Search

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

From veterinary point of view Malassezia pachydermatis has the greatest significance. It has been standing in the focus of interest since the early 1990s, mostly because of the frequency of otitis externa and dermatitis caused by this yeast in dogs. This is the only lipid-independent species in the genus Malassezia. It can be found in very large proportion on the skin of healthy animals, but can be isolated in much greater number from diseased dogs. It often causes illness together with other pathogens (e.g. Staphylococcus intermedius). Some breeds are predisposed. In addition to the treatment of the accidental concurrent diseases, therapy consists of systemic and/or topical antimicrobial treatment. Ketoconazole is used most frequently. Malassezia pachydermatis plays also a role in the skin disorders of other carnivores. It has little zoonotic potential, it can be dangerous to immunocompromised humans. The other Malassezia species have little veterinary importance, although M. sympodialis and M. globosa were isolated from asymptomatic animals (mostly cats) and from mixed infections.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

We report the results of electronic-structure calculations on interstitial hydrogen in silicon using the semiempirical modified neglect of diatomic overlap method with a finite cluster. We find that the interstitial hydrogen is stable at a bond-centered site, consistent with other, recent computational results. The barrier for migration between adjacent bond-centered sites is estimated to be \ensuremath{\lesssim}1 eV. Furthermore, contrary to most other studies, we find the hydrogen to be asymmetrically located between the near-neighbor silicons. In a static picture, it is therefore bonded in a rather conventional way to one silicon, with the unpaired electron primarily located at the other silicon. However, we find that the barrier for inversion between neighboring silicons (along the bond) is quite small (\ensuremath{\lesssim}0.1--0.2 eV); hence, motional effects are significant. Possible manifestations of this asymmetry are discussed.