Search

Background: Dengue is known as the most severe arboviral infection in the world spread by Aedes aegypti. However, conventional and laboratory-based enzyme-linked immunosorbent assays (ELISA) are the current approaches in detecting dengue virus (DENV), requiring skilled and well-trained personnel to operate. Therefore, the ultrasensitive and label-free technique of the Silicon Nanowire (SiNW) biosensor was chosen for rapid detection of DENV. Methods: In this study, a SiNW field-effect transistor (FET) biosensor integrated with a back-gate of the low-doped p-type Silicon-on-insulator (SOI) wafer was fabricated through conventional photolithography and Inductively Coupled Plasma – Reactive Ion Etching (ICP-RIE) for Dengue Virus type-2 (DENV-2) DNA detection. The morphological characteristics of back-gated SiNW-FET were examined using a field-emission scanning electron microscope supported by the elemental analysis via energy-dispersive X-ray spectroscopy. Results and Discussion: A complementary (target) single-stranded deoxyribonucleic acid (ssDNA) was recognized when the target DNA was hybridized with the probe DNA attached to SiNW surfaces. Based on the slope of the linear regression curve, the back-gated SiNW-FET biosensor demonstrated the sensitivity of 3.3 nAM-1 with a detection limit of 10 fM. Furthermore, the drain and back-gate voltages were also found to influence the SiNW conductance changed. Conclusion: Thus, the results obtained suggest that the back-gated SiNW-FET shows good stability in both biosensing applications and medical diagnosis throughout the conventional photolithography method.

A stable truncated 2’ fluoro-RNA aptamer contributes to the upstream interruption of the blood coagulation pathway by selectively binding with factor IX protein (FIX). This work followed a rational method for virtually analyzing structural orientation and binding interactions between aptamer and FIX. Three possible aptamer models from the same sequence were designed and evaluated for optimum binding with FIX. Molecular docking was performed to find a prime docking domain and the best docking conformation for a stable aptamer-FIX complex. Possible interactions are observed at PRO126-U9, LYS125-U9, LYS122-A7, ARG116-U9, GLY102-G22, THR101-G22, GLN74-G6, GLY60-G5, CGU36-U11, CGU40-A12, and ASP49-A10. A molecular dynamic simulation assessed the strength of the interaction between aptamer and FIX. It was revealed that the aptamer was effectively bound with the average amino acid fluctuation of 1 A. The complex reached equilibrium within ten ns during the initial phase of the simulation and then remained stable over 100 ns. B factor analysis showed a moderate atomic displacement from the crystal structure, except at N-terminal from atom 2247-5938. Principal component analysis of post-dynamic trajectories further revealed the stability by the arrayed orientation of amino acids dihedral angles. Overall, 2’ fluoro-RNA aptamer exhibits stronger stability in their interaction with FIX. Noteworthy, the aptamer's stability as an inhibitor to deactivate the clotting cascade by specifically binding with epidermal growth factor-like (EGF) 1 and 2 domains was evidenced.

This research reports a new approach with lectin-based capacitive non-faradaic biosensor for the detection of prostate-specific membrane antigen (PSMA) as a promising diagnostic marker for determining prostate cancer. PSMA expression is significantly higher in malign hyperplasia, thus can be effectively employed to discriminate other benign prostatic diseases. Herein, the aluminium interdigitated electrode was fabricated and modified by a linker, 2-mercaptoacetate to form the self-assembled monolayer. Gold nanoparticles were used as a signal amplifier and supported the conjugation of Concanavalin A, for efficient capacitive sensing of PSMA. Scanning electron microscope observation effectively captured the surface modification on the aluminium surface by revealing the specific adherence of gold nanoparticles with Concanavalin A. Moreover, the successful surface modification was further validated by atomic force microscopy, Fourier transforms infrared spectroscopy, and X-ray photoelectron spectroscopy. The interaction analysis of Concanavalin A with PSMA by capacitive non-faradaic measurement exhibited a linear detection range from 10 pM to 100 nM and attained the detection limit and sensitivity of 10 pM and 1.65 nF/pM respectively as the comparable performance to the current sensing strategies. Furthermore, the fabrication and quantification of PSMA as demonstrated here are relatively simple and can be employed for the straightforward detection of other biomarkers.

Cardiovascular disease (CVD) has become one of the leading causes of morbidity and mortality in both men and women. According to the World Health Organization (WHO), ischemic heart disease is the major issue due to the narrowing of the coronary artery by plaque formation on the artery wall, which causes an inadequate flow of oxygen and blood to the heart and is called ‘coronary artery disease’. The CVD death rate increased by up to 15% in 2016 (~17.6 million) compared to the past decade. This tremendous increment urges the development of a suitable biomarker for rapid and early diagnosis. Currently, C-reactive protein (CRP) is considered an outstanding biomarker for quick and accurate outcomes in clinical analyses. Various techniques have also been used to diagnose CVD, including surface plasmon resonance (SPR), colorimetric assay, enzyme-linked immunosorbent assay (ELISA), fluoro-immunoassays, chemiluminescent assays, and electrical measurements. This review discusses such diagnostic strategies and how current, cutting-edge technologies have enabled the development of high-performance detection methodologies. Concluding remarks have been made concerning the clinical significance and the use of nanomaterial in medical diagnostics towards nanotheranostics.

Prostate cancer is currently diagnosed using the conventional gold standard methods using prostate-specific antigen (PSA) as the selective biomarker. However, lack of precision in PSA screening has resulted in needless biopsies and delays the treatment of potentially fatal prostate cancer. Thus, identification of glycans as novel biomarkers for the early detection of prostate cancer has attracted considerable attention due to their reliable diagnostic platform compared with the current PSA systems. Therefore, biosensing technologies that provide point-of-care diagnostics have demonstrated the ability to detect various analytes, including glycosylated micro- and macro-molecules, thereby enabling versatile detection methodologies. This highlight article discusses recent advances in the biosensor-based detection of prostate cancer glycan biomarkers and the innovative strategies for the conjugation of nanomaterials adapted to biosensing platforms. Finally, the article is concluded with prospects and challenges of prostate cancer biosensors and recommendations to overcome the issues associated with prostate cancer diagnosis.

