Author: "Interactions Microorganismes-Insectes" - Searchworks@Jio Institute Digital Library Search Results

Your search keyword '"Interactions Microorganismes-Insectes"' showing total 426 results

Start Over Author "Interactions Microorganismes-Insectes"

426 results on '"Interactions Microorganismes-Insectes"'

1. [i]Steinernema tbilisiensis sp. n.[/i] (Nematoda: Steinernematidae)—A New Species of Entomopathogenic Nematode from Georgia

Author: Patrick Tailliez, Interactions Microorganismes-Insectes, Medea Burjanadze, Oleg Gorgadze, Manana Lortkhipanidze, Jean-Claude Ogier, Institute of Zoology, Ilia State University [Tbilisi], Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro), Agricultural University of Georgia, Gorgadze, Oleg, and Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de la Recherche Agronomique (INRA)
Subjects: 0106 biological sciences, phylogénétique, Spicule, new species, steinernema, morphology, phylogeny, epn, Biodiversité et Ecologie, Biology, medicine.disease_cause, 010603 evolutionary biology, 01 natural sciences, Biodiversity and Ecology, 03 medical and health sciences, Phylogenetics, Botany, medicine, caractérisation morphologique, 030304 developmental biology, 0303 health sciences, Phylogenetic tree, Xenorhabdus bovienii, Entomopathogenic nematode, nématode entomopathogène, Excretory system, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, séquence de gènes, Symbiotic bacteria
Abstract: A new species of entomopathogenic nematode (EPN), Steinernema tbilisiensis sp. n. is described. The species was isolated from soil samples of the deciduous forest located in the Tbilisi area. Morphological and morphometric data as well as phylogenetic analysis show that S. tbilisiensis sp. n. belongs to the group S. affine/intermedium. S. tbilisiensis sp. n. has been attributed to the group S. affine/intermedium on the basis of spicule and gubernaculum structure. The new species differs from other species of S. affine/intermedium group in the following diagnostic characters: the spicule of S. tbilisiensis sp. n. is the smallest and the gubernaculum of S. tbilisiensis sp. n. is shorter than other species of the S. affine/intermedium group. Infective juveniles (IJs) of S. tbilisiensis sp. n. are distinguished by a relatively long body (L = 866 µm), the position of excretory pore (EP = 72 µm), the length of the esophagus (ES = 140 µm) and the length of the anal body width (ABW = 25 µm). IJs of S. tbilisiensis sp. n. have four lateral lines like S. beddingi, but the number of lines is six in S. affine, S. sichuanense and S. intermedium. Also the analysis of rDNA (28S and ITS) gene sequences depicts this Steinernema species as a distinct and unique entity. The symbiotic bacteria of S. tbilisiensis sp. n. was isolated and found to be Xenorhabdus bovienii using a multigene approach.
Published: 2015
Full Text: View/download PDF

2. BRC4Env, a network of Biological Resource Centres for research in environmental and agricultural sciences

Author: Mougin, Christian, Artige, Emmanuelle, Marchand, Frédéric, Mondy, Samuel, Ratié, Céline, Sellier, Nadine, Castagnone, Philippe, Coeur D'Acier, Armelle, Esmenjaud, Daniel, Faivre-Primot, Céline, Granjon, Laurent, Hamelet, Valérie, Lange, Frédéric, Pages, Sylvie, Rimet, Frédéric, Ris, Nicolas, Salle, Guillaume, Ecologie fonctionnelle et écotoxicologie des agroécosystèmes (ECOSYS), Institut National de la Recherche Agronomique (INRA)-AgroParisTech, Université Paris-Saclay, Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut National de la Recherche Agronomique (INRA)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Unité d'Ecologie et Ecotoxicologie Aquatiques (UEEA), Institut National de la Recherche Agronomique (INRA), Agroécologie [Dijon], Institut National de la Recherche Agronomique (INRA)-Université de Bourgogne (UB)-AgroSup Dijon - Institut National Supérieur des Sciences Agronomiques, de l'Alimentation et de l'Environnement-Université Bourgogne Franche-Comté [COMUE] (UBFC), Unité INFOSOL (ORLEANS INFOSOL), Institut Sophia Agrobiotech [Sophia Antipolis] (ISA), Institut National de la Recherche Agronomique (INRA)-Université Nice Sophia Antipolis (... - 2019) (UNS), Université Côte d'Azur (UCA)-Université Côte d'Azur (UCA)-Centre National de la Recherche Scientifique (CNRS), Centre Alpin de Recherche sur les Réseaux Trophiques et Ecosystèmes Limniques (CARRTEL), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Institut National de la Recherche Agronomique (INRA), Ecologie Comportementale et Biologie des Populations de Poissons (ECOBIOP), Institut National de la Recherche Agronomique (INRA)-Université de Pau et des Pays de l'Adour (UPPA), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), Infectiologie Animale et Santé Publique - IASP (Nouzilly, France), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de la Recherche Agronomique (INRA), InfoSol (InfoSol), Institut Sophia Agrobiotech (ISA), Institut National de la Recherche Agronomique (INRA)-Université Nice Sophia Antipolis (1965 - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS), Institut National de la Recherche Agronomique (INRA)-Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry]), Infectiologie et Santé Publique (UMR ISP), Institut National de la Recherche Agronomique (INRA)-Université de Tours (UT), IBiSA : 2017-224, Ecologie fonctionnelle et écotoxicologie des agroécosystèmes ( ECOSYS ), Institut National de la Recherche Agronomique ( INRA ) -AgroParisTech, Université Paris Saclay, Centre de Biologie pour la Gestion des Populations ( CBGP ), Centre de Coopération Internationale en Recherche Agronomique pour le Développement ( CIRAD ) -Centre international d'études supérieures en sciences agronomiques ( Montpellier SupAgro ) -Institut national de la recherche agronomique [Montpellier] ( INRA Montpellier ) -Université de Montpellier ( UM ) -Institut de Recherche pour le Développement ( IRD [France-Sud] ) -Institut national d’études supérieures agronomiques de Montpellier ( Montpellier SupAgro ), Unité d'Ecologie et Ecotoxicologie Aquatiques ( UEEA ), Institut National de la Recherche Agronomique ( INRA ), Institut National de la Recherche Agronomique ( INRA ) -Université de Bourgogne ( UB ) -AgroSup Dijon - Institut National Supérieur des Sciences Agronomiques, de l'Alimentation et de l'Environnement-Université Bourgogne Franche-Comté ( UBFC ), Unité INFOSOL ( ORLEANS INFOSOL ), Institut Sophia Agrobiotech [Sophia Antipolis] ( ISA ), Centre National de la Recherche Scientifique ( CNRS ) -Université Nice Sophia Antipolis ( UNS ), Université Côte d'Azur ( UCA ) -Université Côte d'Azur ( UCA ) -Institut National de la Recherche Agronomique ( INRA ), Centre Alpin de Recherche sur les Réseaux Trophiques et Ecosystèmes Limniques ( CARRTEL ), Institut National de la Recherche Agronomique ( INRA ) -Université Savoie Mont Blanc ( USMB [Université de Savoie] [Université de Chambéry] ), Ecologie Comportementale et Biologie des Populations de Poissons ( ECOBIOP ), Institut National de la Recherche Agronomique ( INRA ) -Université de Pau et des Pays de l'Adour ( UPPA ), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] ( DGIMI ), Institut National de la Recherche Agronomique ( INRA ) -Université Montpellier 2 - Sciences et Techniques ( UM2 ) -Université de Montpellier ( UM ), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université de Bourgogne (UB)-Institut National de la Recherche Agronomique (INRA)-Université Bourgogne Franche-Comté [COMUE] (UBFC)-AgroSup Dijon - Institut National Supérieur des Sciences Agronomiques, de l'Alimentation et de l'Environnement, Centre National de la Recherche Scientifique (CNRS)-Université Nice Sophia Antipolis (... - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Institut National de la Recherche Agronomique (INRA), and Institut National de la Recherche Agronomique (INRA)-Université de Tours
Subjects: Resource, Nematoda, [SDV]Life Sciences [q-bio], genomic, genetic, biological, resource, ecosystem, research, environment, agriculture, platform, infrastructure, ECOTOX, new questions for terrestrial and aquatic ecotoxicology, Environment, Soil, Genetic, Platform, Animals, Ecosystem, ComputingMilieux_MISCELLANEOUS, Biological Specimen Banks, Infrastructure, Bacteria, Ecology, [ SDV ] Life Sciences [q-bio], Research, Agriculture, Plants, Biological, Genomic
Abstract: International audience; The Biological Resource Centre for the Environment BRC4Env is a network of Biological Resource Centres (BRCs) and collections whose leading objectives are to improve the visibility of genetic and biological resources maintained by its BRCs and collections and to facilitate their use by a large research community, from agriculture research to life sciences and environmental sciences. Its added value relies on sharing skills, harmonizing practices, triggering projects in comparative biology, and ultimately proposing a single-entry portal to facilitate access to documented samples, taking into account the partnership policies of research institutions as well as the legal frame which varies with the biological nature of resources. BRC4Env currently includes three BRCs: the Centre for Soil Genetic Resources of the platform GenoSol, in partnership with the European Conservatory of Soil Samples; the Egg Parasitoids Collection (EP-Coll); and the collection of ichthyological samples, Colisa. BRC4Env is also associated to several biological collections: microbial consortia (entomopathogenic bacteria, freshwater microalgae…), terrestrial arthropods, nematodes (plant parasitic, entomopathogenic, animal parasitic...), and small mammals. The BRCs and collections of BRC4Env are involved in partnership with academic scientists, as well as private companies, in the fields of medicinal mining, biocontrol, sustainable agriculture, and additional sectors. Moreover, the staff of the BRCs is involved in many training courses for students from French licence degree to Ph.D, engineers, as well as ongoing training.
Published: 2018
Full Text: View/download PDF

3. An antimicrobial peptide-resistant minor subpopulation of Photorhabdus luminescens is responsible for virulence

Author: Emeric Dubois, Sylvie Pagès, Anne Lanois, Julien Brillard, Maurine Bonabaud, Annabelle Mouammine, Sophie Gaudriault, Alain Givaudan, David Roche, Grégory Jubelin, Ludovic Legrand, Stéphane Cruveiller, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] ( DGIMI ), Institut National de la Recherche Agronomique ( INRA ) -Université Montpellier 2 - Sciences et Techniques ( UM2 ) -Université de Montpellier ( UM ), Microbiologie Environnement Digestif Santé - Clermont Auvergne ( MEDIS ), Université Clermont Auvergne ( UCA ) -INRA Clermont-Ferrand-Theix, GenomiX, Institut de Génomique Fonctionnelle, Génomique métabolique ( UMR 8030 ), Commissariat à l'énergie atomique et aux énergies alternatives ( CEA ) -Université d'Évry-Val-d'Essonne ( UEVE ) -Université Paris-Saclay-Centre National de la Recherche Scientifique ( CNRS ), Institut de Génomique Fonctionnelle ( IGF ), Centre National de la Recherche Scientifique ( CNRS ) -Université Montpellier 2 - Sciences et Techniques ( UM2 ) -Institut National de la Santé et de la Recherche Médicale ( INSERM ) -Université Montpellier 1 ( UM1 ) -Université de Montpellier ( UM ), Centre Interlangues - Texte, Image, Langage ( TIL ), Université de Bourgogne ( UB ), Interactions plantes-microorganismes et santé végétale, Institut National de la Recherche Agronomique ( INRA ) -Université Nice Sophia Antipolis ( UNS ), Université Côte d'Azur ( UCA ) -Université Côte d'Azur ( UCA ) -Centre National de la Recherche Scientifique ( CNRS ), Sécurité et Qualité des Produits d'Origine Végétale ( SQPOV ), Institut National de la Recherche Agronomique ( INRA ) -Université d'Avignon et des Pays de Vaucluse ( UAPV ), Ecologie microbienne des insectes et interactions hôte-pathogène ( EMIP ), Institut National de la Recherche Agronomique ( INRA ) -Université Montpellier 2 - Sciences et Techniques ( UM2 ), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), Microbiologie Environnement Digestif Santé - Clermont Auvergne (MEDIS), INRA Clermont-Ferrand-Theix-Université Clermont Auvergne (UCA), Institut de Génomique Fonctionnelle - Montpellier GenomiX (IGF MGX), Institut de Génomique Fonctionnelle (IGF), Université de Montpellier (UM)-Université Montpellier 1 (UM1)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Université Montpellier 1 (UM1)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Centre National de la Recherche Scientifique (CNRS), Analyse Bio-Informatique pour la Génomique et le Métabolisme (LABGeM), Génomique métabolique (UMR 8030), Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), Université Paris-Saclay-Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université d'Évry-Val-d'Essonne (UEVE)-Centre National de la Recherche Scientifique (CNRS)-Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université d'Évry-Val-d'Essonne (UEVE)-Centre National de la Recherche Scientifique (CNRS), Centre National de la Recherche Scientifique (CNRS), Laboratoire des interactions plantes micro-organismes (LIPM), Centre National de la Recherche Scientifique (CNRS)-Institut National de la Recherche Agronomique (INRA), INRA 2011_1333_03 2015_1333, Microbiologie Environnement Digestif Santé (MEDIS), Institut National de la Recherche Agronomique (INRA)-Université Clermont Auvergne [2017-2020] (UCA [2017-2020]), Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)-BioCampus (BCM), Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS), Institut National de la Recherche Agronomique (INRA)-Centre National de la Recherche Scientifique (CNRS), Université Clermont Auvergne (UCA)-INRA Clermont-Ferrand-Theix, Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Centre National de la Recherche Scientifique (CNRS)-Université d'Évry-Val-d'Essonne (UEVE)-Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Centre National de la Recherche Scientifique (CNRS)-Université d'Évry-Val-d'Essonne (UEVE), Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Centre National de la Recherche Scientifique (CNRS)-Université d'Évry-Val-d'Essonne (UEVE)-Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Centre National de la Recherche Scientifique (CNRS)-Université d'Évry-Val-d'Essonne (UEVE), INRA Clermont-Ferrand-Theix-Université Clermont Auvergne [2017-2020] (UCA [2017-2020]), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Université d'Évry-Val-d'Essonne (UEVE)-Centre National de la Recherche Scientifique (CNRS)-Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), and Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Université d'Évry-Val-d'Essonne (UEVE)-Centre National de la Recherche Scientifique (CNRS)
Subjects: 0301 basic medicine, Insecta, Operon, [SDV]Life Sciences [q-bio], [ SDV.AEN ] Life Sciences [q-bio]/Food and Nutrition, 030106 microbiology, Population, salmonella, Virulence, Drug resistance, [ SDV.MP.BAC ] Life Sciences [q-bio]/Microbiology and Parasitology/Bacteriology, peptide antimicrobien, Article, Bacterial genetics, Microbiology, 03 medical and health sciences, inhomogeneity, Disk Diffusion Antimicrobial Tests, Photorhabdus luminescens, Drug Resistance, Bacterial, Gene Order, hétérogénéité, Animals, education, ComputingMilieux_MISCELLANEOUS, photorhabdus luminescens, bactérie, education.field_of_study, Multidisciplinary, biology, Gene Expression Profiling, Enterobacteriaceae Infections, biology.organism_classification, bacterium, 030104 developmental biology, Regulon, Gene Expression Regulation, Genes, Bacterial, Mutation, Photorhabdus, Antimicrobial Cationic Peptides
Abstract: Some of the bacterial cells in isogenic populations behave differently from others. We describe here how a new type of phenotypic heterogeneity relating to resistance to cationic antimicrobial peptides (CAMPs) is determinant for the pathogenic infection process of the entomopathogenic bacterium Photorhabdus luminescens. We demonstrate that the resistant subpopulation, which accounts for only 0.5% of the wild-type population, causes septicemia in insects. Bacterial heterogeneity is driven by the PhoPQ two-component regulatory system and expression of pbgPE, an operon encoding proteins involved in lipopolysaccharide (LPS) modifications. We also report the characterization of a core regulon controlled by the DNA-binding PhoP protein, which governs virulence in P. luminescens. Comparative RNAseq analysis revealed an upregulation of marker genes for resistance, virulence and bacterial antagonism in the pre-existing resistant subpopulation, suggesting a greater ability to infect insect prey and to survive in cadavers. Finally, we suggest that the infection process of P. luminescens is based on a bet-hedging strategy to cope with the diverse environmental conditions experienced during the lifecycle.
Published: 2017
Full Text: View/download PDF

4. Pathobiome entomopathogenic nematodes Development of methodology for a taxonomic assignation at the species level in the the pathobiome of entomopathogenic nematodes from the Steinernema genus

