Search

Bacterial lipid macroamphiphiles extracted with phenol/water can be purified in one step by hydrophobic interaction chromatography. Lipids and the major part of protein are separated from macroamphiphiles during phenol/water extraction. Coextracted nucleic acids, polysaccharides, and residual protein are effectively removed by column chromatography on octyl-Sepharose whereby macroamphiphiles are primarily adsorbed and later eluted with a buffered propanol gradient. The procedure is applicable to macroamphiphiles with various lipid structures as was demonstrated using the diacylglycerol-containing lipoglycan of Micrococcus luteus, the lipid A-containing lipopolysaccharide of Salmonella typhimurium, and the diglyceryl tetraether lipoglycans of Thermoplasma acidophilum and Thermoplasma volcanicum. On elution from octyl-Sepharose, separation into molecular species of different compositions was observed with the lipopolysaccharide of S. typhimurium and the lipoglycan of T. volcanicum. It was also shown that, after phenol/water extraction, membrane lipids are completely recoverable from the phenol layer, which makes it possible to isolate lipids along with macroamphiphiles from the same sample of bacteria.

Isolated from Micrococcus lysodeikticus, 6-O-(2-deoxy-2-(N-methyl)hydroxilamino-beta-D-glucopyranosyl)-alph a-alpha- trehalose (lysodektose) is oxidized by K3Fe(CN)6 in a stepwise manner to become a nitroxyl radical and a nitrone with a double bond in the fragment O-N = CH2 which could be reduced to the original hydroxylamine form with sodium borohydride. Thus derivatives of lysodektose specifically labelled with 2H and (or) 3H in the methyl group are easily obtained. When oxidized in cells poisoned with vitamin K analogues, lysodektose is transformed into nitrone concomitant with modification of its methyl group. Participation in the antioxidant defence of the bacteria is suggested for this new trisaccharide.

Teichuronic acid released from its phosphodiester linkage to peptidoglycan in the cell walls of Micrococcus luteus by mild acid treatment is resolved into a ladderlike series of bands by electrophoresis on polyacrylamide gels in the presence of borate. Each band of the ladder differs from its nearest neighbor by one disaccharide repeat unit, ----4)-2-acetamido-2-deoxy-beta-D-mannopyranuronosyl-(1----6)- alpha-D-glucopyranosyl-(1-. Acid-fragmented teichuronic acid, after conversion to the phenylamine derivative, was fractionated by preparative-scale molecular sieve column chromatography, which produced a series of elution peaks. Fast-atom-bombardment mass spectrometry of the smallest member of the series determined its molecular weight and established its identity as the phenylamine derivative of one disaccharide repeat unit of teichuronic acid. Homologous fractions of the same series were used to index the ladder of bands obtained by polyacrylamide gel electrophoresis from samples containing a more extensive distribution of polymer lengths. Nearly native teichuronic acid consists of polymers with a broad range of molecular sizes ranging from 20 to 55 disaccharide units. The most abundant species are those which have 25 to 40 repeat units. Prolonged treatment of teichuronic acid with the acid conditions used to release it from peptidoglycan causes gradual fragmentation of the teichuronic acid.

Teichuronic acid-peptidoglycan complex isolated from Micrococcus luteus cells by lysozyme digestion in osmotically stabilized medium was treated with mild acid to cleave the linkage joining teichuronic acid to peptidoglycan. This labile linkage was shown to be the phosphodiester which joins N-acetylglucosamine, the residue located at the reducing end of the teichuronic acid, through its anomeric hydroxyl group to a 6-phosphomuramic acid, a residue of the glycan strand of peptidoglycan. 31P nuclear magnetic resonance spectroscopy of the lysozyme digest of cell walls demonstrated the presence of a phosphodiester which was converted to a phosphomonoester by the conditions which released teichuronic acid from cell walls. Reduction of acid-liberated reducing end groups by NaB3H4 followed by complete acid hydrolysis yielded [3H] glucosaminitol from the true reducing end residue of teichuronic acid and [3H]glucitol from the sites of fragmentation of teichuronic acid. The amount of N-acetylglucosamine detected was approximately stoichiometric with the amount of phosphate in the complex. Partial fragmentation of teichuronic acid provides an explanation of the previous erroneous identification of the reducing end residue.