Reduced graphene oxide (rGO) is widely utilised to develop various types of biosensors; however, producing self-assembled rGO nanoflake networks through single-droplet drop-casting remains inconsistent. In the present work, we systematically used three different methods to prepare rGO suspensions in order to produce large scale self-assembled rGO nanoflake networks through single-droplet drop-casting. The rGO suspensions were prepared using only deionised water with no added any chemicals/organic solvents, which we considered to be a low-cost method. Subsequently, the most effective preparation method was used to deposit rGO nanoflakes onto commercial gold interdigitated microelectrodes (Au-IDE) to examine their electrical performance. Assessment of the yields, developed methods, surface morphologies, spectroscopy and structural analyses of the as-prepared rGO nanoflakes were conducted. The results revealed that method-3 (involving sonication, centrifugation and post-sonication) produced large self-assembled rGO nanoflake networks with strong adhesion to glass substrates. Furthermore, the as-prepared rGO/Au-IDE modified sensors showed excellent electron mobility where the electrical conductivity was enhanced approximately ~ 1000 fold compared to the bare devices. The present work provided new insights for depositing large self-assembled interconnected rGO nanoflake networks through single-droplet drop-casting which will be beneficial for biosensor development and other downstream applications.

Field of generating a surface thin film is emerging broadly in sensing applications to obtain the quick and fast results by forming the high-performance sensors. Incorporation of thin film technologies in sensor development for the better sensing could be a promising way to attain the current requirements. This work predominantly delineates the fabrication of the dielectric sensor using two different sensing materials (Gold and Aluminium). Conventional photolithography was carried out using silicon as a base material and the photo mask of the dielectric sensor was designed by AutoCAD software. The physical characterization of the fabricated sensor was done by Scanning Electron Microscope, Atomic Force Microscope, High Power Microscope and 3D-nano profiler. The electrical characterization was performed using Keithley 6487 picoammeter with a linear sweep voltage of 0 to 2 V at 0.01 V step voltage. By pH scouting, I-V measurements on the bare sensor were carried out, whereby the gold electrodes conducts a least current than aluminium dielectrodes. Comparative analysis with pH scouting reveals that gold electrode is suitable under varied ionic strengths and background electrolytes, whereas aluminium electrodes were affected by the extreme acid (pH 1) and alkali (pH 12) solutions.

Recently, simulations of In0.48Ga0.52As-based Planar Barrier Diode (PBD) and Self-Switching Device (SSD) as millimeter-wave rectifiers were reported. Both PBD and SSD have a planar structure, but with different insulating shapes and working principles. In this work, a hybrid structure of the reported PBD and SSD in a parallel configuration is proposed, to exploit the advantages of each device. The advantages of high rectifying properties in the SSD and fast switching rate of the PBD are combined in this hybrid structure in order to obtain an improved rectification performance at zero-bias in the near terahertz frequency region. Analysis of the curvature co-efficient, γ, which is defined as the ratio of the second order to the first order derivative of the device’s I-V function was performed to evaluate the rectification performance. AC transient analyses were then executed in various frequencies to imitate the high-frequency signal inputs. By using this hybrid structure, the highest value of γ achieved has been improved to ~19 V-1at 70 mV, and ~6 V-1at zero-bias (compared to the previous results on PBDs). The estimated cut-off frequency obtained was ~360 GHz (0.36 THz), operating at zero-bias.

Lung cancer is one of the most serious threats to human where 85% of lethal death caused by non-small cell lung cancer (NSCLC) induced by epidermal growth factor receptor (EGFR) mutation. The present research focuses in the development of efficient and effortless EGFR mutant detection strategy through high-performance and sensitive genosensor. The current amplified through 250 µm sized fingers between 100 µm aluminium electrodes indicates the voltammetry signal generated by means of the mutant DNA sequence hybridization. To enhance the DNA immobilization and hybridization, ∼25 nm sized aluminosilicate nanocomposite synthesized from the disposed joss fly ash was deposited on the gaps between aluminium electrodes. The probe, mutant (complementary), and wild (single-base pair mismatch) targets were designed precisely from the genomic sequences denote the detection of EGFR mutation. Fourier-transform Infrared Spectroscopy analysis was performed at every step of surface functionalization evidences the relevant chemical bonding of biomolecules on the genosensor as duplex DNA with peak response at 1150 cm−1 to 1650 cm−1. Genosensor depicts a sensitive EGFR mutation as it is able to detect apparently at 100 aM mutant against 1 µM DNA probe. The insignificant voltammetry signal generated with wild type strand emphasizes the specificity of genosensor in the detection of single base pair mismatch. The inefficiency of genosensor in detecting EGFR mutation in the absence of aluminosilicate nanocomposite implies the insensitivity of genosensing DNA hybridization and accentuates the significance of aluminosilicate. Based on the slope of the calibration curve, the attained sensitivity of aluminosilicate modified genosensor was 3.02E-4 A M−1. The detection limit of genosensor computed based on 3σ calculation, relative to the change of current proportional to the logarithm of mutant concentration is at 100 aM.

The universal burden of Parkinson’s disease (PD) has more than doubled over the past generation due to the increasing numbers of elderly individuals, with possible contributions from extended disease duration and environmental factors. PD affects the basal ganglia and the substantia nigra in deep parts of the brain. The nerve cells in the substantia nigra produce the neurotransmitter dopamine, which is responsible for the movement of the body. When PD affects the basal ganglia and the substantia nigra in the brain, there is abnormal neurotransmission in the body, leading to speech impairment, slowness of movement (bradykinesia), balance disorder, postural instability, tremor, and muscle rigidity. Even though the cause of this disease is still unknown, some studies revealed that α-synuclein is a major constituent of Lewy bodies, protein clumps that are the pathological hallmark of PD. Furthermore, different lines of research are under investigation with the involvement of other biological macromolecules, such as microRNA and DNA. Therefore, this paper reviews the current states and perspectives on PD, including its nature, features, and management, and the methods available to predict PD. The essence of this review is that PD requires more investigation and the development of suitable technologies to provide assistance to PD patients to improve their life.