Author: Ogier, Jean-Claude, Gaudriault, Sophie, Heuillard, Pauline, Zemb, Olivier, Carrere, Sebastien, Galan, Maxime, Barret, Matthieu, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), GeT PlaGe, Genotoul, Institut National de la Recherche Agronomique (INRA), Génétique Physiologie et Systèmes d'Elevage (GenPhySE ), Institut National de la Recherche Agronomique (INRA)-Ecole Nationale Vétérinaire de Toulouse (ENVT), Institut National Polytechnique (Toulouse) (Toulouse INP), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Institut National Polytechnique (Toulouse) (Toulouse INP), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-École nationale supérieure agronomique de Toulouse [ENSAT], Laboratoire des interactions plantes micro-organismes (LIPM), Centre National de la Recherche Scientifique (CNRS)-Institut National de la Recherche Agronomique (INRA), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut National de la Recherche Agronomique (INRA)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Institut de Recherche en Horticulture et Semences (IRHS), AGROCAMPUS OUEST-Institut National de la Recherche Agronomique (INRA)-Université d'Angers (UA), Génome et Transcriptome - Plateforme Génomique (GeT-PlaGe), Institut National de la Recherche Agronomique (INRA)-Plateforme Génome & Transcriptome (GET), Génopole Toulouse Midi-Pyrénées [Auzeville] (GENOTOUL), Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Ecole Nationale Vétérinaire de Toulouse (ENVT), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Génopole Toulouse Midi-Pyrénées [Auzeville] (GENOTOUL), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), École nationale supérieure agronomique de Toulouse [ENSAT]-Institut National de la Recherche Agronomique (INRA)-Ecole Nationale Vétérinaire de Toulouse (ENVT), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées, Institut National de la Recherche Agronomique (INRA)-Centre National de la Recherche Scientifique (CNRS), Université d'Angers (UA)-Institut National de la Recherche Agronomique (INRA)-AGROCAMPUS OUEST, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] ( DGIMI ), Institut National de la Recherche Agronomique ( INRA ) -Université Montpellier 2 - Sciences et Techniques ( UM2 ) -Université de Montpellier ( UM ), Institut National de la Recherche Agronomique ( INRA ), GenPhySE - UMR 1388 ( Génétique Physiologie et Systèmes d'Elevage ), Institut National de la Recherche Agronomique ( INRA ) -École nationale supérieure agronomique de Toulouse [ENSAT]-ENVT, Interactions plantes-microorganismes et santé végétale, Université Nice Sophia Antipolis ( UNS ), Université Côte d'Azur ( UCA ) -Université Côte d'Azur ( UCA ) -Centre National de la Recherche Scientifique ( CNRS ) -Institut National de la Recherche Agronomique ( INRA ), Centre de Biologie pour la Gestion des Populations ( CBGP ), Centre de Coopération Internationale en Recherche Agronomique pour le Développement ( CIRAD ) -Centre international d'études supérieures en sciences agronomiques ( Montpellier SupAgro ) -Institut national de la recherche agronomique [Montpellier] ( INRA Montpellier ) -Université de Montpellier ( UM ) -Institut de Recherche pour le Développement ( IRD [France-Sud] ) -Institut national d’études supérieures agronomiques de Montpellier ( Montpellier SupAgro ), Institut de Recherche en Horticulture et Semences ( IRHS ), Université d'Angers ( UA ) -Institut National de la Recherche Agronomique ( INRA ) -AGROCAMPUS OUEST, Institut National des Sciences Appliquées - Toulouse (INSA Toulouse), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université Toulouse III - Paul Sabatier (UT3), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut National des Sciences Appliquées - Toulouse (INSA Toulouse), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université Fédérale Toulouse Midi-Pyrénées-Université Fédérale Toulouse Midi-Pyrénées-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Ecole Nationale Vétérinaire de Toulouse (ENVT), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM)-Institut National des Sciences Appliquées - Toulouse (INSA Toulouse), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM)-Génopole Toulouse Midi-Pyrénées [Auzeville] (GENOTOUL), Université Fédérale Toulouse Midi-Pyrénées-Institut National de la Santé et de la Recherche Médicale (INSERM), AGROCAMPUS OUEST, and Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de la Recherche Agronomique (INRA)-Université d'Angers (UA)
Subjects: [ SDE.BE ] Environmental Sciences/Biodiversity and Ecology, taxonomy, amplification d'adn, activité intestinale, sol, microbiote, taxonomie, interaction microorganisme insecte, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, steinernema, écologie des populations, soil, nématode
Abstract: Pathobiome entomopathogenic nematodes Development of methodology for a taxonomic assignation at the species level in the the pathobiome of entomopathogenic nematodes from the [i]Steinernema[/i] genus . 2017 Scientific MEM days: Journées scientifiques MEM (Métaomiques et écosystèmes microbiens)
Published: 2017

5. Origine et évolution des protéines RhoGAP associées aux vésicules chez deux guêpes parasitoïdes non apparentées

Author: Colinet, Dominique, Cavigliasso, Fanny, Leobold, Matthieu, Pichon, Appoline, Urbach, Serge, Cazes, Dominique, Poullet, Marine, Belghazi, Maya, Volkoff, Anne-Nathalie, Drezen, Jean-Michel, Gatti, Jean-Luc, Poirie, Marylene, Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (1965 - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), Institut de recherche sur la biologie de l'insecte UMR7261 (IRBI), Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Institut de Microbiologie de la Méditerranée (IMM), Aix Marseille Université (AMU)-Centre National de la Recherche Scientifique (CNRS), Department of Plant Health and Environment from INRAE, and ANR-11-LABX-0028,SIGNALIFE,Réseau d'Innovation sur les Voies de Signalisation en Sciences de la Vie(2011)
Subjects: RhoGAP multigene family, positive selection, [SDV]Life Sciences [q-bio], [SDV.BID.EVO]Life Sciences [q-bio]/Biodiversity/Populations and Evolution [q-bio.PE], evolution, gene duplication, venom and other secretions, parasitoids
Abstract: Animal venoms and other protein-based secretions that perform a variety of functions, from predation to defense, are highly complex cocktails of bioactive compounds. Gene duplication, accompanied by modification of the expression and/or function of one of the duplicates under the action of positive selection, followed by further duplication to produce multigene families of toxins is a well-documented process in venomous animals. This evolutionary model has been less described in parasitoid wasps, which use maternal fluids, including venom, to protect their eggs from encapsulation by the host immune system. Here, we evidence the convergent recruitment and accelerated evolution of two multigene families of RhoGAPs presumably involved in virulence in two unrelated parasitoid wasp species, Leptopilina boulardi (Figitidae) and Venturia canescens (Icheumonidae). In both species, these RhoGAPs are associated with vesicles that act as transport systems to deliver virulence factors, but are produced in different tissues: the venom gland in Leptopilina sp. and the ovarian calyx in V. canescens. We show that the gene encoding the cellular RacGAP1 is at the origin of the virulent RhoGAP families found in Leptopilina sp. and V. canescens. We also show that both RhoGAP families have undergone evolution under positive selection and that almost all of these RhoGAPs lost their GAP activity and GTPase binding ability due to mutations in key amino acids. These results suggest an accelerated evolution and functional diversification of these vesicle-associated RhoGAPs in the two phylogenetically distant parasitoid species. The potential new function(s) and the exact mechanism of action of these proteins in host cells remain to be elucidated.; Les venins d'animaux et d'autres sécrétions à base de protéines qui remplissent diverses fonctions, de la prédation à la défense, sont des cocktails très complexes de composés bioactifs. La duplication des gènes, accompagnée d'une modification de l'expression et/ou de la fonction de l'une des duplications sous l'action de la sélection positive, suivie d'une nouvelle duplication pour produire des familles multigéniques de toxines, est un processus bien documenté chez les animaux venimeux. Ce modèle évolutif a été moins décrit chez les guêpes parasitoïdes, qui utilisent les fluides maternels, y compris le venin, pour protéger leurs œufs de l'encapsulation par le système immunitaire de l'hôte. Nous démontrons ici le recrutement convergent et l'évolution accélérée de deux familles multigéniques de RhoGAPs probablement impliquées dans la virulence chez deux espèces de guêpes parasitoïdes non apparentées, Leptopilina boulardi (Figitidae) et Venturia canescens (Icheumonidae). Chez les deux espèces, ces RhoGAP sont associées à des vésicules qui agissent comme des systèmes de transport pour délivrer les facteurs de virulence, mais elles sont produites dans des tissus différents : la glande à venin chez Leptopilina sp. et le calice ovarien chez V. canescens. Nous montrons que le gène codant pour la RacGAP1 cellulaire est à l'origine des familles de RhoGAP virulentes trouvées chez Leptopilina sp. et V. canescens. Nous montrons également que les deux familles RhoGAP ont subi une évolution sous sélection positive et que presque toutes ces RhoGAP ont perdu leur activité GAP et leur capacité de liaison à la GTPase en raison de mutations dans des acides aminés clés. Ces résultats suggèrent une évolution accélérée et une diversification fonctionnelle de ces RhoGAP associées aux vésicules chez les deux espèces de parasitoïdes phylogénétiquement éloignées. Les nouvelles fonctions potentielles et le mécanisme d'action exact de ces protéines dans les cellules hôtes restent à élucider.
Published: 2023

6. pWCP is a widely distributed and highly conserved Wolbachia plasmid in Culex pipiens and Culex quinquefasciatus mosquitoes worldwide

Author: Amani Ghousein, Jordan Tutagata, Hans Schrieke, Manuel Etienne, Victor Chaumeau, Sebastien Boyer, Nonito Pages, David Roiz, A. Murat Eren, Guillaume Cambray, Julie Reveillaud, Biothérapies des maladies génétiques et cancers, Université Bordeaux Segalen - Bordeaux 2-Institut National de la Santé et de la Recherche Médicale (INSERM), Maladies infectieuses et vecteurs : écologie, génétique, évolution et contrôle (MIVEGEC), Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD [France-Sud])-Université de Montpellier (UM), Laboratoire d'Ecologie Alpine (LECA ), Université Savoie Mont Blanc (USMB [Université de Savoie] [Université de Chambéry])-Centre National de la Recherche Scientifique (CNRS)-Université Grenoble Alpes (UGA), Centre de Démoustication, Conseil Général de Martinique, Shoklo Malaria Research Unit [Mae Sot, Thailand] (SMRU), Mahidol Oxford Tropical Medicine Research Unit (MORU), University of Oxford-Mahidol University [Bangkok]-Wellcome Trust-University of Oxford-Mahidol University [Bangkok]-Wellcome Trust, Centre for Tropical Medicine and Global Health [Oxford, UK], Nuffield Department of Medicine [Oxford, UK] (Big Data Institute), University of Oxford-University of Oxford, Institut Pasteur du Cambodge, Réseau International des Instituts Pasteur (RIIP), Animal, Santé, Territoires, Risques et Ecosystèmes (UMR ASTRE), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Département Systèmes Biologiques (Cirad-BIOS), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), Helmholtz Institute for Functional Marine Biodiversity at the University of Oldenburg (HIFMB), Carl Von Ossietzky Universität Oldenburg = Carl von Ossietzky University of Oldenburg (OFFIS), Marine Biological Laboratory, Woods Hole, Massachusetts, USA, Centre de Biologie Structurale [Montpellier] (CBS), Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), and Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM)
Subjects: [SDV]Life Sciences [q-bio], General Medicine
Abstract: Mosquitoes represent the most important pathogen vectors and are responsible for the spread of a wide variety of poorly treatable diseases. Wolbachia are obligate intracellular bacteria that are widely distributed among arthropods and collectively represents one of the most promising solutions for vector control. In particular, Wolbachia has been shown to limit the transmission of pathogens, and to dramatically affect the reproductive behavior of their host through its phage WO. While much research has focused on deciphering and exploring the biocontrol applications of these WO-related phenotypes, the extent and potential impact of the Wolbachia mobilome remain poorly appreciated. Notably, several Wolbachia plasmids, carrying WO-like genes and Insertion Sequences (IS), thus possibly interrelated to other genetic units of the endosymbiont, have been recently discovered. Here we investigated the diversity and biogeography of the first described plasmid of Wolbachia in Culex pipiens (pWCP) in several islands and continental countries around the world—including Cambodia, Guadeloupe, Martinique, Thailand, and Mexico—together with mosquito strains from colonies that evolved for 2 to 30 years in the laboratory. We used PCR and qPCR to determine the presence and copy number of pWCP in individual mosquitoes, and highly accurate Sanger sequencing to evaluate potential variations. Together with earlier observation, our results show that pWCP is omnipresent and strikingly conserved among Wolbachia populations within mosquitoes from distant geographies and environmental conditions. These data suggest a critical role for the plasmid in Wolbachia ecology and evolution, and the potential of a great tool for further genetic dissection and possible manipulation of this endosymbiont.
Published: 2023
Full Text: View/download PDF

7. Genomics of adaptation to host-plants in herbivorous insects

Author: Jean Peccoud, Pierre Nouhaud, Endrick Guy, Réjane Streiff, Jean-Christophe Simon, Emmanuelle d'Alençon, Akiko Sugio, Emmanuelle Jacquin-Joly, Julie Jaquiéry, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Institut National de la Recherche Agronomique (INRA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Diversité, Génomes et Interactions Microorganismes-Insectes, Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2), Institut d'écologie et des sciences de l'environnement de Paris (iEES Paris), Institut National de la Recherche Agronomique (INRA)-Sorbonne Université (SU)-Université Paris-Est Créteil Val-de-Marne - Paris 12 (UPEC UP12)-Centre National de la Recherche Scientifique (CNRS), Origine, structure et évolution de la biodiversité (OSEB), Muséum national d'Histoire naturelle (MNHN)-Centre National de la Recherche Scientifique (CNRS), Laboratoire Traitement et Communication de l'Information (LTCI), Télécom ParisTech-Institut Mines-Télécom [Paris] (IMT)-Centre National de la Recherche Scientifique (CNRS), Institut d'écologie et des sciences de l'environnement de Paris (IEES), Institut National de la Recherche Agronomique (INRA)-Université Pierre et Marie Curie - Paris 6 (UPMC)-Université Paris-Est Créteil Val-de-Marne - Paris 12 (UPEC UP12)-Centre National de la Recherche Scientifique (CNRS), Ecosystèmes, biodiversité, évolution [Rennes] (ECOBIO), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut Ecologie et Environnement (INEE), Centre National de la Recherche Scientifique (CNRS)-Centre National de la Recherche Scientifique (CNRS)-Observatoire des Sciences de l'Univers de Rennes (OSUR)-Centre National de la Recherche Scientifique (CNRS), AGROCAMPUS OUEST-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National de la Recherche Agronomique (INRA), Ecologie, Evolution, Symbiose (EES), Ecologie et biologie des interactions (EBI), Université de Poitiers-Centre National de la Recherche Scientifique (CNRS)-Université de Poitiers-Centre National de la Recherche Scientifique (CNRS), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de la Recherche Agronomique (INRA), This work received supports from ANR Speciaphid (ANR-11-BSV7-005-01) to JCS, ANR Ada-Spodo (ANR-12-BSV7-0004-01) to EA, ANR Bugspit (ANR-13-JSV7-0012-01) to AS and ANR Adapt-Ome (ANR-13-BSV7-0012-01) to RS., ANR-11-BSV7-0005,SPECIAPHID,Génétique de l'adaptation trophique et mécanismes d'isolement reproducteur chez les pucerons(2011), ANR-12-BSV7-0004,ADA-SPODO,Déterminisme moléculaire de l’adaptation écologique et de la spéciation chez deux variants du lépidoptère Spodoptera frugiperda(2012), ANR-13-JSV7-0012,Bugspit,Mécanismes moléculaires impliqués dans la spécialisation des pucerons à leurs hôtes(2013), Centre National de la Recherche Scientifique (CNRS)-Université Paris-Est Créteil Val-de-Marne - Paris 12 (UPEC UP12)-Université Pierre et Marie Curie - Paris 6 (UPMC)-Institut National de la Recherche Agronomique (INRA), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), ANR-12-BSV7-0004,ADA-SPODO,Déterminisme moléculaire de l'adaptation écologique et de la spéciation chez deux variants du lépidoptère Spodoptera frugiperda(2012), and Institut National de la Recherche Agronomique (INRA)-Université de Rennes (UR)-AGROCAMPUS OUEST
Subjects: Insecta, media_common.quotation_subject, Population, Genomics, Insect, salivary genes, Biology, Biochemistry, Host-Parasite Interactions, Hemiptera, Genetics, Animals, Herbivory, Mating, detoxification, education, Molecular Biology, chemosensory genes, media_common, education.field_of_study, Herbivore, mechanisms, plant cues, [SDV.GEN]Life Sciences [q-bio]/Genetics, Host (biology), Ecology, fungi, food and beverages, plant–insect interactions, General Medicine, Reproductive isolation, 15. Life on land, Plants, Adaptation, Physiological, Lepidoptera, Adaptation, [SDE.BE]Environmental Sciences/Biodiversity and Ecology
Abstract: International audience; Herbivorous insects represent the most species-rich lineages of metazoans. The high rate of diversification in herbivorous insects is thought to result from their specialization to distinct host-plants, which creates conditions favorable for the build-up of reproductive isolation and speciation. These conditions rely on constraints against the optimal use of a wide range of plant species, as each must constitute a viable food resource, oviposition site and mating site for an insect. Utilization of plants involves many essential traits of herbivorous insects, as they locate and select their hosts, overcome their defenses and acquire nutrients while avoiding intoxication. Although advances in understanding insect-plant molecular interactions have been limited by the complexity of insect traits involved in host use and the lack of genomic resources and functional tools, recent studies at the molecular level, combined with large-scale genomics studies at population and species levels, are revealing the genetic underpinning of plant specialization and adaptive divergence in non-model insect herbivores. Here, we review the recent advances in the genomics of plant adaptation in hemipterans and lepidopterans, two major insect orders, each of which includes a large number of crop pests. We focus on how genomics and post-genomics have improved our understanding of the mechanisms involved in insect-plant interactions by reviewing recent molecular discoveries in sensing, feeding, digesting and detoxifying strategies. We also present the outcomes of large-scale genomics approaches aimed at identifying loci potentially involved in plant adaptation in these insects.
Published: 2015
Full Text: View/download PDF

8. Massive Somatic and Germline Chromosomal Integrations of Polydnaviruses in Lepidopterans

Author: Camille Heisserer, Héloïse Muller, Véronique Jouan, Karine Musset, Georges Periquet, Jean-Michel Drezen, Anne-Nathalie Volkoff, Clément Gilbert, Evolution, génomes, comportement et écologie (EGCE), Institut de Recherche pour le Développement (IRD)-Université Paris-Saclay-Centre National de la Recherche Scientifique (CNRS), Institut de recherche sur la biologie de l'insecte UMR7261 (IRBI), Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), and ANR-18-CE02-0021,TranspHorizon,Transferts horizontaux d'éléments transposables: les clés d'une invasion réussie(2018)
Subjects: parasitoid wasps, [SDV]Life Sciences [q-bio], evolutionary genomics, Genetics, polydnavirus, insects, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, horizontal transfer, host-parasite relationships, Molecular Biology, Ecology, Evolution, Behavior and Systematics
Abstract: Increasing numbers of horizontal transfer (HT) of genes and transposable elements are reported in insects. Yet the mechanisms underlying these transfers remain unknown. Here we first quantify and characterize the patterns of chromosomal integration of the polydnavirus (PDV) encoded by the Campopleginae Hyposoter didymator parasitoid wasp (HdIV) in somatic cells of parasitized fall armyworm (Spodoptera frugiperda). PDVs are domesticated viruses injected by wasps together with their eggs into their hosts in order to facilitate the development of wasp larvae. We found that six HdIV DNA circles integrate into the genome of host somatic cells. Each host haploid genome suffers between 23 and 40 integration events (IEs) on average 72 h post-parasitism. Almost all IEs are mediated by DNA double-strand breaks occurring in the host integration motif (HIM) of HdIV circles. We show that despite their independent evolutionary origins, PDV from both Campopleginae and Braconidae wasps use remarkably similar mechanisms for chromosomal integration. Next, our similarity search performed on 775 genomes reveals that PDVs of both Campopleginae and Braconidae wasps have recurrently colonized the germline of dozens of lepidopteran species through the same mechanisms they use to integrate into somatic host chromosomes during parasitism. We found evidence of HIM-mediated HT of PDV DNA circles in no less than 124 species belonging to 15 lepidopteran families. Thus, this mechanism underlies a major route of HT of genetic material from wasps to lepidopterans with likely important consequences on lepidopterans.
Published: 2023
Full Text: View/download PDF