The composition of polyamines is studied for the first time in representatives of the genus Micrococcus and taxon "conglomeratus", strains Staphylococcus aureus CCM 209, Deinococcus erythromyxa CCM 706 as well as of Erwinia carotovora ATCC 15713 polyamines, which are not extracted by perchloric acid. Considerable amounts of spermine and rarely of spermidine are revealed in cells of Gram positive microorganisms, that differs them from Gram negative bacteria possessing high concentrations of putrescine, spermidine and their derivatives. A procedure is developed for detection of polyamines in cells of Gram positive microorganisms. It is recommended to use the hydrolysis of their cells by 6N HCl for 4 at 120 degrees C or for 8-10h at 100 degrees C with the subsequent electrophoretic separation. Putrescine, as well as comparable with it amount of agmatine and spermidine traces are found in Erwinia carotovora ATCC 15713 cell hydrolyzates, whereas putrescine and agmatine traces are found in perchloric extracts of intact cells. Spermine is not observed in the cells. The binding of polyamines with biopolymers of cells of Gram positive bacteria and their difference by the given character from the Gram negative procaryotes are under discussion.

Cell packets (MT packets) induced from a tetrads-forming mutant (strain MT) of Micrococcus luteus, both treated with chemical reagents and non-treated, were observed with a scanning electron microscope (SEM). The agglutinability of MT packets with antiserum containing anti-teichuronic acid antibody was examined. The binding of protein A-gold particles to the MT packets, mediated with the antiserum, was also observed with SEM. Gold particles were observed uniformly on the whole packet surface and also on the bridging structure formed by the outermost layer of the cell wall. Mild acid treatment, NaIO4-NaBH4 treatment and mild Smith degradation of the MT packets extremely decreased the agglutinability and binding of protein A-gold particles. The treatments gave a little influence on the surface feature and appreciably destroyed the regular packet structure. It was supposed that teichuronic acids distributed uniformly on the whole packet surface, naturally on the surface of the bridging structure too, and appreciably participated in the maintenance of the regular packet structure.

9-(2-Anthryl)-nonanoic acid, a newly synthesized photoactivable molecule, is shown to be incorporated into the membrane lipids of the bacterium Micrococcus luteus, through the regular metabolic pathway. This incorporation, which occurs at the sn-1 position exclusively and without any degradation or elongation of the anthracene fatty acid, is accompanied by an upward shift of the chain length of the other fatty acids.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Hot and cold, 80% aqueous phenol extraction procedures together with an aqueous extraction technique have been evaluated for the isolation of lipoteichoic acids from the cytoplasmic membrane of Gram-positive bacteria. Lipoteichoic acids of Staphlococcus aureus H, Micrococcus 2102, Baccillus subtilis 168, and Bacillus subtilis W-23 were examined as each of them emphasises a different problem of contamination. The purity of the lipoteichoic acids with respect to cell-wall material, nucleic acid, and protein is discussed together with the criteria of purity which enables critical structural analysis of lipoteichoic acids to be carried out.

In an attempt to elucidate the relation between Micrococcus cryophilus, Neisseria caviae, Neisseria ovis, and Branhamella catarrhalis, fractions derived from outer membranes of a strain of each organism were examined for protein composition by SDS - polyacrylamide gel electrophoresis. Micrococcus cryophilus outer membrane protein showed extensive similarities to that of N. ovis and contained a heat-modifiable protein which behaved almost identically with the corresponding bands previously shown to exist in N. caviae and N. ovis. Branhamella catarrhalis protein was distinctly different from those of M. cryophilus and the two 'false neisserias' N. caviae and N. ovis.

The integral protein of cytochrome b556 after its solubilization with Triton X-100 from M. lysodeikticus membranes was studied. The cytochrome was found in complexes differing in charge and size during preparative gel electrophoresis and centrifugation in a sucrose concentration gradient. Cytochrome b556, being in complexes, retains its ability to be reduced by NADH dehydrogenase. The electron micrographs of the membranes after solubilization by Triton X-100 demonstrated the maintenance of the membrane structure. It is concluded that native protein complexes marked with cytochrome b556 are extracted from the membranes under their solubilization.