Background: Ampicillin has been widely used as a broad-spectrum antibiotic for the treatment and prevention of human diseases with a low-toxicity. Ampicillin plays an important role in therapeutics, however, there might be some synthetically prepared compounds for the applications in agriculture, animals and even humans that eventually have resulted in major health issues. Objective: This research demonstrates the approach to improve the specific in vitro detection of ampicillin using titanium dioxide nanoparticle-based interdigitated device electrode. Methods: The fabrication of biosensor was performed using the conventional photolithography integrated process of an inductively-coupled plasma dry-etching. Surface modifications were applied on a 50 µm gapped interdigitated comb-like titanium dioxide nanoparticle modified electrode surface using 0.02 M of 3-Aminopropyl trimethoxysilane, which was diluted in 75% ethanol. A Schiff-base reaction using glutaraldehyde was followed to covalently immobilize streptavidin followed by a non-covalent immobilization of biotinylated-aptamer DNA probe (1 µM), having a sequence of 5’- CACGGCATGGTGGGCGTCGTG–biotin-3’. Results: These surface modifications with multiple self-assembling monolayers afford the additional control for stability. The immobilized aptamer DNA probe was interacted with the target, ampicillin at 10 mg/ml, resulting in the current field changes across the device. I-V relationship interpreted the selective binding of ampicillin and distinguished kanamycin from carbenicillin. Our sensing system was able to detect ampicillin in a linear range of 0.1 ng until 10 mg/ml with the limit of detection at 0.1 ng/ml. Conclusion: This sensing platform aimed to evaluate the purity of ampicillin, a promising beneficial approach towards the pharmaceutical industries.

Purpose This paper aims to analyze the negative impact of surface mount (SMT) pad and imperfect via structure such as stub, pad, non-functional pad (NFP) and anti-pad on the signal integrity at 40 Gbps transmission on printed circuit board (PCB) due to impedance mismatch or discontinuity. The optimized modeling of via and SMT structures is performed to achieve minimal impedance mismatch and insertion loss less than 10 dB for six-inch full path transmission line between transmitter and receiver on PCB at Nyquist frequency 20 GHz. Design/methodology/approach This work is split into two phases. The first phase involves optimization of via and SMT structures in three-dimensional electromagnetic (3DEM) simulation using Hyperlynx Via Wizard and Keysight EMPro software, respectively, followed by analysis of time domain reflectometry (TDR) and insertion loss (Sdd21). Whereas, in the second phase, full path hybrid mode simulation involving vias for signal layer transition, a 6-inch PCB channel and SMT pads is performed using Keysight ADS software to observe the TDR, Sdd21 and eye diagram at 40 Gbps transmission. Findings Imperfect via and SMT structures have a negative effect on signal reflection and attenuation. The optimized via and SMT minimizes the impedance mismatch by 81 per cent and insertion loss by 4.5 dB, ultimately enlarging the eye diagram opening to achieve minimal data loss at receiver with 40 Gbps transmission. Originality/value The results of original empirical research work on signal integrity analysis that optimizes the PCB channel design to achieve 40 Gbps signal transmission are presented in this study. It serves as a reference guide for high-speed PCB layout design.

In the advancement of the Internet of Things (IoT) applications, widespread uses and applications of devices require higher frequency connectivity to be explored and exploited. Furthermore, the size, weight, power and cost demands for the IoT ecosystems also creates a new paradigm for the hardware where improved power efficiency and efficient wireless transmission needed to be investigated and made feasible. As such, functional microwave detectors to detect and rectify the signals transmitted in higher frequency regions are crucial. This paper reviewed the practicability of self switching diodes as Radio Frequency (RF) rectifiers. The existing methods used in the evaluation of the rectification performance and cut-off frequency are reviewed, and current achievements are then concluded. The works reviewed in this paper highlights the functionality of SSD as a RF rectifier with design simplicity, which may offer cheaper alternatives in current high frequency rectifying devices for application in low-power devices.

Human immunodeficiency virus (HIV) is a life threatening, weakens the immune system upon infection, thus ultimately resulting in the fatal health issues. This situation necessitates the generation of different strategies for HIV detection. HIV-1 Tat, a transactivator of HIV gene expression, was chosen in this study as the target of a non-functional split aptamer. Implementation of split aptamer has been demonstrated in this work for colorimetric detection of HIV-1 Tat. An unmodified gold nanoparticle (GNP)-based colorimetric assay was used for the visible detection of the proof, displays color transitions from red to purple in relation to the dose-dependency of HIV-1 Tat against the split aptamer in ionic solutions. The visible color transition was characterized using UV–vis spectrophotometer showing spectrum shift and supported by Scanning Electron Microscopy observation. With addition of sodium chloride, the color of the solution started to change to purple and spectrum started to shift to higher wavelength due to aggregation at HIV-1 Tat concentration as low as 10 nM. Specificity test was conducted with duplexed split aptamer and HIV-1 p24 has shown slight color changes. With HIV-1 Nef, GNP solution retains the color similar to the control, which indicated the specific split aptamer interaction to HIV-1 Tat.

This article is clearly presenting the development of a biosensor for human factor IX (FIX) to diagnose the blood clotting deficiency, a so-called ‘Royal disease’ using an interdigitated electrode (IDE) with the zinc oxide surface modification. Gold nano-urchins (GNUs) with 60 nm in diameter was integrated into a streptavidin-biotinylated aptamer strategy to enhance the active surface area. Two different comparative studies have been done to validate the system to be practiced in the current work holds with a higher capability for the high-performance sense. Whereby, the presence and absence of GNUs in the aptasensing system for FIX interaction were investigated using the amperometric measurement, using a linear sweep voltage of 0–2 V at 0.01 V step voltage. The detection limit was 6 pM based on 3σ calculation when GNUs integrated aptamer assay was utilized for FIX detection, which shows 8 folds sensitivity enhancement comparing the condition in the absence of GNU and 50 folds higher than sensitive radio-isotope and surface plasmon resonance assays. Albeit, the surface and molecular characterizations were well demonstrated by scanning electron microscopy, atomic force microscopy, 3D nano-profilometry and further supports were rendered by UV–Vis spectroscopy and Enzyme-linked apta-sorbent assay (ELASA). Furthermore, the spiking experiment was done by FIX-spikes in human blood serum in order to demonstrate the stability with a higher non-fouling.