9. Virion-associated nucleic acid-based metagenomics: a decade of advances in molecular characterization of plant viruses

Author: Moubset, Oumaima, François, Sarah, Maclot, François, Palanga, Essowé, Julian, Charlotte, Claude, Lisa, Fernandez, Emmanuel, Rott, Philippe, Daugrois, Jean-Heinrich, Antoine-Lorquin, Aymeric, Bernardo, Pauline, Blouin, Arnaud G., Temple, Coline, Kraberger, Simona, Fontenele, Rafaela S, Harkins, Gordon William, Ma, Yuxin, Marais, Armelle, Candresse, Thierry, Ben Chehida, Sélim, Lefeuvre, Pierre, Lett, Jean-Michel, Varsani, Arvind, Massart, Sébastien, Ogliastro, Mylène, Martin, Darren Patrick, Filloux, Denis, Roumagnac, Philippe, Plant Health Institute of Montpellier (UMR PHIM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), Département Systèmes Biologiques (Cirad-BIOS), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), University of Oxford, Gembloux Agro-Bio Tech [Gembloux], Université de Liège, Institut Togolais de Recherche Agronomique (ITRA), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Enza Zaden, Agroscope, Arizona State University [Tempe] (ASU), University of the Western Cape (UWC), Biologie du fruit et pathologie (BFP), Université de Bordeaux (UB)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Peuplements végétaux et bioagresseurs en milieu tropical (UMR PVBMT), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de La Réunion (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), University of Cape Town, European Union (ERDF, contract GURDT I2016-1731-0006632), Conseil Régional de La Réunion, project SEVIPLANT from Federal Public 17 Service, Public Health, Belgium, Grant Agreement no. RT 18/3, ANR-19-CE35-0008,PHYTOVIRUS,Mesure et cartographie de la richesse des virus des plante à l'échelle de l'écosytème(2019), and European Project: 813542,INEXTVIR
Subjects: Identification, Ecology, viruses, [SDV]Life Sciences [q-bio], Virion, Virus des végétaux, [SDV.BC.BC]Life Sciences [q-bio]/Cellular Biology/Subcellular Processes [q-bio.SC], Plants, génomique, Plant Viruses, [SDV.BA.ZI]Life Sciences [q-bio]/Animal biology/Invertebrate Zoology, Nucleic Acids, Virology, [SDV.MP.VIR]Life Sciences [q-bio]/Microbiology and Parasitology/Virology, Metagenomics, Pathogen Detection, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, Ecosystem, H20 - Maladies des plantes, Plant Diseases
Abstract: Over the last decade, viral metagenomic studies have resulted in the discovery of thousands of previously unknown viruses. These studies are likely to play a pivotal role in obtaining an accurate and robust understanding of how viruses affect the stability and productivity of ecosystems. Among the metagenomics-based approaches that have been developed since the beginning of the 21st century, shotgun metagenomics applied specifically to virion-associated nucleic acids (VANA) has been used to disentangle the diversity of the viral world. We summarize herein the results of 24 VANA-based studies, focusing on plant and insect samples conducted over the last decade (2010 to 2020). Collectively, viruses from 85 different families were reliably detected in these studies, including capsidless RNA viruses that replicate in fungi, oomycetes, and plants. Finally, strengths and weaknesses of the VANA approach are summarized and perspectives of applications in detection, epidemiological surveillance, environmental monitoring, and ecology of plant viruses are provided. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.
Published: 2022
Full Text: View/download PDF

10. The evolutionary process of invasion in the fall armyworm (Spodoptera frugiperda)

Author: Sudeeptha Yainna, Wee Tek Tay, Karine Durand, Estelle Fiteni, Frédérique Hilliou, Fabrice Legeai, Anne-Laure Clamens, Sylvie Gimenez, R. Asokan, C. M. Kalleshwaraswamy, Sharanabasappa S. Deshmukh, Robert L. Meagher, Carlos A. Blanco, Pierre Silvie, Thierry Brévault, Anicet Dassou, Gael J. Kergoat, Thomas Walsh, Karl Gordon, Nicolas Nègre, Emmanuelle d’Alençon, Kiwoong Nam, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Agroécologie et Intensification Durables des cultures annuelles (UPR AIDA), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), CSIRO Agriculture and Food (CSIRO), Black Mountain Laboratories, Commonwealth Scientific and Industrial Research Organisation [Canberra] (CSIRO), Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (1965 - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Rennes Angers, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), Indian Institute of Horticultural Research [Bangalore] (ICAR), University of Agricultural and Horticultural Sciences [Shivamogga] (UAHS), USDA-ARS : Agricultural Research Service, USDA Agricultural Research Service [Beltsville, Maryland], Plant Health Institute of Montpellier (UMR PHIM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Ecole Nationale Supérieure des Biosciences et Biotechnologies Appliquées (ENSBBA), Plateforme bioinformatique GenOuest [Rennes], Université de Rennes (UR)-Plateforme Génomique Santé Biogenouest®-Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), This work (ID 1702-018, given to KN) was publicly funded through ANR (the French National Research Agency) under the 'Investissements d'avenir' programme with the reference ANR-10-LABX-0001 Labex Agro and coordinated by Agropolis Fondation under the frame of I-SITE MUSE (ANR-16-IDEX-0006). In addition, a grant from the department of Sante des Plantes et Environnement at Institut national de la recherche agronomique for KN ( adaptivesv). This work was also financially supported by EUPHRESCO (FAW-spedcom, given to Anne-Nathalie Volkoff) and by CSIRO Health & biosecurity (given to WTT, TW, and KG). SY was supported by a CIRAD-INRAE PhD fellowship. We are grateful to the genotoul bioinformatics platform Toulouse Occitanie (Bioinfo Genotoul, https://doi.org/10.15454/1.557236932896116 7E12) for providing help and/or computing and/or storage resources., ANR-10-LABX-0001,AGRO,Agricultural Sciences for sustainable Development(2010), and ANR-16-IDEX-0006,MUSE,MUSE(2016)
Subjects: Multidisciplinary, MESH: Humans, MESH: Spodoptera, MESH: Asia, MESH: Africa, Western, Spodoptera frugiperda, MESH: Animals, MESH: Africa, [INFO.INFO-BI]Computer Science [cs]/Bioinformatics [q-bio.QM], MESH: Phylogeny, H10 - Ravageurs des plantes
Abstract: The resequencing dataset generated during the current study is available in the NCBI SRA (Accession Number: PRJNA639295).Computer programming scripts used in this study are available on GitHub (https://github.com/kiwoong-nam/FAW_invasion).; International audience; The fall armyworm (FAW; S podoptera frugiperda ) is one of the major agricultural pest insects. FAW is native to the Americas, and its invasion was first reported in West Africa in 2016. Then it quickly spread through Africa, Asia, and Oceania, becoming one of the main threats to corn production. We analyzed whole genome sequences of 177 FAW individuals from 12 locations on four continents to infer evolutionary processes of invasion. Principal component analysis from the TPI gene and whole genome sequences shows that invasive FAW populations originated from the corn strain. Ancestry coefficient and phylogenetic analyses from the nuclear genome indicate that invasive populations are derived from a single ancestry, distinct from native populations, while the mitochondrial phylogenetic tree supports the hypothesis of multiple introductions. Adaptive evolution specific to invasive populations was observed in detoxification, chemosensory, and digestion genes. We concluded that extant invasive FAW populations originated from the corn strain with potential contributions of adaptive evolution.
Published: 2022
Full Text: View/download PDF

11. Host-plant adaptation as a driver of incipient speciation in the fall armyworm ( Spodoptera frugiperda )

Author: Estelle Fiteni, Karine Durand, Sylvie Gimenez, Robert L. Meagher, Fabrice Legeai, Gael J. Kergoat, Nicolas Nègre, Emmanuelle d’Alençon, Kiwoong Nam, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), USDA-ARS : Agricultural Research Service, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Rennes Angers, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Plateforme bioinformatique GenOuest [Rennes], Université de Rennes (UR)-Plateforme Génomique Santé Biogenouest®-Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), BioInformatics Platform for Agroecosystems Arthropods, Université de Rennes (UR), Scalable, Optimized and Parallel Algorithms for Genomics (GenScale), Inria Rennes – Bretagne Atlantique, Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), This work (ID 1702-018) was publicly funded through ANR (the French National Research Agency) under the 'Investissements d'avenir' programme with the reference ANR-10-LABX-0001 Labex Agro and coordinated by Agropolis Fondation under the frame of I-SITE MUSE (ANR-16-IDEX-0006). In addition, the study is supported by Agence Nationale De La Recherche (ORIGINS, ANR-20-CE92-0018) and by department of Sante des Plantes et Environnement at Institut national de recherche pour l'agriculture, l'alimentation et l'environnement (NewHost)., ANR-10-LABX-0001,AGRO,Agricultural Sciences for sustainable Development(2010), ANR-16-IDEX-0006,MUSE,MUSE(2016), and ANR-20-CE92-0018,ORIGINS,A l'origine de la divergence : les barrières conduisant à l'isolement reproducteur pré- et post-zygotique chez Spodoptera frugiperda(2020)
Subjects: Gene Flow, Reproductive Isolation, speciation with gene flow, Oryza, Spodoptera frugiperda, General Medicine, incipient speciation, Spodoptera, Zea mays, fall armyworm, Humans, Animals, host-plant adaptation, [SDV.BBM]Life Sciences [q-bio]/Biochemistry, Molecular Biology, [SDE.BE]Environmental Sciences/Biodiversity and Ecology
Abstract: Background Divergent selection on host-plants is one of the main evolutionary forces driving ecological speciation in phytophagous insects. The ecological speciation might be challenging in the presence of gene flow and assortative mating because the direction of divergence is not necessarily the same between ecological selection (through host-plant adaptation) and assortative mating. The fall armyworm (FAW), a major lepidopteran pest species, is composed of two sympatric strains, corn and rice strains, named after two of their preferred host-plants. These two strains have been hypothesized to undergo incipient speciation, based on (i) several lines of evidence encompassing both pre- and post-zygotic reproductive isolation, and (ii) the presence of a substantial level of genetic differentiation. Even though the status of these two strains has been established a long time ago, it is still yet to be found whether these two strains indeed exhibit a marked level of genetic differentiation from a large number of genomic loci. Here, we analyzed whole genome sequences from 56 FAW individuals either collected from pasture grasses (a part of the favored host range of the rice strain) or corn to assess the role of host-plant adaptation in incipient speciation. Results Principal component analysis of whole genome data shows that the pattern of divergence in the fall armyworm is predominantly explained by the genetic differentiation associated with host-plants. The level of genetic differentiation between corn and rice strains is particularly marked in the Z chromosome. We identified one autosomal locus and two Z chromosome loci targeted by selective sweeps specific to rice strain and corn strain, respectively. The autosomal locus has both increased DXY and FST while the Z chromosome loci had decreased DXY and increased FST. Conclusion These results show that the FAW population structure is dominated by the genetic differentiation between corn and rice strains. This differentiation involves divergent selection targeting at least three loci, which include a locus potentially causing reproductive isolation. Taken together, these results suggest the evolutionary scenario that host-plant speciation is a driver of incipient speciation in the fall armyworm.
Published: 2022
Full Text: View/download PDF

12. Invasiveness, biology, ecology, and management of the fall armyworm, Spodoptera frugiperda

Author: Kenis, Marc, Benelli, Giovanni, Biondi, Antonio, Calatayud, Paul-André, Day, Roger, Desneux, Nicolas, Harrison, Rhett, Kriticos, Darren, Rwomushana, Ivan, van den Berg, Johnnie, Verheggen, François, Zhang, Yong-Jun, Agboyi, Lakpo Koku, Ahissou, Régis Besmer, Ba, Malick, Bernal, Julio, Nègre, Nicolas, CABI DELEMONT CHE, Partenaires IRSTEA, Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA)-Institut national de recherche en sciences et technologies pour l'environnement et l'agriculture (IRSTEA), University of Pisa - Università di Pisa, University of Catania [Italy], Evolution, génomes, comportement et écologie (EGCE), Institut de Recherche pour le Développement (IRD)-Université Paris-Saclay-Centre National de la Recherche Scientifique (CNRS), Centre for Agricultural and Biosciences International (CABI), Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (1965 - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), Center for International Forestry Research (CIFOR), Consultative Group on International Agricultural Research [CGIAR] (CGIAR), CSIRO Entomology, Commonwealth Scientific and Industrial Research Organisation [Canberra] (CSIRO), North-West University [South Aftrica] (NWU), Université de Liège, Chinese Academy of Agricultural Sciences (CAAS), cabi, Université Polytechnique Nazi Boni Bobo-Dioulasso (UNB), International Crops Research Institute for the Semi-Arid Tropics [Niger] (ICRISAT), International Crops Research Institute for the Semi-Arid Tropics [Inde] (ICRISAT), Consultative Group on International Agricultural Research [CGIAR] (CGIAR)-Consultative Group on International Agricultural Research [CGIAR] (CGIAR), Université du Texas, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Foreign, Commonwealth and Development Office (FCDO) , UK, Netherlands Government, European Commission Directorate-General for International Cooperation and Development (DEVCO), Swiss Agency for Development and Cooperation (SDC) through the Plantwise+ programme, and Ministry of Agriculture, Czech Republic MZE-RO0418
Subjects: biopesticides, integrated pest management, Insect Science, Noctuidae, [SDV]Life Sciences [q-bio], genomics, biological control, globalization, invasive species
Abstract: Early access; International audience; The fall armyworm (FAW), Spodoptera frugiperda (JE Smith, 1797), is a serious pest of several crops, particularly maize and other cereals. It has long been known as a pest in the Americas and has invaded most of Africa and parts of the Middle East, Asia, and Australia in the last six years. Its new status as an invasive species causing serious damage in many regions worldwide has highlighted the need for better understanding and has generated much research. In this article, we provide a comprehensive review of FAW covering its (i) taxonomy, biology, ecology, genomics, and microbiome, (ii) worldwide status and geographic spread, (iii) potential for geographic expansion and quarantine measures in place, and (iv) management including monitoring, sampling, forecasting, biological control, biopesticides, agroecological strategies, chemical control, insecticide resistance, effects of insecticides on natural enemies, as well as conventional and transgenic resistant cultivars. We conclude with recommendations for research to enhance the sustainable management of FAW in invaded regions.
Published: 2022
Full Text: View/download PDF

13. Photorhabdus antibacterial Rhs polymorphic toxin inhibits translation through ADP-ribosylation of 23S ribosomal RNA

Author: Vasili Hauryliuk, Amaury Payelleville, Kathryn Jane Turnbull, Mohammad Roghanian, Eric Cascales, Dukas Jurėnas, Alain Givaudan, Julien Brillard, Laboratoire d'ingénierie des systèmes macromoléculaires (LISM), Aix Marseille Université (AMU)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Umeå University, Lund University [Lund], University of Tartu, Centre National de la Recherche Scientifique (CNRS)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Aix Marseille Université (AMU), Centre National de la Recherche Scientifique (CNRS), Aix Marseille Université, Fondation pour la Recherche MedicaleDEQ20180339165, Fondation Bettencourt Schueller, ANR-17-CE11-0003,NANODROP,Physique du bourgeonnement des gouttelettes lipidiques(2017), ANR-17-CE11-0039,T6-PLATFORM,Une approche multidisciplinaire et intégrative pour comprendre l'assemblage, la structure et la dynamique d'une plateforme de queue contractile(2017), Department of Molecular Biology, Umeå University, 901 87 Umeå, Sweden, CASCALES, ERIC, Physique du bourgeonnement des gouttelettes lipidiques - - NANODROP2017 - ANR-17-CE11-0003 - AAPG2017 - VALID, and Une approche multidisciplinaire et intégrative pour comprendre l'assemblage, la structure et la dynamique d'une plateforme de queue contractile - - T6-PLATFORM2017 - ANR-17-CE11-0039 - AAPG2017 - VALID
Subjects: AcademicSubjects/SCI00010, [SDV]Life Sciences [q-bio], Bacterial Toxins, Biology, Ribosome, Microbiology in the medical area, GTP Phosphohydrolases, 03 medical and health sciences, ADP-Ribosylation, Mikrobiologi inom det medicinska området, Genetics, Protein biosynthesis, RNA and RNA-protein complexes, Secretion, 030304 developmental biology, 0303 health sciences, 030306 microbiology, Effector, Biochemistry and Molecular Biology, RNA, Type VI Secretion Systems, NAD, Peptide Elongation Factor G, Thiostrepton, 3. Good health, Cell biology, [SDV] Life Sciences [q-bio], Elongation factor, RNA, Ribosomal, 23S, ADP-ribosylation, Protein Biosynthesis, RNA-protein complexes, [SDE]Environmental Sciences, NAD+ kinase, Photorhabdus, Biologie, Biokemi och molekylärbiologi
Abstract: Bacteria have evolved sophisticated mechanisms to deliver potent toxins into bacterial competitors or into eukaryotic cells in order to destroy rivals and gain access to a specific niche or to hijack essential metabolic or signaling pathways in the host. Delivered effectors carry various activities such as nucleases, phospholipases, peptidoglycan hydrolases, enzymes that deplete the pools of NADH or ATP, compromise the cell division machinery, or the host cell cytoskeleton. Effectors categorized in the family of polymorphic toxins have a modular structure, in which the toxin domain is fused to additional elements acting as cargo to adapt the effector to a specific secretion machinery. Here we show that Photorhabdus laumondii, an entomopathogen species, delivers a polymorphic antibacterial toxin via a type VI secretion system. This toxin inhibits protein synthesis in a NAD+-dependent manner. Using a biotinylated derivative of NAD, we demonstrate that translation is inhibited through ADP-ribosylation of the ribosomal 23S RNA. Mapping of the modification further showed that the adduct locates on helix 44 of the thiostrepton loop located in the GTPase-associated center and decreases the GTPase activity of the EF-G elongation factor., SCOPUS: ar.j, info:eu-repo/semantics/published
Published: 2021
Full Text: View/download PDF

