., knowledge-based and data-driven models, mechanistic models, hybrid twins, control methods, and the Internet of Things). Furthermore, two cases are provided, followed by an assessment of current challenges in and perspectives on the application of digital twins in WWTPs. This review serves as an essential primer for wastewater engineers navigating the digital paradigm shift.

Fast homogenization without incipient melting is the key to designing solution heat treatment (SHT) process for single crystal superalloys. In this paper, a multicomponent phase-field model coupled with solidus temperature is developed for dynamically tracking incipient melting temperature, TIM, of alloy during SHT. The simulation process runs completely automatically only by inputting the composition information of as-cast specimen. Based on the obtained TIM-time profile, the holding temperature and the time of SHT are determined. Applying this approach to Co–30Ni–11Al–4W–1Ta–4Ti–5Cr single crystal specimen, a gradual increased TIM from 1247 °C to 1293 °C within 72,000 s is obtained, and thus a stepwise SHT process with a short time of less than 20 h is designed. The experimental verification shows that after SHT, the segregation coefficient of the slowest diffusing element W decreased from more than 2 to 1.065, the content of harmful secondary phase has decreased to below 0.1%, and no incipient melting occurs.

Abstract Background Current research on the doctor-patient relationship primarily focuses on the responsibilities of doctors, with relatively less emphasis on examining the contributions patients can make. As a result, there is an urgent demand for exploring innovative approaches that highlight the active role patients play in cultivating a robust doctor-patient relationship. The purpose of this study was to devise an intervention strategy centered around patients to enhance the doctor-patient relationship. Comics were developed to depict shared narratives encompassing challenging daily life experiences between doctors and ordinary individuals. The study aimed to assess the efficacy of this approach in cultivating positive attitudes toward doctors. Method A 3-group design trial was conducted in Shanghai, China. A total of 152 participants were randomly assigned to one of three conditions: the parallel presenting group (n = 51), where narratives about a doctor and an ordinary employee were presented side by side in comics; the single presenting group (n = 50), where only narratives about a doctor were presented; and the control group (n = 51). The outcomes assessed in this study encompassed changes in identification with the doctor portrayed in the comics, perceived intimacy between doctors and patients in reality, and appraisal of the doctor in a prepared doctor-patient interaction situation. Results The parallel presenting group exhibited significantly larger increases in identification with the doctor portrayed in the comics, perceived intimacy between doctors and patients in reality, and appraisal of the doctor in a prepared doctor-patient interaction scenario compared to the single presenting group. The observed enhancements in the appraisal of the doctor in a prepared doctor-patient interaction scenario can be attributed to the changes in identification with the doctor portrayed in the comics experienced by the participants. Conclusion Our study responds to the doctor-centric focus in existing research by exploring patients’ contributions to the doctor-patient relationship. Using comics to depict shared narratives, the parallel presenting group demonstrated significantly increased identification with the depicted doctor, perceived intimacy, and positive appraisal in prepared scenarios compared to the single presenting group. This underscores the effectiveness of patient-centered interventions in shaping positive attitudes toward doctors, highlighting the pivotal role patients play in fostering a resilient doctor-patient relationship. Trial registration Chinese Clinical Trail Registry: ChiCTR2400080999 (registered 20 February 2024; retrospectively registered).