This paper primarily demonstrates the approach to enhance the sensing performance on antigen C-reactive protein (CRP) and anti-CRP antibody binding event. A nanogapped electrode structure with the gap of ~100 nm was modified by the anti-CRP antibody (Probe) to capture the available CRP. In order to increase the amount of antigen to be captured, a gold nanorod with 119 nm in length and 25 nm in width was integrated, to increase the surface area. A comparative study between the existence and non-existence of gold nanorod utilization was evaluated. Analysis of the sensing surface was well-supported by atomic force microscopy, scanning electron microscopy, 3D nano-profilometry, high-power microscopy and UV–Vis spectroscopy. The dielectric voltammetric analysis was carried out from 0 V to 2 V. The sensitivity was calculated based on 3σ and attained as low as 1 pM, which is tremendously low compared to real CRP concentration (119 nM) in human blood serum. The gold nanorod conjugation with antibody has enhanced the sensitivity to 100 folds (10 fM). The specificity of the CRP detection by the proposed strategy was anchored by ELISA and failure in the detection of human blood clotting factor IX by voltammetry. Despite, CRP antigen was further detected in human serum by spiking CRP to run-through the detection with the physiologically relevant samples.

In this study, a critical evaluation of analyte dielectric properties in a microvolume was undertaken, using a microwave biochemical sensor based on a circular substrate integrated waveguide (CSIW) topology. These dielectric properties were numerically investigated based on the resonant perturbation method, as this method provides the best sensing performance as a real-time biochemical detector. To validate these findings, shifts of the resonant frequency in the presence of aqueous solvents were compared with an ideal permittivity. The sensor prototype required a 2.5 µL volume of the liquid sample each time, which still offered an overall accuracy of better than 99.06%, with an average error measurement of ±0.44%, compared with the commercial and ideal permittivity values. The unloaded Qu factor of the circular substrate-integrated waveguide (CSIW) sensor achieved more than 400 to ensure a precise measurement. At 4.4 GHz, a good agreement was observed between simulated and measured results within a broad frequency range, from 1 to 6 GHz. The proposed sensor, therefore, offers high sensitivity detection, a simple structural design, a fast-sensing response, and cost-effectiveness. The proposed sensor in this study will facilitate real improvements in any material characterization applications such as pharmaceutical, bio-sensing, and food processing applications.

Reduction of graphene oxide becomes an alternative way to produce a scalable graphene and the resulting nanomaterial namely reduced graphene oxide (rGO) has been utilized in a wide range of potential applications. In this article, the level of green reduction strategies, especially the solution-based reduction methods are overviewed based on recent progression, to get insights towards biomedical applications. The degrees of gaining tips with the solution-based green reduction methods, conditions, complexity and the resulting rGO characteristics have been elucidated comparatively. Moreover, the application of greenly produced rGO in electrochemical biosensors has been elucidated as well as their electrical performance in term of linear range and limit of detections for various healthcare biological analytes. In addition, the characterization scheme for graphene-based materials and the analyses on the reduction especially for the solution-based green reduction methods are outlined for the future endeavours.

Interaction between split RNA aptamer and the clinically important target, HIV-1 Tat was investigated on a biosensing surface transduced by functionally choreographed multiwall carbon nanotubes (MWCNTs). Acid oxidation was performed to functionalize MWCNTs with carboxyl functional groups. X-ray photoelectron spectroscopy analysis had profound ~2.91% increment in overall oxygen group and ~1% increment was noticed with a specific carboxyl content owing to C O and O C O bonding. The interaction between split RNA aptamer and HIV-1 Tat protein was quantified by electrical measurements with the current signal (Ids) over a gate voltage (Vgs). Initially, 34.4 mV gate voltage shift was observed by the immobilization of aptamer on MWCNT. With aptamer and HIV-1 Tat interaction, the current flow was decreased with the concomitant gate voltage shift of 23.5 mV. The attainment of sensitivity with split aptamer and HIV-1 Tat interaction on the fabricated device was 600 pM. To ensure the genuine interaction of aptamer with HIV-1 Tat, other HIV-1 proteins, Nef and p24 were interacted with aptamer and they displayed the negligible interferences with gate voltage shift of 3.5 mV and 5.7 mV, which shows 4 and 2.5 folds lesser than HIV-1 Tat interaction, respectively.

Nanoparticles have been paid a great attraction in interdisciplinary sciences owing to their unique characteristics. Different nanoparticles were synthesized in metallic and non-metallic states, showing varied sizes for down-stream applications. Copper nanoparticle (CuNP) has a special attention due to its great electrical, catalytic, optical and mechanical properties. In this research, CuNP was prepared by the electrolytic deposition and characterized its morphological and structural behaviours by scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), X-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and Raman spectroscopy. SEM displays the irregular agglomerated particles, whereas with TEM the sizes were determined as 40 ± 10 nm. The peaks with XPS analysis were noticed at 932.1 for Cu(2p3/2), 944.1 eV and 952.1 eV for Cu(2p1/2). Whereas, the representative peaks for copper were placed at 43.7°, 50.7° and 74.3°, corresponding to (111), (200) and (220) under XRD observations. CuNP vibration peaks were monitored at 1635 cm−1 with FTIR and a sharp peak at 617.6 cm−1 is representing Cu-O group due to the occurrence of Cu2O. The antimicrobial activity of the electrodeposited CuNP was proved against the fungus, Aspergillus niger. Further, ITO/CuNP/CuI/Cu (Indium Tin Oxide/Copper Nanoparticle/Copper Iodide/Copper) substrate solid-state photovoltaic cell was fabricated by CuNP electrodeposition on the CuI substrate. It was anchored by I–V characteristics, apparent that a rapid current enhancement after deposition of the CuNP.