14. Four Amino Acids of an Insect Densovirus Capsid Determine Midgut Tropism and Virulence

Author: Morena Casartelli, Cecilia Multeau, Ilaria Castelli, Mylène Ogliastro, Aurélie Perrin, Rémy Froissart, Diversité, Génomes et Interactions Microorganismes-Insectes, Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2), InVivo AgroSolut, Université Montpellier 2 - Sciences et Techniques (UM2), Maladies infectieuses et vecteurs : écologie, génétique, évolution et contrôle (MIVEGEC), Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD [France-Sud]), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), Università degli Studi di Milano [Milano] (UNIMI), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de la Recherche Agronomique (INRA), French Association Nationale Recherche Technologie, In vivo AgroSolutions from the Union In vivo group, and French Institut National de la Recherche Agronomique
Subjects: Models, Molecular, [SDV]Life Sciences [q-bio], viruses, Immunology, Amino Acid Motifs, Molecular Sequence Data, Virulence, Biology, Spodoptera, Virus Replication, JUNONIA-COENIA DENSOVIRUS, Microbiology, PATHWAY, 03 medical and health sciences, Virology, INFECTION, Animals, Densovirus, Amino Acid Sequence, Tropism, 030304 developmental biology, chemistry.chemical_classification, 0303 health sciences, 030302 biochemistry & molecular biology, fungi, Midgut, 3. Good health, Amino acid, Virus-Cell Interactions, GENOME, Intestines, Viral Tropism, chemistry, Viral replication, Capsid, Insect Science, Tissue tropism, VIRUS, Capsid Proteins, HOST-RANGE
Abstract: Densoviruses are insect parvoviruses that are orally infectious for Lepidoptera . To assess the mechanisms underlying their specificity and their virulence, we investigated the role of eight candidate residues in the densovirus capsid. We showed that the substitutions of four amino acids were associated with decreased virulence due to a decreased ability to cross the host midgut epithelium, without an effect on viral replication in other tissues.
Published: 2012
Full Text: View/download PDF

15. Cecropins as a marker of Spodoptera frugiperda immunosuppression during entomopathogenic bacterial challenge

Author: Jean-Michel Escoubas, Alain Givaudan, Z. Abi Khattar, Sylvie Pages, Bernard Duvic, N.-A. Volkoff, Véronique Jouan, Delphine Destoumieux-Garzón, N. Essa, Pierre-Alain Girard, Diversité, Génomes et Interactions Microorganismes-Insectes, Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), Université Montpellier 2 - Sciences et Techniques (UM2), Ecologie des systèmes marins côtiers (Ecosym), Université Montpellier 1 (UM1)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut Français de Recherche pour l'Exploitation de la Mer (IFREMER)-Centre National de la Recherche Scientifique (CNRS), Université Montpellier 1 (UM1), French Institut National de la Recherche Agronomique, and Centre National de la Recherche Scientifique
Subjects: 0106 biological sciences, Physiology, [SDV]Life Sciences [q-bio], Xenorhabdus, medicine.disease_cause, 01 natural sciences, Hemolymph, INFECTION, Invertebrate, Phylogeny, Xenorhabdus mauleonii, Innate immunity, 0303 health sciences, biology, Cecropins, MANDUCA-SEXTA, Antimicrobial, FAMILY, DROSOPHILA, SILKWORM BOMBYX-MORI, ANTIBACTERIAL PEPTIDES, Lepidopteran, EXPRESSION, Molecular Sequence Data, Microbial Sensitivity Tests, Spodoptera, Microbiology, 03 medical and health sciences, medicine, Animals, Amino Acid Sequence, 030304 developmental biology, Molecular mass, Base Sequence, XENORHABDUS-NEMATOPHILA, fungi, Sequence Analysis, DNA, biology.organism_classification, ANTIMICROBIAL PEPTIDES, 010602 entomology, Humoral immunity, Cecropin, Insect Science, Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization, INSECT IMMUNITY, Sequence Alignment, Bacteria, Immunosuppression
Abstract: International audience; An antimicrobial peptide (AMP) of the cecropin family was isolated by HPLC from plasma of the insect pest, Spodoptera frugiperda. Its molecular mass is 3910.9 Da as determined by mass spectrometry. Thanks to the EST database Spodobase, we were able to describe 13 cDNAs encoding six different cecropins which belong to the sub-families CecA, CecB, CecC and CecD. The purified peptide identified as CecB1 was chemically synthesized (syCecB1). It was shown to be active against Gram-positive and Gram-negative bacteria as well as fungi. Two closely related entomopathogenic bacteria, Xenorhabdus nematophila F1 and Xenorhabdus mauleonii VC01(T) showed different susceptibility to syCecB1. Indeed, X. nematophila was sensitive to syCecB1 whereas X. mauleonii had a minimal inhibitory concentration (MIC) eight times higher. Interestingly, injection of live X. nematophila into insects did not induce the expression of AMPs in hemolymph. This effect was not observed when this bacterium was heat-killed before injection. On the opposite, both live and heat-killed X. mauleonii induced the expression of AMPs in the hemolymph of S. frugiperda. The same phenomenon was observed for another immune-related protein lacking antimicrobial activity. Altogether, our data suggest that Xenorhabdus strains have developed different strategies to supplant the humoral defense mechanisms of S. frugiperda, either by increasing their resistance to AMPs or by preventing their expression during such host-pathogen interaction. (C) 2012 Elsevier Ltd. All rights reserved.
Published: 2011
Full Text: View/download PDF

16. Biocontrôle et macro-organismes: enjeux et réalité

Author: Ris, N., Borowiec, Nicolas, Bout, Alexandre, Debelle, Allan, Fellous, Simon, Le Ralec, Anne, Moquet, Laura, Ogier, Jean-Claude, Rode, Nicolas Olivier, van Oudenhove, Louise, Fauvergue, Xavier, Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (1965 - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Rennes Angers, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Peuplements végétaux et bioagresseurs en milieu tropical (UMR PVBMT), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de La Réunion (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Département Systèmes Biologiques (Cirad-BIOS), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), and Astruc, Suzette
Subjects: [SDE] Environmental Sciences, Invertébrés, Auxiliaires, Réglementation, [SDE]Environmental Sciences, Prédateurs, Génétique, Lutte biologique, Parasitoïdes, Zootechnie
Abstract: International audience; Contexte: Il existe une diversité de stratégies de biocontrôle faisant appel aux macro-organismes, qu'elles soient pratiquées depuis longtemps en France, plus récemment implantées, voire encore prospectives. enjeux: Il est possible de définir un cadre de réflexion commun à l'ensemble de ces stratégies autour d'enjeux de recherche et développement : réglementation, zootechnie, amélioration génétique, efficacité au champ et risques éventuels. Quatre dynamiques sont susceptibles d'apporter un nouvel élan au biocontrôle à l'aide de macroorganismes : – la convergence entre santé des plantes et santé humaine autour de stratégies communes ; – la convergence entre biocontrôle et production d'insectes comestibles autour d'enjeux communs ; – la complémentarité entre les stratégies interventionnistes utilisant les macro-organismes et la lutte biologique par conservation ; – la nécessaire réflexion concernant de nouvelles organisations économiques et sociales.
Published: 2022

17. Structural variation turnovers and defective genomes: key drivers for the in vitro evolution of the large double-stranded DNA koi herpesvirus (KHV)

Author: Nurul Novelia Fuandila, Anne-Sophie Gosselin-Grenet, Marie-Ka Tilak, Sven M Bergmann, Jean-Michel Escoubas, Sandro Klafack, Angela Mariana Lusiastuti, Munti Yuhana, Anna-Sophie Fiston-Lavier, Jean-Christophe Avarre, Emira Cherif, Institut des Sciences de l'Evolution de Montpellier (UMR ISEM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-École Pratique des Hautes Études (EPHE), Université Paris sciences et lettres (PSL)-Université Paris sciences et lettres (PSL)-Institut de recherche pour le développement [IRD] : UR226-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Université de Lausanne = University of Lausanne (UNIL), Swiss Institute of Bioinformatics [Lausanne] (SIB), Interactions Hôtes-Pathogènes-Environnements (IHPE), Université de Perpignan Via Domitia (UPVD)-Institut Français de Recherche pour l'Exploitation de la Mer (IFREMER)-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM), Friedrich-Loeffer-Institute, Research Institute for Freshwater Aquaculture and Fisheries Extension, Bogor Agricultural University - IPB (INDONESIA), Université Paris sciences et lettres (PSL)-Université Paris sciences et lettres (PSL)-Université de Montpellier (UM)-Institut de recherche pour le développement [IRD] : UR226-Centre National de la Recherche Scientifique (CNRS), Institut Universitaire de France (IUF), Ministère de l'Education nationale, de l’Enseignement supérieur et de la Recherche (M.E.N.E.S.R.), and Société Française de BioInformatique (SFBI)
Subjects: [SDV.BID.EVO]Life Sciences [q-bio]/Biodiversity/Populations and Evolution [q-bio.PE]
Abstract: Structural variations (SVs) constitute a significant source of genetic variability in virusgenomes. Yet knowledge about SV variability and contribution to the evolutionaryprocess in large double-stranded (ds)DNA viruses is limited. Cyprinid herpesvirus 3(CyHV-3), also commonly known as koi herpesvirus (KHV), has the largest dsDNA genomewithin herpesviruses. This virus has become one of the biggest threats to common carpand koi farming, resulting in high morbidity and mortalities of fishes, seriousenvironmental damage, and severe economic losses. A previous study analyzing CyHV-3virulence evolution during serial passages onto carp cell cultures suggested that CyHV-3evolves, at least in vitro, through an assembly of haplotypes that alternatively becomedominant or under-represented. The present study investigates the SV diversity anddynamics in CyHV-3 genome during 99 serial passages in cell culture using, for the firsttime, ultra-deep whole-genome and amplicon-based sequencing. The results indicatethat KHV polymorphism mostly involves SVs. These SVs display a wide distribution alongthe genome and exhibit high turnover dynamics with a clear bias towards inversion anddeletion events. Analysis of the pathogenesis-associated ORF150 region in tenintermediate cell passages highlighted mainly deletion, inversion and insertion variationsthat deeply altered the structure of ORF150. Our findings indicate that SV turnovers anddefective genomes represent key drivers in the viral population dynamics and in vitroevolution of KHV. Thus, the present study can contribute to the basic research needed todesign safe live-attenuated vaccines, classically obtained by viral attenuation after serial passages in cell culture.&nbsp
Published: 2022
Full Text: View/download PDF

18. <scp>AcrAB</scp> , the major <scp>RND</scp> ‐type efflux pump of Photorhabdus laumondii , confers intrinsic multidrug‐resistance and contributes to virulence in insects

Author: Paloma Kiwan, Fida Nassar, Alain Givaudan, Anne Lanois, Linda Hadchity, Ziad Abi Khattar, Laboratoryof Georesources, GeosciencesandEnvironment, Microbiologyteam, Faculty of Science 2, Lebanese University [Beirut] (LU), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Lebanese University, National Council for Scientific Research - Lebanon, and University of Montpellier
Subjects: Insecta, Mutant, Virulence, Biology, Microbiology, 03 medical and health sciences, chemistry.chemical_compound, Bacterial Proteins, Animals, Ecology, Evolution, Behavior and Systematics, 030304 developmental biology, 0303 health sciences, 030306 microbiology, biochemical phenomena, metabolism, and nutrition, biology.organism_classification, [SDV.MP.BAC]Life Sciences [q-bio]/Microbiology and Parasitology/Bacteriology, Agricultural and Biological Sciences (miscellaneous), Phenotype, Anti-Bacterial Agents, [SDV.BA.ZI]Life Sciences [q-bio]/Animal biology/Invertebrate Zoology, Multiple drug resistance, chemistry, Efflux, Photorhabdus, Nutrient agar, Bacteria
Abstract: International audience; The resistance-nodulation-division (RND)-type efflux pumps AcrAB and MdtABC contribute to multidrug-resistance (MDR) in Gram-negative bacteria. Photorhabdus is a symbiotic bacterium of soil nematodes that also produces virulence factors killing insects by septicaemia. We previously showed that mdtA deletion in Photorhabdus laumondii TT01 resulted in no detrimental phenotypes. Here, we investigated the roles of the last two putative RND transporters in TT01 genome, AcrAB and AcrAB-like (Plu0759-Plu0758). Only ΔacrA and ΔmdtAΔacrA mutants were multidrug sensitive, even to triphenyltetrazolium chloride and bromothymol blue used for Photorhabdus isolation from nematodes on the nutrient bromothymol blue-triphenyltetrazolium chloride agar (NBTA) medium. Both mutants also displayed slightly attenuated virulence after injection into Spodoptera littoralis. Transcriptional analysis revealed intermediate levels of acrAB expression in vitro, in vivo and post-mortem, whereas its putative transcriptional repressor acrR was weakly expressed. Yet, plasmid-mediated acrR overexpression did not decrease acrAB transcript levels neither MDR in TT01 WT. While no pertinent mutations were detected in acrR of the same P. laumondii strain grown either on NBTA or nutrient agar, we suggest that AcrR-mediated repression of acrAB is not physiologically required under conditions tested. Finally, we propose that AcrAB is the primary RND-efflux pump, which is essential for MDR in Photorhabdus and may confer adaptive advantages during insect infection.
Published: 2021
Full Text: View/download PDF

19. Influence of parasitoid-associated viral symbionts on plant–insect interactions and biological control

Author: Antonino Cusumano, Anne-Nathalie Volkoff, Università degli studi di Palermo - University of Palermo, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Cusumano A., and Volkoff A.-N.
Subjects: 0106 biological sciences, 0301 basic medicine, Insecta, [SDV]Life Sciences [q-bio], media_common.quotation_subject, Wasps, Biological pest control, Insect, Parasitoids, plant-insect-microbe, Biology, 010603 evolutionary biology, 01 natural sciences, Host-Parasite Interactions, Parasitoid, 03 medical and health sciences, Animals, Herbivory, Feeding patterns, Pest Control, Biological, Symbiosis, Ecology, Evolution, Behavior and Systematics, media_common, Trophic level, 2. Zero hunger, Herbivore, Host (biology), fungi, food and beverages, Plants, biology.organism_classification, Phenotype, 030104 developmental biology, Polydnaviridae, Evolutionary biology, Insect Science
Abstract: International audience; Insect parasitoids have evolved symbiotic interactions with several viruses and thousands of parasitoid species have established mutualistic associations with polydnaviruses (PDVs). While PDVs have often been described as virulence factors allowing development of immature parasitoids inside their herbivore hosts, there is increasing awareness that PDVs can affect plant-insect interactions. We review recent literature showing that PDVs alter not only host physiology, but also feeding patterns and composition of herbivore's oral secretions. In turn PDV-induced changes in herbivore phenotype affect plant responses to herbivory with consequences ranging from differential expression of plant defense-related genes to wider ecological effects across multiple trophic levels. In this opinion paper we also highlight important missing gaps to fully understand the role of PDVs and other parasitoid-associated viral symbionts in a plant-insect interaction perspective. Because PDVs negatively impact performance and survival of herbivore pests, we conclude arguing that PDV genomes offer potential opportunities for biological control.
Published: 2021
Full Text: View/download PDF

20. Sequence, assembly and count datasets of viruses associated to the pine processionary moth Thaumetopoea pityocampa (Denis & Schiffermüller) (Lepidoptera, Notodontidae) identified from transcriptomic high-throughput sequencing

Author: Franck Dorkeld, Réjane Streiff, Laure Sauné, Guillaume Castel, Mylène Ogliastro, Carole Kerdelhué, Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), This research was funded by the French National Agency for Research (ANR, project GenoPheno, grant ANR-10-JCJC-1705) and by a support by INRAE, EFPA (ECODIV) department (projet innovant 2019 EVIL)., and ANR-10-JCJC-1705,GenoPheno,Génomique de la phénologie chez la processionnaire du pin, Thaumetopoea pityocampa(2010)
Subjects: Pine processionary moth, High-throughput sequencing, [SDV.MP]Life Sciences [q-bio]/Microbiology and Parasitology, [SDV.GEN.GPO]Life Sciences [q-bio]/Genetics/Populations and Evolution [q-bio.PE], Multidisciplinary, In silico virus identification, De novo assembly, Transcriptome, Phylogeny
Abstract: International audience; The pine processionary moth Thaumetopoea pityocampa is a Lepidopteran pest species occurring in the Western Mediterranean. It causes heavy pine defoliations and it is a public and animal health concern because of its urticating caterpillars. Very little is known about the viruses associated to this species, as only two viruses were described so far. We here present a dataset corresponding to 34 viral transcripts, among which 27 could be confidently assigned to 9 RNA and DNA viral families (Iflaviridae, Reoviridae, Partitiviridae, Permutotetraviridae, Flaviviridae, Rhabdoviridae, Parvoviridae, Baculoviridae and PolyDNAviridae). These transcripts were identified from an original transcriptome assembled for the insect host, using both blast search and phylogenetic approaches. The data were acquired from 2 populations in Portugal and 2 populations in Italy. The transcripts were de novo assembled and used to identify viral sequences by homology searches. We also provide information about the populations and life stages in which each virus was identified. The data produced will allow to enrich the virus taxonomy in Lepidopteran hosts, and to develop PCR-based diagnostic tools to screen colonies across the range and determine the distribution and prevalence of the identified viral species.
Published: 2023
Full Text: View/download PDF