Low temperature microspectrofluorometry allows an improvement of spectral resolution and an increase of fluorescence intensity. Suppression of fluorescence fading, or at least a marked reduction, is also obtained. A cooling chamber for microspectrofluorometric measurement is described which allows the cooling, under a microscope, of a biological sample down to liquid nitrogen temperature. Objectives with numerical apertures better than 1.0 and a magnification power up to 100X can be used. Low temperature measurements on a histological sample are presented and discussed.

Micrococcus luteus IFO 3333 cells, both treated with chemical reagents and non-treated, were observed with a scanning electron microscope (SEM). The agglutinability of the cells with antiserum containing anti-teichuronic acid antibody was examined. The binding of protein A-gold particles to the cells, mediated with the antiserum, was also observed with SEM. The surface of a M. luteus cell consisted of two or three areas with borders--the rough and the smooth areas, or the rough, the slightly rough, and the smooth areas; fluffy materials were clearly seen in the rough area. Gold particles were observed uniformly and densely on the whole cell surface. However, either mild acid treatment or mild Smith degradation of the cells altered the fluffy rough area to a rough one, and extremely decreased the agglutinability and the binding of protein A-gold particles. Teichuronic acids appeared to be distributed uniformly on the whole cell surface of M. luteus IFO 3333.

The DNA homology relationships of 25 micrococci (15 strains of Micrococcus, eight strains of Sarcina and two strains of Staphylococcus) were studied by the deoxyribonucleic acid hybridization method using nuclease S1, an endonuclease specific for single-stranded DNA molecules. Nineteen of the strains were classified into three groups. Group I contained Micrococcus lysodeikticus IAMI056, M. luteus IAMI1010, M. flavus IAMI2005 and IAMI2006, Sarcina flava IAMI2007 and IAMI1006. S. subflava IAMI2009, S. lutea ATCC381, and ATCC382, and M. luteus IAMI1006. Group II contained M. roseus IAMI315, ATCC412, ATCC185 and IAMI295. Group III contained S. lutea IAMI099, IFO3232 and ATCC383, M. varians ATCC399 and Staphylococcus lactis ATCC15306. Micrococcus luteus IAMI097, M. varians ATCC19099 and ATCC19100, M. conglomeratus IAMI459 and IAMI470, and St. aureus IAMI011 could not be assigned to any of the three groups. The grouping corresponds to that derived from the results of differential lysis by lysozyme, 'lytic enzyme 2' from Cytophaga sp., or Streptomyces albus G enzyme; and to types of peptidoglycan in the cell walls and genetic transformation. The usefulness of classification based on sensitivity to various lytic enzymes was demonstrated. Group I probably coincides with M. luteus of Bergey's Manual of Determinative Bacteriology (1974), and groups II and III with M. roseus and M. varians respectively.

A new sensitive, rapid and simple method for lysozyme assay is described which is based on either fluorescence polarization or fluorescence intensity using fluorescein-labeled peptidoglycan as a substrate. The peptidoglycan was obtained from Micrococcus lysodeikticus after extensive digestion with Pronase and washing with Triton X-100 followed by various solvents. Subsequently, it was labeled with fluorescein isothiocyanate (FITC) at the amino group of the peptide. When the FITC-labeled substrate was subjected to lysozyme digestion, an increase of fluorescence intensity or a decrease of fluorescence polarization value (P value) was apparent in five minutes at a lysozyme concentrations as low as 0.1 or 0.01 micrograms/ml, respectively. The effect of other hydrolytic enzymes including alpha-mannosidase, proteases and RNase on the P value was found to be negligible. The measured values represented the specificity and dose of lysozyme added. Apparent Vmax and Km values for two different lysozymes, chicken egg white and human, could be determined by this method.

Using immunoelectrophoresis, the antigenicity of various protein fractions of the Micrococcus lysodeikticus membranes was evaluated. It was shown that both the peripheral and integral membrane proteins possess the antigenic determinants. The antiserum exhausted by the M. lysodeikticus mebranes loses its ability to interact with intergral proteins, which are not solubilized by Triton X-100. It was thus assumed that the integral proteins are exposed on the membrane surface constantly or periodically and that there exist no proteins which are completely and permanently incorporated into the lipid bilayer. The respiratory chain of the M. lysodeikticus membrane is inhibited by membrane immunoglobulins by 50%. This is probably due to the presence in the membrane antiserum of antibodies specific to the respiratory chain enzymes. Evidence for this assumption can be derived from the fact that partially purified cytochrome b556 forms a precipitation zone with the membrane antiserum and that the activity of membrane NADH-dehydrogenase is inhibited by a monoserum against NADH-dehydrogenase.