A label-free chemical bonding strategy mediated by reduced graphene oxide (rGO) basal plane functional groups has been developed for cardiac Troponin I (cTnI) detection. Four different chemical strategies on respective electrode sensing surface were precedingly examined using electrochemical impedance spectroscopy. The impedimetric assessment was carried out by sweeping frequency at the range 0.1–500 kHz perturbated at a small amplitude of AC voltage (25 mV). The chemical strategy-4 denoted as S-4 shows a significant analytical performance on cTnI detection in spiked buffer and human serum, whereby the pre-mixture of rGO and (3-Aminopropyl)triethoxysilane (APTES) creates a large number of amine sites (−NH2), which significantly enhanced the antibody immobilization without excessive functionalization. The as-fabricated immunosensor exhibited an ultra-low limit of detection of 6.3 ag mL−1 and the lowest antigen concentration measured was at 10 ag mL−1. The immunosensor showed a linear and wide range of cTnI detection (10 ag mL−1–100 ng mL−1) in human serum with a regression coefficient of 0.9716, rapid detection (5 min of binding time), and stable and highly reproducible bioelectrode response with RSD

This study described a “green chemistry” synthesis of titanium oxide nanoparticle (TiO2-NP) using environment-friendly reducing agents that were from Elodea canadensis. The obtained TiO2-NP has an intense surface plasmon reverberation band at ~ 250 nm with UV–visible spectroscopic investigation which showed the intactness of TiO2-NPs. The morphological behaviour of TiO2-NPs was watched beneath field-emission scanning electron microscopy and transmission electron microscopy, shown that TiO2-NPs have a spherical pattern with a normal estimate of ~ 25 nm in breadth. The occurrence of the critical elements was pinpointed by energy-dispersive X-ray spectroscopy study, which displays the predominant titanium and oxide elements. Further support with a defined morphology and size distribution was rendered by atomic force microscopy and 3D high-power microscopy analyses. X-ray powder diffraction and chosen area electron diffraction examinations affirmed that TiO2-NPs are crystal clear in macrocosm. X-ray photoelectron spectroscopy study was uncovered natural composition of the TiO2-NPs, displaying Ti 2p crested at 458.48 eV with C1s crest for the catalyst that was shaped into a C–H constitute at 284.88 eV. The O 1s spectra moreover were displayed with authoritative vitality at 532.28 eV. XRD analysis gave proportion phase as 75%:25% for anatase and rutile. DLS showed polydispersity index esteem of − 1.23, and zeta potential for green synthesized Ti2O-NPs was − 3.87 mV. A broad hydroxyl peak was identified, and prominent peaks were notified at 1631.78 cm−1 and 3454.51 cm−1 by Fourier-transform infrared spectroscopy analysis.

Drastically growing research areas are mainly dependent on nanotechnology for the purpose of a better outcome and to propose new advancements in their respective field. In fact, nanotechnology has been an attraction field for all researchers due to their outstanding key prospects in all the fields. Truly, to claim that nature also can be distinguished as a superior nanotechnologist. Nanoparticles are the subclass of nanotechnology which can be found everywhere and every time. Nanoparticles are particles with nano-sized range which are highly mobile and precise. In nature, nanoparticles can be found in volcanic ash, ocean spray, natural water, soil, plant extract, and plant biomass. Naturally, existing compounds or minerals by the bioreduction process can be either highly toxic or nontoxic to the environment. This chapter generally presents the types of nanoparticles that exist naturally and their way of production.

Nanoparticles (NPs) are produced through nanotechnology development by reducing the metal to its nuclear size. NP synthesis includes a few techniques, such as physical, chemical, and biological techniques. Physical methods avoid NP solvent contamination but it is not negligible to consume a large quantity of energy for condensation and evaporation of particles. In addition, extremely high modulation of temperature and pressure indirectly expends the cost of NPs synthesis. In the chemical technique, reducing agents and protective agents are used to synthesize NP and prevent agglomeration in order to synthesize high purity and stable NP. High intake of strong chemicals leads to contamination of the synthetic NP. In comparison to NP’s synthesis by chemical and physical techniques, the interest in NP biological synthesis has concentrated on its ecofriendly and effective technique. The biological technique used under green synthesis differs with the type of reduction agent used as microorganisms (bacteria and fungi) and plants and their extracts. Exclusion in the consumption of powerful chemical agents and set-up of high-energy reactions highlights the significant benefits of biological technique in NP synthesis. Thus, the synthesis of NP with plant extracts by biological method is the appealing technique for a large-scale production of NP and has a higher potential in significant medicinal applications.

This paper reported on performance assessment of a field-effect transistor-based biosensor with different widths of the silicon nanowire transducer channel. Silvaco ATLAS device simulation software was used to model the device design with three different channel widths, which are 100, 150, and 200 nm. In this simulation, the bounded target biomolecules during actual detection using the biosensor were represented by several negative interface charge density values applied on the surface of the transducer channel. Increase in accumulation of hole carriers beneath the channel’s surface was observed due to the availability of negative interface charges on the surface, hence increased the output drain current. Furthermore, width reduction of the device’s channel had allowed more significant change in drain current due to application of different interface charge density values and increased the device’s sensitivity. Among the simulated devices, silicon nanowire field-effect transistor-based biosensor with transducer channel width of 100 nm had shown highest sensitivity (-56.45 nA/e−cm2) with lowest interface charge density detection (2.79×1010 e/cm-2), which means it enhances the interface charge detection by providing better response and allows lower limit of detection. Therefore, in actual detection, possibility for reaction of the transducer channel to the specific target biomolecule can be increased.

Misfolding and accumulation of the protein alpha synuclein in the brain cells characterize Parkinson's disease (PD). Electrochemical based aluminum interdigitated electrodes (ALIDEs) was fabricated by using conventional photolithography method and modified the surfaces with zinc oxide and gold nanorod by using spin coating method for the analysis of PD protein biomarker. The device surface modified with gold nanorod of 25 nm diameter was used. The bare devices and the surface modified devices were characterized by Scanning Electron Microscope, 3D-Profilometer, Atomic Force Microscope and high-power microscope. The above measurement was also performed to measure the interaction of antibody with aggregated alpha-synuclein for normal, aggregated and aggregated alpha synuclein in human serum and distinguished against 3 control proteins (PARK1, DJ-1 and Factor IX). The detection limit for normal alpha synuclein was 1 f. with the sensitivity of 1 f. on a linear regression (R2 = 0.9759). The detection limit for aggregated alpha synuclein was 10 aM with the sensitivity of 1 aM on a linear regression (R2 = 0.9797). Also, the detection limit of aggregated alpha synuclein in serum was 10 aM with the sensitivity of 1 aM on a linear regression (R2 = 0.9739). These results however indicate that, serum has only minimal amount of alpha synuclein.