21. Genetic structure and insecticide resistance characteristics of fall armyworm populations invading China

Author: Yu-Ying Jiang, Weipeng Quan, Kenneth Wilson, Chao Wu, Wanqiang Qian, Bo Liu, Swapan Chakrabarty, Gilson Chipabika, Sheng-yuan Zhao, W. Zheng, Dandan Zhang, Wei Fan, Guirong Wang, Bei Liu, Jie Liu, Xinyue Liang, Amy Withers, Christopher M. Jones, Minghui Jin, Judith A. Smith, Yutao Xiao, Xiaolin Liu, Emmanuelle d'Alençon, Kiwoong Nam, Zaiyuan Li, Xianming Yang, Donald L. Kachigamba, Lei Zhang, Pengjun Xu, Conghui Liu, Kongming Wu, Chinese Academy of Agricultural Sciences (CAAS), Chinese Academy of Sciences [Beijing] (CAS), Lancaster University, Malawi Liverpool Wellcome Trust Clinical Research Programme (MLW), Liverpool School of Tropical Medicine (LSTM)-University of Liverpool-Wellcome Trust-University of Malawi, University of Central Lancashire [Preston] (UCLAN), Zambia Agriculture Research Institute, Partenaires INRAE, Bvumbwe Research Station, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Natl Agrotech Extens & Serv Ctr, Novogene Bioinformatics Institute, and Grandomics Biosciences
Subjects: 0106 biological sciences, 0301 basic medicine, resistance risk, China, Nuclear gene, Population, Genome, Insect, Spodoptera, 010603 evolutionary biology, 01 natural sciences, Genome, Zea mays, Insecticide Resistance, qx_560, 03 medical and health sciences, Hemolysin Proteins, South Africa, Bacterial Proteins, Bacillus thuringiensis, qx_600, Genetics, Animals, [SDV.BBM]Life Sciences [q-bio]/Biochemistry, Molecular Biology, Resource Article, education, Permanent Genetic Resources, subpopulations, Ecology, Evolution, Behavior and Systematics, education.field_of_study, qx_4, Genetically modified maize, biology, F410, Strain (biology), RESOURCE ARTICLES, population structure, Spodoptera frugiperda, biology.organism_classification, Plants, Genetically Modified, Endotoxins, 030104 developmental biology, Genetic structure, Fall armyworm, qu_450, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, gene insertion, Biotechnology
Abstract: The rapid wide-scale spread of fall armyworm (Spodoptera frugiperda) has caused serious crop losses34 globally. However, differences in the genetic background of subpopulations and the mechanisms of rapid adaptation behind the invasion are still not well understood. Here we report the assembly of a 390.38-M chromosome-level genome of fall armyworm using Pacific Bioscience (PacBio) and Hi-C sequencing technologies with scaffold N50 of 12.7 M consisting of 22260 annotated protein-coding genes. Genome-wide resequencing of 103 samples from 16 provinces in China revealed that the fall armyworm population comprises a complex inter-strain hybrid, mainly with the corn-strain genetic background and less of the rice-strain, which highlights the inaccuracy of strain identification using mitochondrial or Triosephosphate isomerase (Tpi) genes. Analysis of genes related to pesticide- and Bt-resistance showed that the risk of fall armyworm developing resistance to conventional pesticides is very high. Laboratory bioassay results showed that insects invading China carry resistance to organophosphate and pyrethroid pesticides, but are sensitive to genetically modified maize expressing Bacillus thuringiensis (Bt) toxins Cry1Ab in field experiments. Additionally, two mitochondrial fragments are inserted into the nuclear genome, and the insertion event occurred after the differentiation of the two strains. This study represents a valuable advance toward improving management strategies for fall armyworm.
Published: 2020
Full Text: View/download PDF

22. Transcriptional differences between the two host strains of Spodoptera frugiperda (Lepidoptera: Noctuidae)

Author: Marion Orsucci, Yves Moné, Philippe Audiot, Sylvie Gimenez, Sandra Nhim, Rima Naït-Saïdi, Marie Frayssinet, Guillaume Dumont, Jean-Paul Boudon, Marin Vabre, Stéphanie Rialle, Rachid Koual, Gael J. Kergoat, Rodney N. Nagoshi, Robert L. Meagher, Emmanuelle d’Alençon, Nicolas Nègre, Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Plant Biology, Linnean Centre for Plant Biology, Uppsala BioCentre, Swedish University of Agricultural Sciences (SLU), Drexel University College of Medicine, DIASCOPE, Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut de Génomique Fonctionnelle - Montpellier GenomiX (IGF MGX), Institut de Génomique Fonctionnelle (IGF), Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-BioCampus (BCM), Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS), USDA/ARS, and USDA-ARS : Agricultural Research Service
Subjects: [SDV]Life Sciences [q-bio]
Abstract: International audience; Spodoptera frugiperda, the fall armyworm (FAW), is an important agricultural pest in the Americas and an emerging pest in sub-Saharan Africa, India, East-Asia and Australia, causing damage to major crops such as corn, sorghum and soybean. While FAW larvae are considered polyphagous, differences in diet preference have been described between two genetic variants: the corn strain (sf-C) and the rice strain (sf-R). These two strains are sometimes considered as distinct species, raising the hypothesis that host plant specialization might have driven their divergence. To test this hypothesis, we first performed controlled reciprocal transplant (RT) experiments to address the impact of plant diet on several traits linked to the fitness of the sf-C and sf-R strains. The phenotypical data suggest that sf-C is specialized to corn. We then used RNA-Se to identify constitutive transcriptional differences between strains, regardless of diet, in laboratory as well as in natural populations. We found that variations in mitochondrial transcription levels are among the most substantial and consistent differences between the two strains. Since mitochondrial genotypes also vary between the strains, we believe the mitochondria may have a significant role in driving strain divergence.
Published: 2022
Full Text: View/download PDF

23. Biocontrôle et macro-organismes: panorama

Author: Ris, N., Borowiec, Nicolas, Bout, Alexandre, Debelle, Allan, Fellous, Simon, Le Ralec, Anne, Moquet, Laura, Ogier, Jean-Claude, Rode, Nicolas Olivier, van Oudenhove, Louise, Fauvergue, Xavier, Astruc, Suzette, Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (1965 - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Montpellier, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Université de Montpellier (UM), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro Rennes Angers, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Peuplements végétaux et bioagresseurs en milieu tropical (UMR PVBMT), and Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de La Réunion (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)
Subjects: [SDE] Environmental Sciences, Invertébrés, Auxiliaires, [SDE]Environmental Sciences, Prédateurs, Lutte biologique, Parasitoïdes
Abstract: International audience; Contexte : Malgré des besoins toujours plus pressants de trouver des alternatives aux produits phytopharmaceutiques, force est de constater que le secteur des macro-organismes de biocontrôle peine à se généraliser dans la pratique et, avant tout, à s'imposer dans l'esprit des parties intéressées : les utilisateurs finaux (les agriculteurs), les conseillers techniques, mais également les politiques et les financeurs. Stratégies de lutte : La régulation des bioagresseurs peut se réaliser en favorisant les individus déjà présents dans ou aux alentours des parcelles cultivées : c'est ce que l'on appelle la lutte biologique par conservation. Elle peut également se faire en introduisant certains auxiliaires délibérément dans les parcelles cultivées (acclimatation, augmentation, lutte autocide). Cet article présente les stratégies de biocontrôle à l'aide de macro-organismes (essentiellement des insectes, acariens ou nématodes entomopathogènes), qu'elles soient pratiquées depuis longtemps en France, plus récemment implantées, voire encore prospectives.
Published: 2022

24. Progeny fitness determines the performance of the parasitoid Therophilus javanus, a prospective biocontrol agent against the legume pod borer

Author: Barry R. Pittendrigh, Ramasamy Srinivasan, Manuele Tamò, Aimé H. Bokonon-Ganta, Djibril Aboubakar Souna, Mesmin Alizannon, Anne-Nathalie Volkoff, Marc Ravallec, International Institute of Tropical Agriculture [Nigeria] (IITA), Consultative Group on International Agricultural Research [CGIAR] (CGIAR), Université d’Abomey-Calavi (UAC), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), World Vegetable Center, Michigan State University [East Lansing], Michigan State University System, International Institute of Tropical Agriculture (IITA-Benin), Consultative Group on International Agricultural Research [CGIAR] (CGIAR)-Consultative Group on International Agricultural Research [CGIAR] (CGIAR), Cooperation and Cultural Action Service (SCAC) of the French Embassy in Cotonou N 898392E, CGIAR, and Bill & Melinda Gates Foundation OPP1082463
Subjects: Male, 0106 biological sciences, Behavioural ecology, Ecophysiology, Science, [SDV]Life Sciences [q-bio], Wasps, Biological pest control, Moths, 010603 evolutionary biology, 01 natural sciences, Article, Parasitoid, Toxicology, Animals, Population dynamics, Pest Control, Biological, Larva, Multidisciplinary, biology, Host (biology), Reproduction, fungi, biology.organism_classification, 010602 entomology, Maruca vitrata, Medicine, Instar, Female, Agroecology, Sex ratio
Abstract: Therophilus javanus (Bhat & Gupta) is an exotic larval endoparasitoid newly imported from Asia into Africa as a classical biological control agent against the pod borer Maruca vitrata (Fabricius). The parasitoid preference for the five larval instars of M. vitrata and their influence on progeny sex ratio were assessed together with the impact of larval host age at the time of oviposition on development time, mother longevity and offspring production. In a choice situation, female parasitoids preferred to oviposit in the first three larval instars. The development of immature stages of the parasitoid was observed inside three-day-old hosts, whereby the first two larval instars of T. javanus completed their development as endoparasites and the third larval instar as ectoparasite. The development time was faster when first larval instars (two- and three-day-old) of the host caterpillars were parasitized compared to second larval instar (four-day-old). The highest proportion of daughters (0.51) was observed when females were provided with four-day-old hosts. The lowest intrinsic rate of increase (r) (0.21 ± 0.01), the lowest rate of increase (λ) (1.23 ± 0.01), and the lowest net reproductive rate (Ro) (35.93 ± 6.51) were recorded on four-day-old hosts. These results are discussed in the light of optimizing mass rearing and release strategies.
Published: 2021
Full Text: View/download PDF

25. Paternal transmission of the Wolbachia CidB toxin underlies cytoplasmic incompatibility

Author: Béatrice Horard, Kevin Terretaz, Anne-Sophie Gosselin-Grenet, Hélène Sobry, Mathieu Sicard, Frédéric Landmann, Benjamin Loppin, Laboratoire de biologie et modélisation de la cellule (LBMC UMR 5239), École normale supérieure de Lyon (ENS de Lyon)-Université Claude Bernard Lyon 1 (UCBL), Université de Lyon-Université de Lyon-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS), Centre de recherche en Biologie cellulaire de Montpellier (CRBM), Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Institut des Sciences de l'Evolution de Montpellier (UMR ISEM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-École Pratique des Hautes Études (EPHE), Université Paris sciences et lettres (PSL)-Université Paris sciences et lettres (PSL)-Institut de recherche pour le développement [IRD] : UR226-Centre National de la Recherche Scientifique (CNRS)-Université de Montpellier (UM), MUSE program of the University of MontpellierAAP17REC-FRS04-GENEWOL, SchlumbergerFSER202002011118, ANR-16-CE02-0006,CIAWOL,Bases moléculaire et cellulaire de la diversité phénotypique de l'incompatibilté cytoplasmique chez les insectes(2016), ANR-10-INBS-0004,France-BioImaging,Développment d'une infrastructure française distribuée coordonnée(2010), École normale supérieure - Lyon (ENS Lyon)-Université Claude Bernard Lyon 1 (UCBL), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-École pratique des hautes études (EPHE), KARLI, Mélanie, Bases moléculaire et cellulaire de la diversité phénotypique de l'incompatibilté cytoplasmique chez les insectes - - CIAWOL2016 - ANR-16-CE02-0006 - AAPG2016 - VALID, and Développment d'une infrastructure française distribuée coordonnée - - France-BioImaging2010 - ANR-10-INBS-0004 - INBS - VALID
Subjects: toxin-antidote, Male, Cytoplasm, cytoplasmic incompatibility, [SDV]Life Sciences [q-bio], General Biochemistry, Genetics and Molecular Biology, DNA replication stress, spermiogenesis, [SDV] Life Sciences [q-bio], Culex, Cytosol, fertilization, Animals, Drosophila, General Agricultural and Biological Sciences, CidA, Wolbachia, CidB
Abstract: International audience; Wolbachia are widespread endosymbiotic bacteria that manipulate the reproduction of arthropods through a diversity of cellular mechanisms. In cytoplasmic incompatibility (CI), a sterility syndrome originally discovered in the mosquito Culex pipiens, uninfected eggs fertilized by sperm from infected males are selectively killed during embryo development following the abortive segregation of paternal chromosomes in the zygote. Despite the recent discovery of Wolbachia CI factor (cif) genes, the mechanism by which they control the fate of paternal chromosomes at fertilization remains unknown. Here, we have analyzed the cytological distribution and cellular impact of CidA and CidB, a pair of Cif proteins from the Culex-infecting Wolbachia strain wPip. We show that expression of CidB in Drosophila S2R+ cells induces apoptosis unless CidA is co-expressed and associated with its partner. In transgenic Drosophila testes, both effectors colocalize in germ cells until the histone-to-protamine transition in which only CidB is retained in maturing spermatid nuclei. We further show that CidB is similarly targeted to maturing sperm of naturally infected Culex mosquitoes. At fertilization, CidB associates with paternal DNA regions exhibiting DNA replication stress, as a likely cause of incomplete replication of paternal chromosomes at the onset of the first mitosis. Importantly, we demonstrate that inactivation of the deubiquitylase activity of CidB does not abolish its cell toxicity or its ability to induce CI in Drosophila. Our study thus demonstrates that CI functions as a transgenerational toxin-antidote system and suggests that CidB acts by poisoning paternal DNA replication in incompatible crosses.
Published: 2021
Full Text: View/download PDF

26. Integrated miRNA and transcriptome profiling to explore the molecular determinism of convergent adaptation to corn in two lepidopteran pests of agriculture

Author: Gimenez, Sylvie, Seninet, Imene, Orsucci, Marion, Audiot, Philippe, Negre, Nicolas, Nam, Kiwoong, Streiff, Rejane, d'Alencon, Emmanuelle, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Swedish University of Agricultural Sciences (SLU), Plant Biology, Linnean Centre for Plant Biology, Uppsala BioCentre, This work was supported by a grant from the French National Research Agency (Projet ANR-13-BSV7-0012 for R.S. and ANR-12-BSV7-0004 for E. A., ANR-13-BSV7-0012,Adapt-Ome,Contributions du genome, du transcriptome et de l'épigénome à l'adaptation de lépidoptères (Ostrinia spp.) à leurs plantes hôtes(2013), ANR-12-BSV7-0004,ADA-SPODO,Déterminisme moléculaire de l'adaptation écologique et de la spéciation chez deux variants du lépidoptère Spodoptera frugiperda(2012), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, and Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)
Subjects: Evolutionary Biology, Research, Gene Expression Profiling, [SDV]Life Sciences [q-bio], fungi, food and beverages, Agriculture, Phenotypic plasticity, Moths, QH426-470, Zea mays, Insect plant interaction, microRNAs, Genetic convergence, Genetics, Animals, Regulation of gene expression, Adaptation, Transcriptome, TP248.13-248.65, Biotechnology
Abstract: Dataset for S. frugiperda RNAseq [1] is available in Array Express: E-MTAB-6540.Dataset for Ostrinia miRNAs is available in Array Express: E-MTAB-10014.For reviewer access from 2021 to 01-14 at about 6 am UK time, please use the following login details. Username: Reviewer_E-MTAB-10014. Password: 66VvhpXh.; International audience; Background: The degree to which adaptation to same environment is determined by similar molecular mechanisms, is a topic of broad interest in evolutionary biology, as an indicator of evolutionary predictability. We wished to address if adaptation to the same host plant in phytophagous insects involved related gene expression patterns. We compared sRNA-Seq and RNA-Seq data between two pairs of taxa of Ostrinia and Spodoptera frugiperda sharing maize as host-plant. For the latter, we had previously carried out a reciprocal transplant experiment by feeding of the larvae of the Corn strain (Sf-C) and the Rice strain (Sf-R) on corn versus rice and characterized the mRNA and miRNA responses. Results: First, we predicted the genes encoding miRNA in Ostrinia nubilalis (On) and O. scapulalis (Os). Respectively 67 and 65 known miRNA genes, as well as 196 and 190 novel ones were predicted with Os genome using sncRNAs extracted from whole larvae feeding on corn or mugwort. In On, a read counts analysis showed that 37 (55.22%) known miRNAs and 19 (9.84%) novel miRNAs were differentially expressed (DE) on mugwort compared to corn (in Os, 25 known miRs (38.46%) and 8 novel ones (4.34%)). Between species on corn, 8 (12.5%) known miRNAs and 8 (6.83%) novel ones were DE while only one novel miRNA showed expression variation between species on mugwort. Gene target prediction led to the identification of 2953 unique target genes in On and 2719 in Os, among which 11.6% (344) were DE when comparing species on corn. 1.8% (54) of On miR targets showed expression variation upon a change of host-plant. We found molecular changes matching convergent phenotype, i.e., a set of nine miRNAs that are regulated either according to the host-plant both in On and S f-C or between them on the same plant, corn. Among DE miR target genes between taxa, 13.7% shared exactly the same annotation between the two pairs of taxa and had function related to insect host-plant interaction. Conclusion: There is some similarity in underlying genetic mechanisms of convergent evolution of two distant Lepidopteran species having adopted corn in their host range, highlighting possible adaptation genes.
Published: 2021
Full Text: View/download PDF

27. Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana

Author: Azza M. Elgendy, Amr A. Mohamed, Bernard Duvic, Muhammad Tufail, Makio Takeda, Department of Entomology, Faculty of Science, Cairo University, Giza, Egypt, Department of Agrobioscience, Graduate School of Agricultural Science, Kobe University, Hyogo, Japan, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), and Ghazi University, Dera Ghazi Khan, Punjab, Pakistan
Subjects: Physiology, [SDV]Life Sciences [q-bio], Response element, 03 medical and health sciences, Vitellogenin, 0302 clinical medicine, hemimetabola, Physiology (medical), periplaneta, QP1-981, transcriptional regulation, Nuclear protein, 030304 developmental biology, Original Research, 0303 health sciences, biology, Chemistry, juvenile hormone, Binding protein, Promoter, Molecular biology, [SDV.BA.ZI]Life Sciences [q-bio]/Animal biology/Invertebrate Zoology, cis-regulatory elements, Juvenile hormone, biology.protein, Vitellogenesis, 20-hydroxyecdysone, vitellogenesis, Vitellogenins, 030217 neurology & neurosurgery
Abstract: Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.
Published: 2021
Full Text: View/download PDF