The sudden onset of the coronavirus disease 2019 (COVID-19) in January 2020 has affected essential global health services. Cancer-screening services that can reduce cancer mortality are strongly affected. However, the specific role of COVID-19 in cancer screening is not fully understood. This study aimed to assess the efficiency of global cancer screening programs before and during the COVID-19 pandemic and to promote potential cancer-screening strategies for the next pandemic. Electronic searches in PubMed, Embase, and Web of Science, and manual searches were performed between January 1, 2020 and March 1, 2023. Cohort studies that reported the number of participants who underwent cancer screening before and during the COVID-19 pandemic were included. The methodological quality of the included studies was assessed using the Newcastle-Ottawa Scale. Differences in cancer-screening rates were estimated using the incidence rate ratio (IRR). Fifty-five cohort studies were included in this meta-analysis. The screening rates of colorectal cancer using invasive screening methods (Pooled IRR = 0.52, 95% CI: 0.42 to 0.65, p < 0.01), cervical cancer (Pooled IRR = 0.56, 95% CI: 0.47 to 0.67, p < 0.01), breast cancer (Pooled IRR = 0.57, 95% CI: 0.49 to 0.66, p < 0.01) and prostate cancer (Pooled IRR = 0.71, 95% CI: 0.56 to 0.90, p < 0.01) during the COVID-19 pandemic were significantly lower than those before the COVID-19 pandemic. The screening rates of lung cancer (Pooled IRR = 0.77, 95% CI: 0.58 to 1.03, p = 0.08) and colorectal cancer using noninvasive screening methods (Pooled IRR = 0.74, 95% CI: 0.50 to 1.09, p = 0.13) were reduced with no statistical differences. The subgroup analyses revealed that the reduction in cancer-screening rates varied across economies. Our results suggest that the COVID-19 pandemic has had a noteworthy impact on colorectal, cervical, breast, and prostate cancer screening. Developing innovative cancer-screening technologies is important to promote the efficiency of cancer-screening services in the post-COVID-19 era and prepare for the next pandemic.

Abstract Introduction Real-world data on the efficacy of risankizumab (RZB) in clinical moderate-to-severe plaque psoriasis (PsO) are limited. The RAPID study assessed real-world clinical and patient-reported outcomes in RZB-treated PsO patients using data collected from dermatologists in Canada, the Czech Republic, Germany, Japan, and Poland. Methods This ongoing, retrospective chart review collected data from medical records of RZB-treated adults with moderate-to-severe PsO (09/2022–06/2023). Eligible patients received RZB, had ≥ 12 months of medical records after RZB initiation (index date), and had Psoriasis Area and Severity Index (PASI), Investigator Global Assessment (IGA), or static Physician’s Global Assessment (sPGA) scores ≥ 3 months before and up to 18 months after the index date. The proportion of patients achieving a clear/almost clear PsO (IGA/sPGA = 0/1), PASI ≤ 1, Dermatology Life Quality Index (DLQI) = 0/1, and a 90%/100% improvement from baseline in PASI as well as the mean changes in PASI, DLQI, itch, and skin pain scores at 12 and 18 months were reported for patients with non-missing assessments at baseline and 12 months. Results Most patients (66.4%) were male, 74.0% were biologic naïve, and 73.0% had scalp PsO. Mean baseline IGA/sPGA was 3.7 ± 0.5, with a mean PASI of 23.3 ± 11.8. After 12 months, 86.1% of patients reported IGA/sPGA ≤ 1, and 75.7% achieved PASI90; these further increased to 91.1% and 80.5% at 18 months. DLQI, itch, and skin pain scores improved over time. Conclusions These data demonstrated the durable, real-world effectiveness of RZB in patients with moderate-to-severe PsO through continued improvement in disease and symptom severity over 18 months, with most of the patients reporting clear/almost clear skin.

Abstract Emerging evidence shows that FAT atypical cadherin 1 (FAT1) mutations occur in lymphoma and are associated with poorer overall survival. Considering that diffuse large B cell lymphoma (DLBCL) is the category of lymphoma with the highest incidence rate, this study aims to explore the role of FAT1 in DLBCL. The findings demonstrate that FAT1 inhibits the proliferation of DLBCL cell lines by downregulating the expression of YAP1 rather than by altering its cellular localization. Mechanistic analysis via meRIP-qPCR/luciferase reporter assays showed that FAT1 increases the m6A modification of YAP1 mRNA 3′UTR and the subsequent binding of heterogeneous nuclear ribonucleoprotein D (HNRNPD) to the m6A modified YAP1 mRNA, thus decreasing the stability of YAP1 mRNA. Furthermore, FAT1 increases YAP1 mRNA 3′UTR m6A modification by decreasing the activity of the TGFβ-Smad2/3 pathway and the subsequent expression of ALKBH5, which is regulated at the transcriptional level by Smad2/3. Collectively, these results reveal that FAT1 inhibits the proliferation of DLBCL cells by increasing the m6A modification of the YAP1 mRNA 3’UTR via the TGFβ-Smad2/3-ALKBH5 pathway. The findings of this study therefore indicate that FAT1 exerts anti-tumor effects in DLBCL and may represent a novel target in the treatment of this form of lymphoma.