Mortality level is worsening the situation worldwide thru blood diseases and greatly jeopardizes the human health with poor diagnostics. Due to the lack of successful generation of early diagnosis, the survival rate is currently lower. To overcome the present hurdle, new diagnostic methods have been choreographed for blood disease biomarkers analyses with the conjunction of ultra-small ideal gold nanohybrids. Gold-hybrids hold varieties of unique features, such as high biocompatibility, increased surface-to-volume ratio, less-toxicity, ease in electron transfer and have a greater localized surface plasmon resonance. Gold-nanocomposites can be physically hybrid on the sensor surface and functionalize with the biomolecules using appropriate chemical conjugations. Revolutionizing biosensor platform can be prominently linked for the nanocomposite applications in the current research on medical diagnosis. This review encloses the new developments in diagnosing blood biomarkers by utilizing the gold-nanohybrids. Further, the current state-of-the-art and the future envision with digital monitoring for facile telediagnosis were narrated.

SiC nanomaterial (SiCNM) is known for its excellent properties and has great potential for a wide range of applications. In this article, preparation of SiCNMs from different types of graphite was performed by microwave-assisted synthesis. Different types of graphite which are graphite flake (GF) and expanded graphite (EG) were used to react with silica for the synthesis of SiCNMs in laboratory microwave furnace at 1400 °C. It was found that SiC nanowhiskers (SiCNWs) were formed when EG was used, while irregular shaped SiC nanoparticles (SiCNPs) were formed when GF was used. β-SiC appeared as the only phase in the XRD patterns for both SiCNMs formed using GF and EG. SiCNWs and SiCNPs have interplanar spacing of around 0.25 nm which is the axial direction of [111]. The difference of formation mechanism is believed to be the origin of different morphology of SiCNMs synthesized from different types of graphite.

Microfluidics explores the manipulation of fluid in small volume, a multidisciplinary field is imperative for DNA extraction. This study offers a simple yet substantial methodology for the fabrication of microfluidics structure-based polydimethylsiloxane (PDMS) biopolymer on a glass substrate with SU-8 photoresist for label-free detection of pathogenic genomic DNA. Two microfluidics designs for DNA detection were based on AutoCAD software, both contain two inlets and one outlet, with dimensions of 28 mm wide, and 18 mm long, and total surface area of 504 mm2. The designs were patterned in such particular sizes and dimensions to test fluid delivery and enhancement in biochemical processes in DNA extraction, while maintaining economical values as a disposable chip. Both microfluidics devices showed no leakage during fluid delivery, have heights of 97.97 and 103.44 μm, and surface roughness of 0.15 and 0.07 μm, respectively. DNA extraction from pathogenic fungus Ganoderma boninense was run on PDMS microfluidic device and UV–Vis analysis confirmed successful extraction with peaks found at 260–280 nm. Current–voltage (I–V) measurement confirmed the accuracy of microfluidic device for the specific pathogen with both real and synthetic samples of G. boninense illustrating the similar graph values of only 0.000005 A difference at 1.0 V after hybridization.

Nanofabricated gold nanoparticles (Au-NPs) on MoS2 nanosheets (Au-NPs/MoS2) in back-gated field-effect transistor (BG-FET) are presented, which acts as an efficient semiconductor device for detecting a low concentration of C-reactive protein (C-RP). The decorated nanomaterials lead to an enhanced electron conduction layer on a 100-μm-sized transducing channel. The sensing surface was characterized by Raman spectroscopy, ultraviolet–visible spectroscopy (UV-Vis), atomic force microscopy (AFM), scanning electron microscopy (SEM), and high-power microscopy (HPM). The BG-FET device exhibits an excellent limit of detection of 8.38 fg/mL and a sensitivity of 176 nA/g·mL−1. The current study with Au-NPs/MoS2 BG-FET displays a new potential biosensing technology; especially for integration into complementary metal oxide (CMOS) technology for hand-held future device application.

In an aim of developing portable biosensor for SARS-CoV-2 pandemic, which facilitates the point-of-care aptasensing, a strategy using 10 μm gap-sized gold interdigitated electrode (AuIDE) is presented. The silane-modified AuIDE surface was deposited with ∼20 nm diamond and enhanced the detection of SARS-CoV-2 nucleocapsid protein (NCP). The characteristics of chemically modified diamond were evidenced by structural analyses, revealing the cubic crystalline nature at (220) and (111) planes as observed by XRD. XPS analysis denotes a strong interaction of carbon element, composed ∼95% as seen in EDS analysis. The C–C, C Created by potrace 1.16, written by Peter Selinger 2001-2019 C, CO, CN functional groups were well-refuted from XPS spectra of carbon and oxygen elements in diamond. The interrelation between elements through FTIR analysis indicates major intrinsic bondings at 2687-2031 cm−1. The aptasensing was evaluated through electrochemical impedance spectroscopy measurements, using NCP spiked human serum. With a good selectivity the lower detection limit was evidenced as 0.389 fM, at a linear detection range from 1 fM to 100 pM. The stability, and reusability of the aptasensor were demonstrated, showing ∼30% and ∼33% loss of active state, respectively, after ∼11 days. The detection of NCP was evaluated by comparing anti-NCP aptamer and antibody as the bioprobes. The determination coefficients of R2 = 0.9759 and R2 = 0.9772 were obtained for aptamer- and antibody-based sensing, respectively. Moreover, the genuine interaction of NCP aptamer and protein was validated by enzyme linked apta-sorbent assay. The aptasensing strategy proposed with AuIDE/diamond enhanced sensing platform is highly recommended for early diagnosis of SARS-CoV-2 infection.