28. Des analyses protéotrancriptomiques révèlent une grande expansion des protéines de type métalloprotéase dans les vésicules atypiques de venin de la guêpe parasitoide Meteorus pulchricornis (Braconidae)

Author: Gatti, Jean-Luc, Belghazi, Maya, Legeai, Fabrice, Ravallec, Marc, Frayssinet, Marie, Robin, Stéphanie, Aboubakar-Souna, Djibril, Srinivasan, Ramasamy, Tamò, Manuele, Poirié, Marylène, Volkoff, Anne-Nathalie, Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (... - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), Institut de neurophysiopathologie (INP), Aix Marseille Université (AMU)-Centre National de la Recherche Scientifique (CNRS), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Scalable, Optimized and Parallel Algorithms for Genomics (GenScale), Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes 1 (UR1), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), World Vegetable Center (WorldVeg), International Institute of Tropical Agriculture (IITA-Benin), International Institute of Tropical Agriculture [Nigeria] (IITA), Consultative Group on International Agricultural Research [CGIAR] (CGIAR)-Consultative Group on International Agricultural Research [CGIAR] (CGIAR), Department of Plant Health (SPE) from the French National Institute for Research in Agriculture, Food and Environment (INRAE) and from the French Government, ANR-12-ADAP-0001,ABC - PaPoGen,Adaptation en lutte biologique - Génomique des populations de parasitoïdes(2012), ANR-11-LABX-0028,SIGNALIFE,Réseau d'Innovation sur les Voies de Signalisation en Sciences de la Vie(2011), ANR-15-IDEX-0001,UCA JEDI,Idex UCA JEDI(2015), Université Nice Sophia Antipolis (1965 - 2019) (UNS), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), and Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique)
Subjects: Meteorus pulchricornis, venomics, DUF-4803 proteins, Braconidae, [SDV]Life Sciences [q-bio], virus-like particles (VLPs), transcriptomic, metalloproteases, parasitoid wasp, complex mixtures, proteomic
Abstract: International audience; Meteorus pulchricornis (Ichneumonoidea, Braconidae) is an endoparasitoid wasp of lepidopteran caterpillars. Its parasitic success relies on vesicles (named M. pulchricornis Virus-Like Particles or MpVLPs) that are synthesized in the venom gland and injected into the parasitoid host along with the venom during oviposition. In order to define the content and understand the biogenesis of these atypical vesicles, we performed a transcriptome analysis of the venom gland and a proteomic analysis of the venom and purified MpVLPs. About half of the MpVLPs and soluble venom proteins identified were unknown and no similarity with any known viral sequence was found. However, MpVLPs contained a large number of proteins labelled as metalloproteinases while the most abundant protein family in the soluble venom was that of proteins containing the Domain of Unknown Function DUF-4803. The high number of these proteins identified suggests that a large expansion of these two protein families occurred in M. pulchricornis. Therefore, although the exact mechanism of MpVLPs formation remains to be elucidated, these vesicles appear to be “metalloproteinase bombs” that may have several physiological roles in the host including modifying the functions of its immune cells. The role of DUF4803 proteins, also present in the venom of other braconids, remains to be clarified.
Published: 2021
Full Text: View/download PDF

29. rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencing

Author: Sylvie Pages, Jean-Claude Ogier, Maxime Galan, Sophie Gaudriault, Matthieu Barret, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut National de la Recherche Agronomique (INRA)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Institut de Recherche en Horticulture et Semences (IRHS), Université d'Angers (UA)-Institut National de la Recherche Agronomique (INRA)-AGROCAMPUS OUEST, Health Plant and Environment Department of INRA, MEM-INRA metaprogram : P10016, AGROCAMPUS OUEST-Institut National de la Recherche Agronomique (INRA)-Université d'Angers (UA), and Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de la Recherche Agronomique (INRA)
Subjects: Nematoda, Biodiversité et Ecologie, lcsh:QR1-502, microbiome, amplification, lcsh:Microbiology, taxonomy, RNA, Ribosomal, 16S, Mock communities, polycyclic compounds, genes, Phylogeny, Genetics, 0303 health sciences, Genes, Essential, Methodology Article, Microbiota, Entomopathogenic nematodes, High-Throughput Nucleotide Sequencing, DNA-Directed RNA Polymerases, respiratory system, Housekeeping gene, DNA, Bacterial, Genetic Markers, rpoB, 16S rRNA gene, metabarcoding, mock communities, entomopathogenic nematodes, taxonomie, Biology, Biodiversity and Ecology, 03 medical and health sciences, Animals, Microbiome, Gene, Illumina dye sequencing, 030304 developmental biology, Bacteria, 030306 microbiology, gène, biochemical phenomena, metabolism, and nutrition, 16S ribosomal RNA, biology.organism_classification, Hypervariable region, Nematode, Metabarcoding, Metagenome, bacteria, Metagenomics, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, human activities
Abstract: BackgroundMicrobiome composition is frequently studied by the amplification and high-throughput sequencing of specific molecular markers (metabarcoding). Various hypervariable regions of the 16S rRNA gene are classically used to estimate bacterial diversity, but other universal bacterial markers with a finer taxonomic resolution could be employed. We compared specificity and sensitivity between a portion of the rpoB gene and the V3V4 hypervariable region of the 16S rRNA gene.ResultsWe first designed universal primers for rpoB suitable for use with Illumina sequencing-based technology and constructed a reference rpoB database of 45,000 sequences. The rpoB and V3V4 markers were amplified and sequenced from (i) a mock community of 19 bacterial strains from both Gram-negative and Gram-positive lineages; (ii) bacterial assemblages associated with entomopathogenic nematodes. In metabarcoding analyses of mock communities with two analytical pipelines (FROGS and DADA2), the estimated diversity captured with the rpoB marker resembled the expected composition of these mock communities more closely than that captured with V3V4. The rpoB marker had a higher level of taxonomic affiliation, a higher sensitivity (detection of all the species present in the mock communities), and a higher specificity (low rates of spurious OTU detection) than V3V4. We applied both primers to infective juveniles of the nematode Steinernema glaseri. Both markers showed the bacterial community associated with this nematode to be of low diversity (< 50 OTUs), but only rpoB reliably detected the symbiotic bacterium Xenorhabdus poinarii.ConclusionsOur results confirm that different microbiota composition data may be obtained with different markers. We found that rpoB was a highly appropriate marker for assessing the taxonomic structure of mock communities and the nematode microbiota. Further studies on other ecosystems should be considered to evaluate the universal usefulness of the rpoB marker. Our data highlight two crucial elements that should be taken into account to ensure more reliable and accurate descriptions of microbial diversity in high-throughput amplicon sequencing analyses: i) the need to include mock communities as controls; ii) the advantages of using a multigenic approach including at least one housekeeping gene (rpoB is a good candidate) and one variable region of the 16S rRNA gene.
Published: 2019
Full Text: View/download PDF

30. Going Viral: Virus-Based Biological Control Agents for Plant Protection

Author: Wagemans, Jeroen, Holtappels, Dominique, Vainio, Eeva, Rabiey, Mojgan, Marzachì, Cristina, Herrero, Salvador, Ravanbakhsh, Mohammadhossein, Tebbe, Christoph C., Ogliastro, Mylène, Ayllón, María A., Turina, Massimo, Sub Ecology and Biodiversity, Ecology and Biodiversity, Sub Ecology and Biodiversity, Ecology and Biodiversity, Catholic University of Leuven - Katholieke Universiteit Leuven (KU Leuven), Natural Resources Institute Finland (LUKE), University of Birmingham [Birmingham], CNR Istituto per la Protezione Sostenibile delle Piante [Torino, Italia] (IPSP), National Research Council of Italy | Consiglio Nazionale delle Ricerche (CNR), Estructura de Recerca Interdisciplinar en Biotecnologia I Biomedicina (ERI-BIOTECMED, Department of Genetics Faculty of Biological Sciences, Universidad de Valencia, Utrecht University [Utrecht], Thünen Institute of Biodiversity, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université de Montpellier (UM), Universidad Politécnica de Madrid (UPM), and European Project: 773567,VIROPLANT
Subjects: Insecta, Bacteria, nanotechnology, Fungi, [SDV.BC.BC]Life Sciences [q-bio]/Cellular Biology/Subcellular Processes [q-bio.SC], virus, Plant Science, Plants, entomovirus, [SDV.BA.ZI]Life Sciences [q-bio]/Animal biology/Invertebrate Zoology, Biological Control Agents, bacteriophage, mycovirus, Viruses, [SDV.MP.VIR]Life Sciences [q-bio]/Microbiology and Parasitology/Virology, Animals, biocontrol, [SDE.BE]Environmental Sciences/Biodiversity and Ecology, Ecosystem, Plant Diseases
Abstract: International audience; The most economically important biotic stresses in crop production are caused by fungi, oomycetes, insects, viruses, and bacteria. Often chemical control is still the most commonly used method to manage them. However, the development of resistance in the different pathogens/pests, the putative damage on the natural ecosystem, and the toxic residues in the field and thus contamination of the environment have stimulated the search for safer alternatives such as the use of biological control agents (BCAs). Among BCAs, viruses, a major driver for controlling host populations and evolution, are somewhat underused, mostly because of regulatory hurdles that make the cost of registration of such host-specific BCAs not affordable in comparison with the limited potential market. Here, we provide a comprehensive overview of the state of the art of virus-based BCAs against fungi, bacteria, viruses, and insects, with a specific focus on new approaches that rely on not only the direct biocidal virus component but also the complex ecological interactions between viruses and their hosts that do not necessarily result in direct damage to the host. Expected final online publication date for the Annual Review of Phytopathology, Volume 60 is August 2022. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
Published: 2022
Full Text: View/download PDF

31. The AcrAB Efflux Pump of Photorhabdus laumondii Confers Multidrug-Resistance and Contributes to Virulence in Insects

Author: Hadchity, Linda, Lanois-NOURI, Anne, Kiwan, Paloma, Nassar, Fida, Givaudan, Alain, Khattar, Ziad Abi, Laboratoryof Georesources, GeosciencesandEnvironment, Microbiologyteam, Faculty of Science 2, Lebanese University [Beirut] (LU), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), and A FEMS AND ASM COLLABORATION
Subjects: drug resistance, insect pathogen, Efflux pumps, [SDV.MP.BAC]Life Sciences [q-bio]/Microbiology and Parasitology/Bacteriology, ComputingMilieux_MISCELLANEOUS
Abstract: International audience
Published: 2021

32. Novel Identification of Bacterial Epigenetic Regulations Would Benefit From a Better Exploitation of Methylomic Data

Author: Amaury, Payelleville, Julien, Brillard, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), GAIA doctoral school 584, INRA Plant Health and Environment (SPE) division SPE-IB17-DiscriMet, ANR-17-CE20-0005,EPI-PATH,Rôle des modifications épigénétiques chez un pathogène de plante au cours de l'adaptation à l'hôte et des changements d'hôte(2017), and European Project: 801505
Subjects: Microbiologie et protistologie [entomologie,phytoparasitolog.], Microbiologie et protistologie [parasitologie hum. et anim.], bacterial epigenetics, DNA methylation, Mini Review, [SDV]Life Sciences [q-bio], methylome, Microbiologie et protistologie [bacteriol.virolog.mycolog.], Microbiology, transcriptome, phenotypic heterogeneity
Abstract: DNA methylation can be part of epigenetic mechanisms, leading to cellular subpopulations with heterogeneous phenotypes. While prokaryotic phenotypic heterogeneity is of critical importance for a successful infection by several major pathogens, the exact mechanisms involved in this phenomenon remain unknown in many cases. Powerful sequencing tools have been developed to allow the detection of the DNA methylated bases at the genome level, and they have recently been extensively applied on numerous bacterial species. Some of these tools are increasingly used for metagenomics analysis but only a limited amount of the available methylomic data is currently being exploited. Because newly developed tools now allow the detection of subpopulations differing in their genome methylation patterns, it is time to emphasize future strategies based on a more extensive use of methylomic data. This will ultimately help to discover new epigenetic gene regulations involved in bacterial phenotypic heterogeneity, including during host-pathogen interactions., SCOPUS: re.j, info:eu-repo/semantics/published
Published: 2021
Full Text: View/download PDF

33. Evolution and phylogeography of Culex pipiens densovirus

Author: Maxime Courcelle, Mylène Weill, Sarah François, Sebastian Lequime, Mathieu Sicard, Anne-Sophie Gosselin-Grenet, Mylène Ogliastro, Mine Altinli, Fabienne Justy, Institut des Sciences de l'Evolution de Montpellier (UMR ISEM), École pratique des hautes études (EPHE), Université Paris sciences et lettres (PSL)-Université Paris sciences et lettres (PSL)-Université de Montpellier (UM)-Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Centre National de la Recherche Scientifique (CNRS)-Institut de recherche pour le développement [IRD] : UR226, Rega Institute for Medical Research [Leuven, België], Catholic University of Leuven - Katholieke Universiteit Leuven (KU Leuven), University of Oxford [Oxford], Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Université Montpellier 2 - Sciences et Techniques (UM2)-Institut National de la Recherche Agronomique (INRA), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-École Pratique des Hautes Études (EPHE), Université Paris sciences et lettres (PSL)-Université Paris sciences et lettres (PSL)-Université de Montpellier (UM)-Institut de recherche pour le développement [IRD] : UR226-Centre National de la Recherche Scientifique (CNRS), University of Oxford, and Institut National de la Recherche Agronomique (INRA)-Université Montpellier 2 - Sciences et Techniques (UM2)-Université de Montpellier (UM)
Subjects: 030231 tropical medicine, selection, phylogeography, Microbiology, Genome, 03 medical and health sciences, Negative selection, 0302 clinical medicine, Molecular evolution, Virology, Culex pipiens, Clade, Gene, 030304 developmental biology, Parvoviridae, 0303 health sciences, biology, molecular evolution, Ambidensovirus, biology.organism_classification, densovirus evolution, insect-specific virus prevalence, Evolutionary biology, [SDV.MP.VIR]Life Sciences [q-bio]/Microbiology and Parasitology/Virology, Densovirus, Research Article
Abstract: Viruses of the Parvoviridae family infect a wide range of animals including vertebrates and invertebrates. So far, our understanding of parvovirus diversity is biased towards medically or economically important viruses mainly infecting vertebrate hosts, while invertebrate infecting parvoviruses—namely densoviruses—have been largely neglected. Here, we investigated the prevalence and the evolution of the only mosquito-infecting ambidensovirus, Culex pipiens densovirus (CpDV), from laboratory mosquito lines and natural populations collected worldwide. CpDV diversity generally grouped in two clades, here named CpDV-1 and -2. The incongruence of the different gene trees for some samples suggested the possibility of recombination events between strains from different clades. We further investigated the role of selection on the evolution of CpDV genome and detected many individual sites under purifying selection both in non-structural and structural genes. However, some sites in structural genes were under diversifying selection, especially during the divergence of CpDV-1 and -2 clades. These substitutions between CpDV-1 and -2 clades were mostly located in the capsid protein encoding region and might cause changes in host specificity or pathogenicity of CpDV strains from the two clades. However, additional functional and experimental studies are necessary to fully understand the protein conformations and the resulting phenotype of these substitutions between clades of CpDV.
Published: 2021
Full Text: View/download PDF

34. Characterisation of the Viral Community Associated with the Alfalfa Weevil (Hypera postica) and Its Host Plant, Alfalfa (Medicago sativa)

Author: Marie Frayssinet, Rémy Froissart, Mylène Ogliastro, Emmanuel Fernandez, Philippe Roumagnac, Maximilien Kulikowski, Denis Filloux, Sarah François, Aymeric Antoine-Lorquin, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), University of Oxford [Oxford], Plant Health Institute of Montpellier (UMR PHIM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de Montpellier (UM)-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Département Systèmes Biologiques (Cirad-BIOS), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), Maladies infectieuses et vecteurs : écologie, génétique, évolution et contrôle (MIVEGEC), Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)-Institut de Recherche pour le Développement (IRD [France-Sud]), University of Oxford, Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, and Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)
Subjects: 0301 basic medicine, H01 - Protection des végétaux - Considérations générales, Viral metagenomics, viruses, agroecosystem, ved/biology.organism_classification_rank.species, Relation plante animal, Biological pest control, virus diversity, Gestion intégrée des ravageurs, Ravageur des plantes, biology, Weevil, food and beverages, QR1-502, Hypera postica, Infectious Diseases, Lutte biologique contre les ravageurs, Medicago sativa, F40 - Écologie végétale, 030106 microbiology, Virus des insectes, Microbiology, 03 medical and health sciences, Virology, Plant virus, biocontrol, Herbivore, ved/biology, fungi, 15. Life on land, biology.organism_classification, H10 - Ravageurs des plantes, Lutte biologique, [SDV.BV.PEP]Life Sciences [q-bio]/Vegetal Biology/Phytopathology and phytopharmacy, 030104 developmental biology, Agronomy, PEST analysis, viral metagenomics, insect pest
Abstract: Advances in viral metagenomics have paved the way of virus discovery by making the exploration of viruses in any ecosystem possible. Applied to agroecosystems, such an approach opens new possibilities to explore how viruses circulate between insects and plants, which may help to optimise their management. It could also lead to identifying novel entomopathogenic viral resources potentially suitable for biocontrol strategies. We sampled the larvae of a natural population of alfalfa weevils (Hypera postica), a major herbivorous pest feeding on legumes, and its host plant alfalfa (Medicago sativa). Insect and plant samples were collected from a crop field and an adjacent meadow. We characterised the diversity and abundance of viruses associated with weevils and alfalfa, and described nine putative new virus species, including four associated with alfalfa and five with weevils. In addition, we found that trophic accumulation may result in a higher diversity of plant viruses in phytophagous pests compared to host plants.
Published: 2021
Full Text: View/download PDF