Extraction of phospholipids from stationary phase grown cells of the Gram+ bacteria, Bacillus megaterium, Bacillus subtilis, Bacillus cereus and Micrococcus lysodeikticus was found to be incomplete with various commonly used extraction procedures. Phosphatidylglycerol and phosphatidylethanolamine were readily extracted but up to 95% of the cardiolipin appeared to be retained within the cell residue. Extraction of the cardiolipin could be slightly enhanced by increasing the temperature or the acidity of the extraction solutions but complete extraction was obtained only after lysozyme treatment of intact cells or cell residues remaining after extraction. In addition complete extraction could be observed in the case of cells harvested in the early logarithmic phase. Freeze-fracture electron microscopy was carried out on the cell residue remaining after extraction of all phospholipids except cardiolipin. A fracture plane through the plasma membrane could not be observed anymore. Instead fracture planes through lipid vesicles were observed. These vesicles reside within the remnants of the cytoplasm and consist most likely of the non-extracted cardiolipin.

A fraction of hydrophobic proteins (9, 14, 18 kD) soluble in a chloroform-methanol mixture (2:1) has been isolated from Micrococcus lysodeikticus bacterial membranes. The proteins obtained were introduced into proteoliposomes at a protein/lipid weight ratio ranging from 0.1 to 0.25 in combination with the fluorescent probe pyrene or the spin probe 2-(14-carboxytetradecyl)-2-ethyl-4.4-dimethyl-3-oxasolidinyloxyl. The excimertization of pyrene upon direct excitation of its molecules (gamma excit.=338nm) and under conditions of energy transfer from the excited protein chromophores to pyrene (gamma excit.=286nm) and the spin-spin exchange between the spin probe molecules was investigated. The experimental results suggest that the hydrophobic protein molecules are surrounded by a structurally heterogenous lipid area containing up to 3.3 mg of lipid per l mg of protein. The maximal expression of structural heterogeneity was observed at the minimal content of protein in the proteoliposomes. Treatment with the membranotropic antibiotic gramicidin S resulted in disappearance of lateral heterogeneity of lipids in the constituted system and in lipid aggregation in bacterial membranes. It is assumed that the aggregability of membrane proteins depends on the structural rearrangement of some part of lipid bilayer around them.

Studies were carried out on lipid composition of Micrococcus radiodurans. The polar lipid components were found to be 4 glycolipids, 3 phospholipids and 2 phosphoglycolipids. The major fraction belongs to the last group. Correlation between these components and lipoteichoic acid was not observed. A lipid-polysaccharidic complex was isolated. It was not of this type.

The external polysaccharide is a major component of Micrococcus lysodeikticus cell wall and displays distinct composition. The complete structure of the external polysaccharide had been elucidated as a basis for investigation of the cell wall structure-function relation. However, the mode of attachment of the polysaccharide to the peptidoglycan through a phosphodiester was not clear due to limitations in structural and biosynthetic studies. The present study describes purification of a lysozyme-resistant nondialyzable high-molecular-weight fragment of cell wall and identifies the sugar, D-glucose, as the point of external polysaccharide attachment to the peptidoglycan through a phosphate diester. Kinetic studies for the acid-catalyzed release of external polysaccharide from the peptidoglycan were performed in parallel with synthetic [methyl-2-acetamido-3-O-(D-1-carboxyethyl)-2-deoxy-alpha-D- glucopyranoside-6-yl]-alpha-D-glucopyranosyl phosphate and alpha-D-glucopyranosyl phosphate and showed the presence of a phosphodiester linkage between external polysaccharide and peptidoglycan. In addition, type of phosphate residue and cross-linking between muramic acid and protein part have been determined.