Cuprous oxide, a narrow bandgap p-type semiconductor, has been known as a potential material for applications in supercapacitors, hydrogen production, sensors, and energy conversion due to its properties such as non-toxicity, easy availability, cost effectiveness, high absorption coefficient in the visible region and large minority carriers diffusion length. In this study, Cu2O nanostructured thin film was fabricated by anodizing of Cu plates in ethylene glycol containing 0.15 M KOH, 0.1 M NH4F and 3 wt.% deionized water. The effects of anodizing voltage and temperature of electrolyte were investigated and reported. It was found that nanoporous Cu2O thin film was formed when anodizing voltages of 50 V and 70 V were used while a dense Cu2O thin film was formed due to the aggregation of smaller nanoparticles when 30 V anodizing voltage was used. Nanoplatelets thin film was formed when the temperature of electrolyte was reduced to 15 °C and 5 °C. X-ray diffraction confirmed the presence of Cu2O phase in thin film formed during anodizing of Cu plates, regardless of the anodizing voltage and temperature of electrolyte. Photoluminescence spectroscopy showed the presence of Cu2O peak at 630 nm corresponding to band gap of 1.97 eV. A mechanism of the formation of Cu2O thin film was proposed. This study reported the ease of tailoring Cu2O nanostructures of different morphologies using anodizing that may help widen the applications of this material

Characterization on an InGaAs-based self-switching diode (SSD) using technology computer aided design (TCAD) aimed for optimizing the electrical rectification performance of the device is reported. The rectifying performance is mainly contributed by a parameter known as the curvature coefficient which is derived from the current-voltage (I-V) behavior of the device. As such, the curvature coefficient of SSD was analyzed in this work, not only by varying the device’s geometrical structure, but also by implementing different dielectric relative permittivity of the device’s trenches, ranging from 1.0 to 10. Furthermore, the simulations were performed under temperature range of 300–600 K. The results showed that increased temperature degraded the SSD’s rectifying performance due to increased reverse current which can deteriorate the nonlinearity of the device’s I-V characteristic. Moreover, an improved curvature coefficient can be achieved using silicon dioxide (∼3.9) as the SSD trenches. The cut-off frequency of SSD with zero-bias curvature coefficient of ∼30 V−1 attained in this work was approximately 80 GHz, operating at unbiased condition. The results obtained can assist the design of SSD to efficiently operate as rectifiers at microwave and terahertz frequencies.

Early cancer diagnosis remains the holy-grail in the battle against cancers progression. Tainted with debates and medical challenges, current therapeutic approaches for prostate cancer (PCa) lack early preventive measures, rapid diagnostic capabilities, risk factors identification, and portability, i.e. the inherent attributes offered by the label-free biosensing devices. Electronic assisted immunosensing systems inherit the high sensitivity and specificity properties due to the predilection of the antigen–antibody affinity. Bioelectronic immunosensor for PCa has attracted much attentions among the researchers due to its high-performance, easy to prepare, rapid feedback, and possibility for miniaturization. This review explores the current advances on bioelectronic immunosensors for the detection of PCa biomarker revealed in the past decade. The research milestones and current trends of the immunosensors are reported to project the future visions in order to propel their “lab-to-market” realization.

This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

The authors describe an impedimetric nanosensor for aptamer-mediated detection of ATP. A triangular junction of polysilicon substrate is used as a transducer. The aptamer was immobilized on the substrate via biotin-streptavidin interaction. ATP can be detected by this method in the 10 to 100 nM concentration range at room temperature and estimated the signal to noise ratio above the range of 3σ. It was applied to the detection of ATP in 1:1000 diluted human urine. The desired transducer is highly reproducible and specific. It is selective over closely related molecules such as guanosine triphosphate, cytidine triphosphate and uridine triphosphate. The method is perceived to represent a valuable tool for the diagnosis for infections and inflammations. The novelties shown in this study compared to other sensors are, consumption of low sample volume (~ 1 μl), non-invasive and suitable with AC and DC currents.

The authors describe an electrochemical method for the determination of the blood clotting factor IX (FIX). A nanogapped dielectrode (with a

The increasing cases of dengue fever (DF) and dengue hemorrhagic fever (DHF) in the last decade have been reported worldwide. These conditions have led to huge economic loses and health complications. At present, no direct cure for DF and no efficient device to control or detect the Aedes mosquitoes that cause DF are available. Therefore, the fabrication of a device will reduce the probability of get infection since it works as a warning system, to exterminate Aedes mosquitoes as soon as discovered, and to evacuate the location until it be treated. This paper is the first to report the detection of the female Aedes mosquito in human habitations using a surface acoustic wave (SAW) sensor. The feasibility of an acoustic-based device that records differences in signals and noise levels from different mosquito species has been demonstrated in instructing frequency differences to detect female mosquitoes. The SAW sensor response was investigated with simulated and real Aedes mosquito signals. Decreased resonant peak amplitude was obtained with different wingbeat frequencies. The S11 magnitude was reduced by 0.6dB and 1.25dB with female and male Aedes mosquitoes, respectively. Furthermore, the SAW sensor exhibited good sensitivity in low sound pressure environments between 40 and 55dB, making it suitable for use inside an average home. Display Omitted Layard SAW sensor for female Aedes mosquito detection was fabricated and investigated.Decreased resonant peak amplitude was obtained with different wing beat frequencies.S11 magnitude was reduced by 0.6 and 1.25dB with female and male Aedes mosquitoes.The SAW sensor exhibited good sensitivity in low sound pressure environments.

Systematic Evolution of Ligands by EXponential enrichment (SELEX) is the method to select the specific aptamer against a wide range of targets. For this process, the initial library usually has a length of random sequences from ∼25 and it reaches over 100 bases. The lengthy sequences have disadvantages such as difficult to prepare, less stable and expensive. It is wise to prefer shorter version of aptamer for a wide range of applications including drug delivery process. It is a common practice to shorten the full-length aptamer by mapping analyses and it is tedious. Here, we used a crawling method to shorten the aptamer by different sequential deletion of bases from both 5′ and 3′ ends, assisted by Mfold web server application. Two different kinds of aptamer with varied lengths (randomized region of 30 and 74 bases) were desired for this study, generated against Influenza A/Panama/2007/1999 (H3N2) and gD protein of Herpes Simplex Virus-1. It was found that shortening the aptamer length by crawling pattern is possible with the assistance of Mfold web server application. The obtained results resemble the shortened aptamer derived by mapping analyses. The proposed strategy is recommended to predict the shorter aptamer without involving any wet experimental section.