35. Missense Mutations in the CrrB Protein Mediate Odilorhabdin Derivative Resistance in Klebsiella pneumoniae

Author: Lilia Boucinha, Emilie Lessoud, Lucile Pantel, Maxime Gualtieri, Anne Lanois, Emilie Racine, Alain Givaudan, Paulo Juarez, Marine Serri, Nosopharm, Smaltis SAS - R&D Department, MaaT Pharma [Lyon], Evotec ID [Lyon], Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), and Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)
Subjects: Pharmacology, 0303 health sciences, biology, 030306 microbiology, Chemistry, Klebsiella pneumoniae, Mutant, ATP-binding cassette transporter, biology.organism_classification, Molecular biology, Enterobacteriaceae, [SDV.MP.BAC]Life Sciences [q-bio]/Microbiology and Parasitology/Bacteriology, 3. Good health, 03 medical and health sciences, Response regulator, Infectious Diseases, Plasmid, [SDV.MHEP.MI]Life Sciences [q-bio]/Human health and pathology/Infectious diseases, Pharmacology (medical), Bacterial outer membrane, Gene, 030304 developmental biology
Abstract: International audience; NOSO-502 is a preclinical antibiotic candidate of the odilorhabdin class. This compound exhibits activity against Enterobacteriaceae pathogens, including carbapenemase-producing bacteria and most of the colistin (CST)-resistant strains. Among a collection of CST-resistant Klebsiella pneumoniae strains harboring mutations in the genes pmrAB , mgrB , phoPQ , and crrB , only those bearing mutations in the gene crrB were found to be resistant to NOSO-502. CrrB is a histidine kinase which acts with the response regulator CrrA to modulate the PmrAB system, which induces the restructuring of lipopolysaccharide on the outer membrane and thus leads to CST resistance. Moreover, crrB mutations also enhance the transcription of neighboring genes, such as H239_3063 , encoding an ABC transporter transmembrane region, H239_3064 , encoding a putative efflux pump also known as KexD, and H239_3065 , encoding an N -acetyltransferase. To elucidate the mechanism of resistance to NOSO-502 induced by CrrB missense mutations in K. pneumoniae , mutants of NCTC 13442 and ATCC BAA-2146 strains resistant to NOSO-502 and CST with single amino acid substitutions in CrrB (S8N, F33Y, Y34N, W140R, N141I, P151A, P151L, P151S, P151T, or F303Y) were selected. Full susceptibility to NOSO-502 was restored in crrA - or crrB -deleted K. pneumoniae NCTC 13442 CrrB (P151L) mutants, confirming the role of CrrAB in controlling this resistance pathway. Deletion of kexD (but not other neighboring genes) in the same mutant also restored NOSO-502-susceptibility. Upregulation of the kexD gene expression was observed for all CrrB mutants. Finally, plasmid expression of kexD in a K. pneumoniae strain missing the locus crrABC and kexD significantly increased resistance to NOSO-502.
Published: 2021
Full Text: View/download PDF

36. Coding-Complete Genome Sequence of a Partitivirus Isolated from Pine Processionary Moth Eggs

Author: Mylène Ogliastro, Réjane Streiff, Franck Dorkeld, Carole Kerdelhué, Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), This work was supported by INRAE, departments ECODIV (project EVIL) and SPE. M.O. is supported by the European Union's Horizon 2020 research and innovation program under grant agreement number 773567., European Project: 773567,VIROPLANT, Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, and Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)
Subjects: 0106 biological sciences, Whole genome sequencing, Genetics, 0303 health sciences, [SDV]Life Sciences [q-bio], Genome Sequences, Thaumetopoea pityocampa, Coat protein, Biology, 010603 evolutionary biology, 01 natural sciences, Lepidoptera genitalia, 03 medical and health sciences, chemistry.chemical_compound, Open reading frame, Immunology and Microbiology (miscellaneous), chemistry, Family Partitiviridae, RNA polymerase, Molecular Biology, Pine processionary moth, 030304 developmental biology
Abstract: Two coding-complete nucleotide sequences of a partitivirus (family Partitiviridae) were discovered in transcriptomic data sets obtained from eggs of the Lepidoptera Thaumetopoea pityocampa. Each segment encodes a single open reading frame, and these two segments are predicted to encode an RNA-dependent RNA polymerase and a coat protein, respectively.
Published: 2021
Full Text: View/download PDF

37. Chromosomal scale assembly of parasitic wasp genome reveals symbiotic virus colonization

Author: Myriam Harry, Bernard Duvic, Anthony Bretaudeau, Hélène Boulain, Jetske G. de Boer, Jean-Marc Aury, Claire Capdevielle-Dulac, Annie Bézier, Diane Bigot, Natacha Kremer, Laure Kaiser, Lyam Baudry, Joke J.F.A. van Vugt, Jean-Michel Drezen, Georges Periquet, Stéphane Dupas, Romain Koszul, Aurélie Hua-Van, Jérémy Gauthier, Fabrice Legeai, Emma Persyn, Mahnaz Sabeti-Azad, Fernando Luis Cônsoli, Valérie Barbe, Joelle Amselem, Karine Labadie, Benjamin Noel, Frédérique Hilliou, Martine Maïbèche, Géraldine Dubreuil, Isabelle Luyten, Karine Musset, Martial Marbouty, Christophe Bressac, Isabelle Boulogne, Louise E. M. Vet, Thibaut Josse, Philippe Gayral, Hans M. Smid, Emmanuelle Jacquin-Joly, David Siaussat, James B. Whitfield, Elisabeth A. Herniou, Mohamed Amine Chebbi, Thomas Chertemps, Nicolas Montagné, Sébastien J. M. Moreau, Elisabeth Huguet, Bruna Laís Merlin, Gaëlle Le Goff, Sven Warris, Institut de recherche sur la biologie de l'insecte UMR7261 (IRBI), Université de Tours-Centre National de la Recherche Scientifique (CNRS), Natural History Museum [Geneva], Swiss Federal Insitute of Aquatic Science and Technology [Dübendorf] (EAWAG), Netherlands Institute of Ecology - NIOO-KNAW (NETHERLANDS), Régulation spatiale des Génomes - Spatial Regulation of Genomes, Institut Pasteur [Paris]-Centre National de la Recherche Scientifique (CNRS), Collège doctoral [Sorbonne universités], Sorbonne Université (SU), Institut d'écologie et des sciences de l'environnement de Paris (iEES Paris ), Institut de Recherche pour le Développement (IRD)-Sorbonne Université (SU)-Université Paris-Est Créteil Val-de-Marne - Paris 12 (UPEC UP12)-Centre National de la Recherche Scientifique (CNRS)-Université de Paris (UP)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Génomique métabolique (UMR 8030), Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay-Centre National de la Recherche Scientifique (CNRS)-Université d'Évry-Val-d'Essonne (UEVE), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche en Informatique et en Automatique (Inria)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Scalable, Optimized and Parallel Algorithms for Genomics (GenScale), Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Wageningen University and Research [Wageningen] (WUR), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Laboratoire de Biométrie et Biologie Evolutive - UMR 5558 (LBBE), Université Claude Bernard Lyon 1 (UCBL), Université de Lyon-Université de Lyon-Institut National de Recherche en Informatique et en Automatique (Inria)-VetAgro Sup - Institut national d'enseignement supérieur et de recherche en alimentation, santé animale, sciences agronomiques et de l'environnement (VAS)-Centre National de la Recherche Scientifique (CNRS), Evolution, génomes, comportement et écologie (EGCE), Institut de Recherche pour le Développement (IRD)-Université Paris-Saclay-Centre National de la Recherche Scientifique (CNRS), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Unité de Recherche Génomique Info (URGI), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay, Escola Superior de Agricultura 'Luiz de Queiroz' (ESALQ), Universidade de São Paulo (USP), Department of Entomology [Urbana], University of Illinois System, Department of Terrestrial Ecology [Wageningen], Netherlands Institute of Ecology (NIOO-KNAW), ANR-12-ADAP-0001, Agence Nationale de la Recherche, Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS), Institut Pasteur [Paris] (IP)-Centre National de la Recherche Scientifique (CNRS), Collège Doctoral, Institut de Recherche pour le Développement (IRD)-Sorbonne Université (SU)-Université Paris-Est Créteil Val-de-Marne - Paris 12 (UPEC UP12)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Université Paris-Saclay-Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université d'Évry-Val-d'Essonne (UEVE)-Centre National de la Recherche Scientifique (CNRS), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA), Universidade de São Paulo = University of São Paulo (USP), ANR-12-ADAP-0001,ABC - PaPoGen,Adaptation en lutte biologique - Génomique des populations de parasitoïdes(2012), Evolutionary Genetics, Development & Behaviour, Terrestrial Ecology (TE), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes 1 (UR1), and Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique)
Subjects: Genome evolution, food.ingredient, QH301-705.5, Bioinformatics, [SDV]Life Sciences [q-bio], Medicine (miscellaneous), macromolecular substances, Biology, Genome, Article, Evolutionary genetics, General Biochemistry, Genetics and Molecular Biology, Plan_S-Compliant-OA, Parasitoid wasp, 03 medical and health sciences, BIOS Applied Bioinformatics, 0302 clinical medicine, food, Bioinformatica, Life Science, Cotesia congregata, VÍRUS DE DNA, Biology (General), Laboratory of Entomology, Gene, 030304 developmental biology, 0303 health sciences, [SDV.GEN]Life Sciences [q-bio]/Genetics, Human evolutionary genetics, Chromosome, biology.organism_classification, PE&RC, Laboratorium voor Entomologie, Evolutionary biology, international, EPS, General Agricultural and Biological Sciences, Bracovirus, Entomology, 030217 neurology & neurosurgery
Abstract: Endogenous viruses form an important proportion of eukaryote genomes and a source of novel functions. How large DNA viruses integrated into a genome evolve when they confer a benefit to their host, however, remains unknown. Bracoviruses are essential for the parasitism success of parasitoid wasps, into whose genomes they integrated ~103 million years ago. Here we show, from the assembly of a parasitoid wasp genome at a chromosomal scale, that bracovirus genes colonized all ten chromosomes of Cotesia congregata. Most form clusters of genes involved in particle production or parasitism success. Genomic comparison with another wasp, Microplitis demolitor, revealed that these clusters were already established ~53 mya and thus belong to remarkably stable genomic structures, the architectures of which are evolutionary constrained. Transcriptomic analyses highlight temporal synchronization of viral gene expression without resulting in immune gene induction, suggesting that no conflicts remain between ancient symbiotic partners when benefits to them converge., Jeremy Gauthier et al. present the chromosome scale assembly of the genome of the parasitic wasp C. congregata and show that bracovirus genes have colonized all ten chromosomes. Comparison with genome scaffolds of another wasp reveals a striking stability of these regions over ~53 million years, suggesting strong evolutionary constraints.
Published: 2021
Full Text: View/download PDF

38. Coding-Complete Genome Sequences of an Iteradensovirus and an Alphapermutotetra-Like Virus Identified from the Pine Processionary Moth ( Thaumetopoea pityocampa ) in Portugal

Author: Dorkeld, Franck, Streiff, Rejane, Kerdelhué, Carole, Ogliastro, Mylène, Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), INRAE, department ECODIV (innovative project EVIL), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), and Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)
Subjects: [SDV.MP]Life Sciences [q-bio]/Microbiology and Parasitology, viruses, Genome Sequences
Abstract: The coding-complete nucleotide sequences of an iteradensovirus (family Parvoviridae) and an alphapermutotetra-like virus (family Permutotetraviridae) were discovered from transcriptomic data sets obtained from Thaumetopoea pityocampa larvae collected in Portugal. Each of the coding-complete genome sequences of these viruses contain three main open reading frames (ORFs)., The coding-complete genome sequences of an iteradensovirus (family Parvoviridae) and an alphapermutotetra-like virus (family Permutotetraviridae) were discovered from transcriptomic data sets obtained from Thaumetopoea pityocampa larvae collected in Portugal. Each of the coding-complete genome sequences of these viruses contains three main open reading frames (ORFs).
Published: 2021
Full Text: View/download PDF

39. Viruses and scientists under the sun of Montpellier

Author: Gosselin-Grenet, Anne-Sophie, Almeida, Renata Servan De, Roumagnac, Philippe, Ayouba, Ahidjo, Simonin, Yannick, Nisole, Sébastien, LESUR, Hélène, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Animal, Santé, Territoires, Risques et Ecosystèmes (UMR ASTRE), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Département Systèmes Biologiques (Cirad-BIOS), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), Plant Health Institute of Montpellier (UMR PHIM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Recherches Translationnelles sur le VIH et les maladies infectieuses endémiques er émergentes (TransVIHMI), Institut de Recherche pour le Développement (IRD)-Université de Yaoundé I-Université Cheikh Anta Diop [Dakar, Sénégal] (UCAD)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Montpellier (UM), Pathogenesis and Control of Chronic and Emerging Infections (PCCEI), Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Montpellier (UM)-Université des Antilles (UA)-Etablissement français du don du sang [Montpellier], Institut de Recherche en Infectiologie de Montpellier (IRIM), and Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS)
Subjects: [SDV] Life Sciences [q-bio], [SDV]Life Sciences [q-bio]
Abstract: International audience; Les 26 et 27 avril 2021, Montpellier devait accueillir la communauté des virologistes francophones, en hébergeant pour la première fois les « Journées Francophones de Virologie » (JFV). Tout était prêt : les salles, les panneaux pour les posters, les buffets, le vestiaire, le café… et la banderole JFV 2021 devait se dresser fièrement à l’entrée de la Faculté des Sciences
Published: 2021
Full Text: View/download PDF

40. Two repeated motifs enriched within some enhancers and origins of replication are bound by SETMAR isoforms in human colon cells

Author: Antoine-Lorquin, Aymeric, Arensburger, Peter, Arnaoty, Ahmed, Asgari, Sassan, Batailler, Martine, Beauclair, Linda, Belleannée, Catherine, Buisine, Nicolas, Coustham, Vincent, Guyetant, Serge, Helou, Laura, Lecomte, Thierry, Pitard, Bruno, Stévant, Isabelle, Bigot, Yves, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), California State Polytechnic University [Pomona] (CAL POLY POMONA), Centre Hospitalier Régional Universitaire de Tours (CHRU Tours), University of Queensland [Brisbane], Physiologie de la reproduction et des comportements [Nouzilly] (PRC), Institut Français du Cheval et de l'Equitation [Saumur] (IFCE)-Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Dynamics, Logics and Inference for biological Systems and Sequences (Dyliss), Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Physiologie moléculaire et adaptation (PhyMA), Muséum national d'Histoire naturelle (MNHN)-Centre National de la Recherche Scientifique (CNRS), Biologie des Oiseaux et Aviculture (BOA), Université de Tours (UT)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Host-Pathogen Interactions in the Regulation of Immune Responses (CRCINA-ÉQUIPE 5), Centre de Recherche en Cancérologie et Immunologie Nantes-Angers (CRCINA), Université d'Angers (UA)-Université de Nantes (UN)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Centre hospitalier universitaire de Nantes (CHU Nantes)-Université d'Angers (UA)-Université de Nantes (UN)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Centre hospitalier universitaire de Nantes (CHU Nantes), Institut de Génomique Fonctionnelle de Lyon (IGFL), École normale supérieure - Lyon (ENS Lyon)-Université Claude Bernard Lyon 1 (UCBL), Université de Lyon-Université de Lyon-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), and Bigot, yves
Subjects: MITE, domestication, transposon, [SDV.GEN.GH]Life Sciences [q-bio]/Genetics/Human genetics, [SDV.BBM.GTP]Life Sciences [q-bio]/Biochemistry, Molecular Biology/Genomics [q-bio.GN], coevolution, [SDV.BBM.GTP] Life Sciences [q-bio]/Biochemistry, Molecular Biology/Genomics [q-bio.GN], DNA binding, expression enhancer, DNA replication, [SDV.GEN.GH] Life Sciences [q-bio]/Genetics/Human genetics
Abstract: International audience; Setmar is a gene specific to simian genomes. The function(s) of its isoforms are poorly understood and their existence in healthy tissues remains to be validated. Here we profiled SETMAR expression and its genome-wide binding landscape in colon tissue. We found isoforms V3 and V6 in healthy and tumour colon tissues as well as incell lines. In two colorectal cell lines SETMAR binds to several thousand Hsmar1 and MADE1 terminal ends, transposons mostly located in non-genic regions of active chromatin including in enhancers. It also binds to a 12-bp motifs similar to an inner motif in Hsmar1 and MADE1 terminal ends. This motif is interspersed throughout the genome and is enriched in GC-rich regions as well as in CpG islands that contain constitutive replication origins. It is also found in enhancers other than those associated with Hsmar1 and MADE1. The role of SETMAR in the expression of genes, DNA replication and in DNA repair are discussed.
Published: 2021
Full Text: View/download PDF

41. Two repeated motifs enriched within some enhancers and origins of replication are bound by SETMAR isoforms in human colon cells