The occurrence of a specific high potential iron-sulfur protein in a halophilic, denitrifying coccus provisionally assigned to the genus Paracoccus has been confirmed through primary structure determination. This protein, known as "HiPIP", has been found previously only in photosynthetic bacteria. The sequence of this 71-residue protein is as similar to the HiPEPs from photosynthetic bacteria as they, in turn, are to one another (average number of identically matching residues is 38%). Paracoccus HiPIP is a highly acidic protein in accord with general observations on the proteins of halophilic bacteria. A possible explanation for its occurrence in Paracoccus is that gene transfer is involved.

The kinetics of proflavin binding to Micrococcus lysodeicticus deoxyribonucleic acid (DNA [(G-C) content 72%], to Bacillus megaterium DNA [(A-T) content 70%], and to the polydeoxyribonucleotides poly[d(G-C)] and poly[d(A-T)] was studied with fluorescence temperature-jump methods. Poly[d(A-T)] binds proflavin in a two-step reaction with a preequilibrium. Poly[d(G-C)] is characterized by a bimolecular reaction. The binding of acridines to natural DNAs is shown to be characterized by different types of sites whose properties depend on the base composition. The sites have considerable enthalpic differences which result in exchange of dye molecules between them when the temperature is changed. Also, on natural DNAs A-T base pairs are associated with a rapidly equilibrating external complex which is absent or much weaker for G-C base pairs.

Anti 5-methyl-cytidine antibodies might be useful agents for the detection and localization of 5-methyl-cytidine of nucleic acids, but only if the antibodies recognize this nucleoside with sufficient specificity. A conjugate containing 18 moles of 5-methyl-cytidine per mole of BSA was prepared and antibodies directed against this nucleoside hapten were produced by immunization of rabbits (as determined by gel diffusion in agar containing excessive amounts of the carrier). A slight crossreaction of cytidine-BSA was eliminated by adsorption on the cross-reacting antigen. Further purification of the antibodies was effected by chromatography on DEAE-Sephadex A-50 and a method for the rapid quantitation of the antibodies showed that 12.7% of the IgG protein are monospecific against 5-methyl-cytidine-BSA. Hydrolysis of antibodies with insolubilized papain produced monovalent Fab fragments which were identified by SDS-Disk-electrophoresis. A two stage method for cross linking the immunoproteins to ferritin by glutaraldehyde was used. The isolation of immunoferritin conjugates by Bio-Gel A 1.5 m column chromatography is described. The identification of the effluents was made by glycerin density gradient ultracentrifugation. The results were visualized by electron microscopy after the treatment of immunoferritin conjugates with (methylated and unmethylated) denaturated DNA, fractionation on the glycerine density gradient, and the spreading by a modification of drop technique.

Phase partition method in a two-phase polyethylene glycol-dextrane system has been applied to fractionation in Triton X-100 of hydrophobic membrane proteins from Micrococcus lysodeikticus. This method allowed to separate the cytochrome b556 from other cytochromes. Spectral and gel electrophoretic patterns of isolated cytochrome are given.

Different phospholipids, except the choline-containing phospholipids phosphatidylcholine, lysophosphatidylcholine, and sphingomyelin, formed complexes with the dye Victoria blue R, which selectively partitioned into the chloroform phase of chloroform/ethylene glycol/glycerol biphasic solvent system, and were quantitatively estimated at 590 nm. Considerable amounts of water, alcohols, nonlipid phosphates, neutral lipids, free fatty acids, and some detergents did not interfere with the formation of phospholipid-dye complexes. This special advantage of the method described allowed combined phospholipid extraction and estimation procedures in one test tube. Because of its high sensitivity (about 24.00 OD units/mumol of phosphatidic acid and about 10.25 OD units/mumol of other phospholipids), specificity, and simplicity, the proposed phospholipid assay appears to be very useful for rapid analyses of lipid extracts as well as TLC spots or suspensions of biological materials, as demonstrated for membranes and cells of Micrococcus lysodeikticus. The applicability of the dye Victoria blue B to the quantitative determination of phospholipids, except phosphatidylcholine, lysophosphatidylcholine, and sphingomyelin, at 605 nm using chloroform/ethylene glycol/glycerol/water and pentane (hexane)/ethyl acetate/isopropanol/water biphasic solvent systems with similar sensitivities and of sodium dodecyl sulfate in the pentane-containing system with high sensitivity (22.96 OD units/mumol) is also shown. The adaptation of this phospholipid assay to the determination of phospholipases C and D and to the differential quantitation of choline-containing phospholipids using additional phospholipid estimation techniques is discussed.