Novel ZnO combined structures were obtained using the radio frequency (RF) sputtering method. The effects of two different substrates, Si and 128° YX LiNbO 3 , on the structural, morphological, and optical properties of ZnO films were investigated. Field emission scanning electron microscopy clearly revealed the formation of a mixed flake-corolla lobe-like structure. The grain size of the obtained structure depended on the substrate type. Two different X-ray diffraction peaks were obtained for ZnO growth on LiNbO 3 , at the (200) and (201) diffraction planes, respectively.

This paper demonstrated the effect of different number of silicon nanowire transducer channels, in other word single, double, and triple channels towards the performance of field-effect transistor-based biosensor through simulation tool. These silicon nanowire field-effect transistor biosensors were designed and simulated in device simulation modelling tool, Silvaco ATLAS with fixed length, width, and height of the silicon nanowire. Different negatively interface charge density values were applied on the transducer channels’ surface of the biosensors to represent as detected target biomolecules that will bind onto the surface of the transducer regions. Based on the results, more negatively interface charges density values presented on the sensing channels had reduced the electron carrier accumulation at the channel’s interface, therefore, reduced drain current flow between the source and drain terminal. With the increase number of the transducer channels, significant change in drain current for every applied negatively interface charges became more apparent and increased the sensitivity of the biosensor. The triple transducer channels silicon nanowire field-effect transistor biosensor had demonstrated highest sensitivity, that is 2.83 µA/e∙cm2, which indicates it has better response for the detection of interface charges, thus increases chances for transducer channels reaction to the target biomolecules during testing or diagnosis.

In this work, a highly sensitive Silicon nanogap biosensor was demonstrated for Deoxyribonucleic acid (DNA) detection related to Dengue virus (DENV). The Silicon nanogap was fabricated using the top–down conventional lithography approach followed by reactive ion etching (RIE) to further thin down the nanogap. The inspections of Silicon nanogap structures were carried out using the scanning electron microscope (SEM) and atomic force microscopy (AFM). The surface of the fabricated Silicon nanogap was functionalized by means of a three-steps procedure involving surface modification, immobilization and hybridization. This procedure acts as a liquid gate control to establish the electrical detection targets of the dengue virus. The electrical detection is based on the changes in the current of the sensor due to the accumulation of the negative charges by the immobilized probe and hybridized target Deoxyribonucleic acid. The limit of detection (LOD) achieved was recorded at 10 pM with a 207 nm of fabricated Silicon nanogap and its sensitivity at 1.5 × 10−10 AM−1. The demonstrated results show that the Silicon nanogap has the excellent properties for detection of dengue virus as biosensor devices.

This study describes the fabrication of three different gap-fingered aluminum-interdigitated electrodes (AlIDEs) on the silicon substrate based on photolithographic method, followed by integration of the gold nanorod–zinc oxide nanocomposite. The IDE masks were designed using AutoCAD software with the gaps of 10, 20, and 30 μm for design 1, 2, and 3, respectively. The morphological and electrical characterizations were subsequently performed using 3D-nanoprofiler, atomic force microscopy, high-power microscopy (HPM), scanning electron microscopy (SEM), and I–V. Validation of the fabricated surfaces (AlIDEs with/without gold nanorod–zinc oxide nanocomposite) against the electrolytes was performed at different pHs which are ranging from 1 to 12. SEM revealed the following gaps, 18.4, 20, and 40.5 μm for bare 1, 2, and 3, respectively. The measurements on I–V for bare AlIDEs indicated the electrolyte influences at different pH solutions, which were almost similar in terms of current variations except at highly acidic and alkaline. AlIDEs were well fabricated and the smaller the gap displayed the better the sensitivity, hence device 1 AlIDE has a good performance. Using different pH solutions which ranging from pH 1–12, before and after AlIDEs were coated with zinc oxide and gold nanorod. The responses of the devices were similar, fluctuating from highly acidic region to highly alkaline region in the cases of AlIDEs bare 1 and 3. Bare 2 AlIDE displayed similar responses with the AlIDE that was deposited with gold nanorod. With these results, we can conclude that deposition of gold nanorod on the device brought about the orderly response to the different pH and with the increment from acidic to alkaline increases, the proportional changes with the current were noticed.

Biosensor with insensitive electrolyte variation is one of the basic norms to be investigated for developing a high-performance disease diagnostic with a non-biofouling. On the other hand, the optimum dimension of biosensor plays a significant factor to be considered for generating a biosensensing system with a least influence by the buffering agents. In this research, interdigitated aluminium electrode (AlIDE) with four different microscale gap sizes, 400, 100, 60 and 45 µm were fabricated through a photolithography technique on the silicon substrate. The accuracy of the device fabrication was justified by the morphological examination using field emission scanning electron microscopy, high-power microscopy and 3D-nano profilometer. The current amplified by four devices under bare condition was 2.55E−3 A at 2 V explains the accuracy of the device fabrication and the uniformity in the electric flow. Electrolyte scouting was executed on the fabricated AlIDEs with the pH ranges between 1 and 12, the results interpret small gap sized AlIDEs (60 and 45 µm) show the variation in the current with different pH solutions due to the ionic flux. The insensitivity of zeolite nanoparticle (~ 10 nm size) attached AlIDE with 400 µm and 100 µm at different pH solutions were analyzed. Linear current curves with least variations were attained from pH 1 to 11. At 2 V voltage supply, the amount of current generated by AlIDE with and without zeolite attachment during pH scouting were same (1E−4 A), with the same microscale gap sizes. However, there was no current fluctuation observed with zeolite attached AlIDE during pH scouting analysis. Further, the chemically functionalized zeolite nanoparticle behaves better than unmodified one and gold nanoparticle with the similar modifications. The results obtained in the present research denotes that microscale gap size was altered to nanoscale gap size in the presence of nanomaterials on the AlIDE sensing surface, enhances the sensitivity of the device and improves the insensitivity of device to the electrolytes. Thus, optimum microscale gap sized AlIDE is easier to fabricate, could be utilized for medical diagnostics with insensitive pH variation through the advanced physiochemical properties of nanomaterials.