We investigated the methylation reaction catalyzed by 1500-fold purified rat liver DNA methyltransferase (DMase) on native Micrococcal luteus DNA (ML-DNA) and poly(dC-dG) templates containing covalently bound (+)-7 beta,8 alpha-dihydroxy-9 alpha,10 alpha-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (anti-BPDE), the strongly carcinogenic, principal metabolite of benzo[a]pyrene. Since eukaryotic DNA methyltransferases recognize the dinucleotide 5'd[CG] in DNA as a substrate for methylation, the model polynucleotide poly(dC-dG) was used to study in more detail the mode of interaction and effect on incorporation. With either of these BPDE-modified templates, a progressive inhibition of methylation was correlated with increasing amount of BPDE substitution. The effect of BPDE-dG adducts did not alter the apparent km with respect to the concentration of d[CG] in either unmodified or BPDE-modified poly(dC-dG) (km = 10 microM) but lowered the relative apparent Vmax. In assays in which perturbation by salt of preformed enzyme-DNA complex is measured, no change in the relative stability to either unsubstituted or the carcinogen-modified template was noted, thus, excluding any change in the ionic component of this interaction. However, in competition-type experiments, BPDE-DNA is an inhibitor of the methylation reaction on native DNA. When BPDE-DNA is allowed to interact with the enzyme before the addition of native competitor DNA, the methylation rate is not stimulated, suggesting very tight hydrophobic binding of the enzyme to BPDE-DNA and an inhibition in the dissociation of DMase from the template following a methylation event.(ABSTRACT TRUNCATED AT 250 WORDS)

Micrococcus lysodeikticus cell walls were digested with a pI 6.8 endo-N-acetylglucosaminidase or a pI 9.5 endo-N-acetylmuramidase. The digests were further treated with a N-acetylmuramyl-L-alanine amidase of Flavobacterium L-11 enzyme to remove the peptide portion. The products were fractionated by gel filtration and ion-exchange chromatography, and the glycan portion of fractions were analyzed for their average amino sugar chain lengths. The following results were obtained. 1. The glycan portion of the main products in the pI 6.8 enzyme digest consisted of (-N-acetylmuramic acid-N-acetyl-glucosamine-)2-3. 2. The glycan moiety of the pI 9.5 enzyme digest was mainly composed of (-N-acetylglucosamine-N-acetylmuramic acid-)3-4. 3. The glycosidic linkages around the muramic acid 6-phosphate residues which linked to a special structure through a phosphodiester bond were rather refractory to the glycosidase action of both pI 6.8 and 9.5 enzymes.

Studies of the lipid composition of the marine bacterium Caulobacter halobacteroides revealed the presence of glycolipid as the predominant lipid constituent. The presence of minor amounts of phospholipid was confirmed with the incorporation of 14C- and 32P-labeled compounds. Other marine caulobacters had similar lipid compositions. Five chromatographically separable glycolipids were detected, two of which were identified as mono- and diglycosyldiglycerides. Glycolipid constituted 90 to 99% of the total extractable lipid based on 14C-acetate incorporation into six marine caulobacter strains. In addition, comparisons were made with the lipid extracts of the nonmarine Caulobacter crescentus and Micrococcus lysodeikticus, which contain substantial amounts of phospholipid. Studies of lipid composition during growth showed the maximum amount of phospholipid during early logarithmic growth (2.9%) with a decrease to 0.3% in the early stationary phase. The finding of a group of organisms in which phospholipid is not a major constituent of the lipid fraction is unique and generates many questions about the lipid requirements for membrane structure and function.

Seven strains belonging to the family Micrococcaceae and possessing strong antagonistic properties against Staph. aureus and several other Gram-positive bacteria, have been isolated. The strains were characterized and identified, phage typed, tested for antibiotic-sensitivity and antagonistic activities. Two patients of inhibition were noted.

A new photo cross-linking method has been developed for the study of the lateral distribution of lipids in natural membranes, which uses anthracene as a photoactivable group. This method, which rests on the potentiality of anthracene to form covalently bound dimers upon irradiation around 340-380 nm has been applied to the membrane lipids (dimannosyl diacylglycerol, phosphatidylglycerol, phosphatidylinositol) of the bacterium Micrococcus luteus. These glyco- and phospholipids were anthracene labelled by metabolically incorporating the synthetic 9-(2-anthryl)nonanoic acid. The following sequential procedure was used: dimerization of the anthracene-labelled lipids in the membrane by irradiation of the intact cells at 360 nm; extraction of the lipids and thin-layer chromatography in the first dimension to separate the various lipid dimers from the monomers; partial dedimerization of the lipid dimers by illumination of the chromatogram at around 250-280 nm; chromatography in the second dimension to separate the native lipid monomers from the corresponding residual lipid dimers. On account of the occurrence of the 3 hetero dimers phosphatidylglycerol-dimannosyl diacylglycerol, phosphatidylinositol-dimannosyl diacylglycerol and phosphatidylglycerol-phosphatidylinositol after irradiating the cells, it is concluded that in this bacterial membrane, dimannosyl diacylglycerol, phosphatidylglycerol and phosphatidylinositol are homogeneously distributed.

The guanine-plus-cytosine (G + C) content of different species of Staphylococcus and Micrococcus was determined by high-performance liquid chromatography. Purified bacterial DNA was hydrolysed by nuclease P1. The nucleotides were separated by chromatography and quantified by measurement of the optical density at 260 nm. The G + C content of staphylococci ranged from 31.5 to 37.9 moles %, and that of micrococci from 68.7 to 75.2. Most of our results were comparable to those obtained with the thermal method.

The specificity of antibodies directed against the peptidoglycan of gram-negative bacteria was studied. The peptidoglycans of Proteus vulgaris, Escherichia coli, Moraxella glucidolytica, Neisseria perflava, give identical precipitin reactions. By means of inhibition studies with various peptidoglycan subunits and synthetic peptides, it was shown that the antibodies are essentially directed against the peptide moiety of the peptidoglycan: L-Ala-D-Glu (L)-mesoA2pm-(L)-D-Ala, that the peptide reacts better with antibodies when it is not cross-linked, and that the C-terminal portion-meso-A2pm-D-Ala of the peptide is immunodominant. These results explain the immunological identity of the peptidoglycans of gram-negative bacteria, which possess the same peptide subunit. Only weak cross-reactivity was observed with the peptidoglycans of gram-positive bacteria (Streptococcus faecium, Micrococcus lysodeikticus, Corynebacterium poinsettiae) where meso-diaminopimelic acid is replaced by L-lysine or L-homoserine. However, the peptidoglycan of Bacillus megaterium which possesses the same peptide subunit as gram-negative bacteria, gives only a reaction of partial identity with these bacteria. This result suggests the presence on the peptidoglycan of gram-negative bacteria, of other undefined antigenic determinants.

It was shown by the immunochemical method that DNA of X-irradiated E. coli cells of a radiosensitive mutant ABA88uvr A6 can react with the antiserum to thymine dimers which, in all appearance, are induced by ionizing radiation in bacterial DNA. The number of thymine dimers in DNA of E. coli AB1886uvr A6 increased with the dose increase. No dimers were detected in radioresistant cells of M. radioproteolyticus probably due to the effective excision thereof.

Ghosts of Micrococcus lysodeikticus contain a mannan that is not removed by intensive washing procedures. Purified mannan, isolated by extraction of whole cells with hot, aqueous phenol, binds to membranes in vitro. Mannan also binds to DEAE-cellulose and migrates toward the anode in neutral and sodium dodecyl sulfate disc gel electrophoresis. In aqueous solution mannan has an apparent molecular weight of 10-6, but in the presence of sodium dodecyl sulfate its apparent molecular weight is 50,000 to 100,000; removal of the detergent results in reaggregation. Purified mannan contains mannose, succinate, fatty acid, and glycerol in a ratio of 50:4.9:2.1:1.0. Treatment of mannan with mild base produces a neutral, hydrophilic polysaccharide of relatively low molecular weight that has no affinity for membranes. At least 90% of the reducing termini are blocked in a base-stable linkage. Based on these results a tentative structure is proposed for the mannan.