Author: Yves Bigot, Thierry Lecomte, Ahmed Arnaoty, Isabelle Stévant, Peter Arensburger, Vincent Coustham, Aymeric Antoine-Lorquin, Martine Batailler, Laura Helou, Serge Guyétant, Nicolas Buisine, Bruno Pitard, Sassan Asgari, Linda Beauclair, Catherine Belleannée, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), California State Polytechnic University [Pomona] (CAL POLY POMONA), Centre Hospitalier Régional Universitaire de Tours (CHRU Tours), University of Queensland [Brisbane], Physiologie de la reproduction et des comportements [Nouzilly] (PRC), Institut Français du Cheval et de l'Equitation [Saumur]-Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Dynamics, Logics and Inference for biological Systems and Sequences (Dyliss), Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche en Informatique et en Automatique (Inria)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Physiologie moléculaire et adaptation (PhyMA), Muséum national d'Histoire naturelle (MNHN)-Centre National de la Recherche Scientifique (CNRS), Biologie des Oiseaux et Aviculture (BOA), Université de Tours (UT)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Host-Pathogen Interactions in the Regulation of Immune Responses (CRCINA-ÉQUIPE 5), Centre de Recherche en Cancérologie et Immunologie Nantes-Angers (CRCINA), Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Nantes - UFR de Médecine et des Techniques Médicales (UFR MEDECINE), Université de Nantes (UN)-Université de Nantes (UN)-Centre hospitalier universitaire de Nantes (CHU Nantes)-Centre National de la Recherche Scientifique (CNRS)-Université d'Angers (UA)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Université de Nantes - UFR de Médecine et des Techniques Médicales (UFR MEDECINE), Université de Nantes (UN)-Université de Nantes (UN)-Centre hospitalier universitaire de Nantes (CHU Nantes)-Centre National de la Recherche Scientifique (CNRS)-Université d'Angers (UA), Institut de Génomique Fonctionnelle de Lyon (IGFL), École normale supérieure - Lyon (ENS Lyon)-Université Claude Bernard Lyon 1 (UCBL), Université de Lyon-Université de Lyon-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut Français du Cheval et de l'Equitation [Saumur] (IFCE)-Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Université d'Angers (UA)-Université de Nantes (UN)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Centre hospitalier universitaire de Nantes (CHU Nantes)-Université d'Angers (UA)-Université de Nantes (UN)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Centre National de la Recherche Scientifique (CNRS)-Centre hospitalier universitaire de Nantes (CHU Nantes), École normale supérieure de Lyon (ENS de Lyon)-Université Claude Bernard Lyon 1 (UCBL), Centre Hospitalier Régional Universitaire de Tours (CHRU TOURS), Institut Français du Cheval et de l'Equitation [Saumur]-Université de Tours-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), and Université de Tours-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)
Subjects: 0106 biological sciences, Gene isoform, DNA Repair, transposon, Colon, DNA repair, Regulatory Sequences, Nucleic Acid, Biology, DNA replication, Origin of replication, 01 natural sciences, 03 medical and health sciences, domestication, [SDV.BBM.GTP]Life Sciences [q-bio]/Biochemistry, Molecular Biology/Genomics [q-bio.GN], Genetics, Humans, Protein Isoforms, expression enhancer, DNA binding, Enhancer, Gene, 030304 developmental biology, MITE, 0303 health sciences, Histone-Lysine N-Methyltransferase, Chromatin, Cell biology, Enhancer Elements, Genetic, CpG site, [SDV.GEN.GH]Life Sciences [q-bio]/Genetics/Human genetics, coevolution, 010606 plant biology & botany
Abstract: International audience; Setmar is a gene specific to simian genomes. The function(s) of its isoforms are poorly understood and their existence in healthy tissues remains to be validated. Here we profiled SETMAR expression and its genome-wide binding landscape in colon tissue. We found isoforms V3 and V6 in healthy and tumour colon tissues as well as incell lines. In two colorectal cell lines SETMAR binds to several thousand Hsmar1 and MADE1 terminal ends, transposons mostly located in non-genic regions of active chromatin including in enhancers. It also binds to a 12-bp motifs similar to an inner motif in Hsmar1 and MADE1 terminal ends. This motif is interspersed throughout the genome and is enriched in GC-rich regions as well as in CpG islands that contain constitutive replication origins. It is also found in enhancers other than those associated with Hsmar1 and MADE1. The role of SETMAR in the expression of genes, DNA replication and in DNA repair are discussed.
Published: 2021
Full Text: View/download PDF

42. Photorhabdus heterorhabditis subsp. aluminescens subsp. nov., Photorhabdus heterorhabditis subsp. heterorhabditissubsp. nov., Photorhabdus australis subsp. thailandensis subsp. nov., Photorhabdus australis subsp. australis subsp. nov., and Photorhabdus aegyptia sp. nov. isolated from Heterorhabditisentomopathogenic nematodes

Author: Mona A. Hussein, Helge B. Bode, Aunchalee Thanwisai, Louis S. Tisa, Sylvie Pages, Shimaa M. Ghazal, Ricardo A. R. Machado, Arthur Muller, Kamal M. Khalil, Institute of Biology of the University of Neuchâtel, Université de Neuchâtel (UNINE), University of New Hampshire (UNH), National Research Center [Le Caire, Égypte] (NRC), Naresuan University, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Goethe-Universität Frankfurt am Main, Swiss National Science Foundation (SNSF) European Commission 186 094, and National Research Centre (NRC) 12050137
Subjects: Whole genome sequencing, 0303 health sciences, whole genome sequencing, animal structures, Phylogenetic tree, biology, 030306 microbiology, Strain (biology), [SDV]Life Sciences [q-bio], Heterorhabditis, General Medicine, Subspecies, biology.organism_classification, 16S ribosomal RNA, polyphasic classification, Microbiology, dDDH, 03 medical and health sciences, Gammaproteobacteria, Botany, Photorhabdus, Ecology, Evolution, Behavior and Systematics, 030304 developmental biology
Abstract: Three Gram-stain-negative, rod-shaped, non-spore-forming bacteria, BA1T, Q614T and PB68.1T, isolated from the digestive system of Heterorhabditis entomopathogenic nematodes, were biochemically and molecularly characterized to clarify their taxonomic affiliations. The 16S rRNA gene sequences of these strains suggest that they belong to the Gammaproteobacteria, to the family Morganellacea, and to the genus Photorhabdus . Deeper analyses using whole genome-based phylogenetic reconstructions suggest that BA1T is closely related to Photorhabdus akhursti, that Q614T is closely related to Photorhabdus heterorhabditis, and that PB68.1T is closely related to Photorhabdus australis. In silico genomic comparisons confirm these observations: BA1T and P. akhursti 15138T share 68.8 % digital DNA–DNA hybridization (dDDH), Q614T and P. heterorhabditis SF41T share 75.4 % dDDH, and PB68.1T and P. australis DSM 17609T share 76.6 % dDDH. Physiological and biochemical characterizations reveal that these three strains also differ from all validly described Photorhabdus species and from their more closely related taxa, contrary to what was previously suggested. We therefore propose to classify BA1T as a new species within the genus Photorhabdus , Q614T as a new subspecies within P. heterorhabditis, and PB68.1T as a new subspecies within P. australis . Hence, the following names are proposed for these strains: Photorhabdus aegyptia sp. nov. with the type strain BA1T(=DSM 111180T=CCOS 1943T=LMG 31957T), Photorhabdus heterorhabditis subsp. aluminescens subsp. nov. with the type strain Q614T (=DSM 111144T=CCOS 1944T=LMG 31959T) and Photorhabdus australis subsp. thailandensis subsp. nov. with the type strain PB68.1T (=DSM 111145T=CCOS 1942T). These propositions automatically create Photorhabdus heterorhabditis subsp. heterorhabditis subsp. nov. with SF41T as the type strain (currently classified as P. heterorhabditis ) and Photorhabdus australis subsp. australis subsp. nov. with DSM17609T as the type strain (currently classified as P. australis ).
Published: 2021
Full Text: View/download PDF

43. Adaptation by copy number variation increases insecticide resistance in the fall armyworm

Author: Gimenez, Sylvie, Abdelgaffar, Heba, Goff, Gaelle Le, Hilliou, Frédérique, Blanco, Carlos A., Hänniger, Sabine, Bretaudeau, Anthony, Legeai, Fabrice, Nègre, Nicolas, Jurat-Fuentes, Juan Luis, d’Alençon, Emmanuelle, Nam, Kiwoong, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), The University of Tennessee [Knoxville], Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (... - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), United States Department of Agriculture (USDA), Max Planck Institute for Chemical Ecology, Max-Planck-Gesellschaft, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Plateforme bioinformatique GenOuest [Rennes], Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Plateforme Génomique Santé Biogenouest®-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche en Informatique et en Automatique (Inria)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Scalable, Optimized and Parallel Algorithms for Genomics (GenScale), Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), department of Sante des Plantes et Environnement at Institut national de la recherche agronomique (adaptivesv), Agriculture and Food Research Initiative Foundational Program from the USDA National Institute of Food and Agriculture 2018-67013-27820, Université Nice Sophia Antipolis (1965 - 2019) (UNS), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université de Rennes (UR)-Plateforme Génomique Santé Biogenouest®-Inria Rennes – Bretagne Atlantique, Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), and Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique)
Subjects: Insecticides, DNA Copy Number Variations, Genome, Insect, fungi, Spodoptera, Article, Evolutionary genetics, Insecticide Resistance, Cytochrome P-450 Enzyme System, lcsh:Biology (General), Nitriles, Pyrethrins, Animals, Female, Structural variation, [INFO.INFO-BI]Computer Science [cs]/Bioinformatics [q-bio.QM], lcsh:QH301-705.5
Abstract: Understanding the genetic basis of insecticide resistance is a key topic in agricultural ecology. The adaptive evolution of multi-copy detoxification genes has been interpreted as a cause of insecticide resistance, yet the same pattern can also be generated by the adaptation to host-plant defense toxins. In this study, we tested in the fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), if adaptation by copy number variation caused insecticide resistance in two geographically distinct populations with different levels of resistance and the two host-plant strains. We observed a significant allelic differentiation of genomic copy number variations between the two geographic populations, but not between host-plant strains. A locus with positively selected copy number variation included a CYP gene cluster. Toxicological tests supported a central role for CYP enzymes in deltamethrin resistance. Our results indicate that copy number variation of detoxification genes might be responsible for insecticide resistance in fall armyworm and that evolutionary forces causing insecticide resistance could be independent of host-plant adaptation., Sylvie Gimenez et al. compare adaptation by copy number variation in two geographically distinct populations of the fall armyworm and find a relationship between copy number variation and insecticide resistance. The authors perform toxicological tests to confirm a role of the CYP gene cluster in insecticide resistance and suggest that evolutionary forces causing insecticide resistance can be independent of host-plant adaptation.
Published: 2020
Full Text: View/download PDF

44. Genomic architecture of endogenous ichnoviruses reveals distinct evolutionary pathways leading to virus domestication in parasitic wasps

Author: Gabor Gyapay, Claire Lemaitre, Seán G. Brady, Frédéric Baudat, Denis Tagu, Anne-Nathalie Volkoff, Fabrice Legeai, Anthony Bretaudeau, Rebecca B. Dikow, Xin Zhou, Marc Ravallec, Stéphanie Robin, Jean-Michel Drezen, Bernardo F. Santos, Shanlin Liu, Véronique Jouan, Bruce A. Webb, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Scalable, Optimized and Parallel Algorithms for Genomics (GenScale), Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Smithsonian Institution, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut de recherche sur la biologie de l'insecte UMR7261 (IRBI), Université de Tours (UT)-Centre National de la Recherche Scientifique (CNRS), Institut de génétique humaine (IGH), Université de Montpellier (UM)-Centre National de la Recherche Scientifique (CNRS), Genoscope - Centre national de séquençage [Evry] (GENOSCOPE), Université Paris-Saclay-Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA), School of Earth and Space Sciences, Peking University [Beijing], China Agricultural University Library, Beijing Genomics Institute [Shenzhen] (BGI), University of Kentucky (UK), AIPINRA project (GenomeInsect, AIP BIORESSOURCES 2012), Sackler Institute of Comparative Genomics (AMNH), ANR-12-ADAP-0001,ABC - PaPoGen,Adaptation en lutte biologique - Génomique des populations de parasitoïdes(2012), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche en Informatique et en Automatique (Inria)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Direction de Recherche Fondamentale (CEA) (DRF (CEA)), Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Commissariat à l'énergie atomique et aux énergies alternatives (CEA)-Université Paris-Saclay, University of Kentucky, and Université de Tours-Centre National de la Recherche Scientifique (CNRS)
Subjects: 0106 biological sciences, food.ingredient, IVSPERs, Physiology, Endogenous virus architecture, Koinobiont, [SDV]Life Sciences [q-bio], Wasps, Plant Science, Genome, Viral, macromolecular substances, 010603 evolutionary biology, 01 natural sciences, Genome, Campopleginae, General Biochemistry, Genetics and Molecular Biology, Parasitoid, Parasitoid wasp, Evolution, Molecular, 03 medical and health sciences, food, Species Specificity, Structural Biology, Polydnavirus, Animals, lcsh:QH301-705.5, Gene, Ecology, Evolution, Behavior and Systematics, 030304 developmental biology, 0303 health sciences, biology, Host Microbial Interactions, Whole Genome Sequencing, Host (biology), Cell Biology, biology.organism_classification, lcsh:Biology (General), Evolutionary biology, Polydnaviridae, Ichnovirus, General Agricultural and Biological Sciences, Bracovirus, Developmental Biology, Biotechnology, Research Article
Abstract: Background Polydnaviruses (PDVs) are mutualistic endogenous viruses inoculated by some lineages of parasitoid wasps into their hosts, where they facilitate successful wasp development. PDVs include the ichnoviruses and bracoviruses that originate from independent viral acquisitions in ichneumonid and braconid wasps respectively. PDV genomes are fully incorporated into the wasp genomes and consist of (1) genes involved in viral particle production, which derive from the viral ancestor and are not encapsidated, and (2) proviral segments harboring virulence genes, which are packaged into the viral particle. To help elucidating the mechanisms that have facilitated viral domestication in ichneumonid wasps, we analyzed the structure of the viral insertions by sequencing the whole genome of two ichnovirus-carrying wasp species, Hyposoter didymator and Campoletis sonorensis. Results Assemblies with long scaffold sizes allowed us to unravel the organization of the endogenous ichnovirus and revealed considerable dispersion of the viral loci within the wasp genomes. Proviral segments contained species-specific sets of genes and occupied distinct genomic locations in the two ichneumonid wasps. In contrast, viral machinery genes were organized in clusters showing highly conserved gene content and order, with some loci located in collinear wasp genomic regions. This genomic architecture clearly differs from the organization of PDVs in braconid wasps, in which proviral segments are clustered and viral machinery elements are more dispersed. Conclusions The contrasting structures of the two types of ichnovirus genomic elements are consistent with their different functions: proviral segments are vehicles for virulence proteins expected to adapt according to different host defense systems, whereas the genes involved in virus particle production in the wasp are likely more stable and may reflect ancestral viral architecture. The distinct genomic architectures seen in ichnoviruses versus bracoviruses reveal different evolutionary trajectories that have led to virus domestication in the two wasp lineages.
Published: 2020
Full Text: View/download PDF

45. Positive selection alone is sufficient for whole genome differentiation at the early stage of speciation process in the fall armyworm

Author: Kiwoong NAM, Sandra Nhim, Stéphanie Robin, Anthony Bretaudeau, Nicolas Nègre, Emmanuelle d'Alençon, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), ANR-12-BSV7-0004-01, Agence Nationale de la Recherche, Institut Universitaire de France, adaptivesv, SPE, INRA, ANR-12-BSV7-0004,ADA-SPODO,Déterminisme moléculaire de l'adaptation écologique et de la spéciation chez deux variants du lépidoptère Spodoptera frugiperda(2012), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), and Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique)
Subjects: Gene Flow, 0303 health sciences, [SDV.GEN]Life Sciences [q-bio]/Genetics, Genome hitchhiking, Genetic Speciation, Evolution, Speciation, Genome, Insect, Speciation continuum, Genomic differentiation, Spodoptera frugiperda, Spodoptera, Fall armyworm, 03 medical and health sciences, 0302 clinical medicine, Divergent selection, QH359-425, Genome-wide congealing, Animals, Selection, Genetic, 030217 neurology & neurosurgery, Phylogeny, 030304 developmental biology, Research Article
Abstract: International audience; Background: The process of speciation involves differentiation of whole genome sequences between a pair of diverging taxa. In the absence of a geographic barrier and in the presence of gene flow, genomic differentiation may occur when the homogenizing effect of recombination is overcome across the whole genome. The fall armyworm is observed as two sympatric strains with different host-plant preferences across the entire habitat. These two strains exhibit a very low level of genetic differentiation across the whole genome, suggesting that genomic differentiation occurred at an early stage of speciation. In this study, we aim at identifying critical evolutionary forces responsible for genomic differentiation in the fall armyworm. Results: These two strains exhibit a low level of genomic differentiation (F ST = 0.0174), while 99.2% of 200 kb windows have genetically differentiated sequences (F ST > 0). We found that the combined effect of mild positive selection and genetic linkage to selectively targeted loci are responsible for the genomic differentiation. However, a single event of very strong positive selection appears not to be responsible for genomic differentiation. The contribution of chromosomal inversions or tight genetic linkage among positively selected loci causing reproductive barriers is not supported by our data. Phylogenetic analysis shows that the genomic differentiation occurred by sub-setting of genetic variants in one strain from the other. Conclusions: From these results, we concluded that genomic differentiation may occur at the early stage of a speciation process in the fall armyworm and that mild positive selection targeting many loci alone is sufficient evolutionary force for generating the pattern of genomic differentiation. This genomic differentiation may provide a condition for accelerated genomic differentiation by synergistic effects among linkage disequilibrium generated by following events of positive selection. Our study highlights genomic differentiation as a key evolutionary factor connecting positive selection to divergent selection.
Published: 2020
Full Text: View/download PDF

46. The Unconventional Viruses of Ichneumonid Parasitoid Wasps

Author: Volkoff, Anne-Nathalie, Cusson, Michel, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Laurentian Forestry Centre, and Natural Resources Canada (NRCan)
Subjects: genomic architecture, Genes, Viral, ichnovirus, viruses, Genome, Insect, Wasps, fungi, Virion, lcsh:QR1-502, Review, macromolecular substances, endogenous viruses, virus-like particles, lcsh:Microbiology, Evolution, Molecular, mutualistic viruses, DNA, Viral, Viruses, [SDE]Environmental Sciences, Animals, Symbiosis, parasitoid wasp
Abstract: International audience; To ensure their own immature development as parasites, ichneumonid parasitoid wasps use endogenous viruses that they acquired through ancient events of viral genome integration. Thousands of species from the campoplegine and banchine wasp subfamilies rely, for their survival, on their association with these viruses, hijacked from a yet undetermined viral taxon. Here, we give an update of recent findings on the nature of the viral genes retained from the progenitor viruses and how they are organized in the wasp genome.
Published: 2020
Full Text: View/download PDF

47. Genomic balancing selection is key to the invasive success of the fall armyworm

Author: Thierry Brévault, Estelle Fiteni, Gael J. Kergoat, Fabrice Legeai, Carlos A. Blanco, Wee Tek Tay, Sylvie Gimenez, Robert L. Meagher, Nicolas Nègre, Asokan Ramasamy, Karl D. Gordon, Marie Frayssinet, Sharanabasappa Deshmukh, Thomas J. Walsh, Sudeeptha Yainna, Pierre Silvie, Anicet G. Dassou, Anne-Laure Clamens, C. M. Kalleshwaraswamy, Emmanuelle d'Alençon, Kiwoong Nam, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Commonwealth Scientific and Industrial Research Organisation [Canberra] (CSIRO), Université Claude Bernard Lyon 1 (UCBL), Université de Lyon, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Centre de Biologie pour la Gestion des Populations (UMR CBGP), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, Indian Institute of Horticultural Research [Bangalore] (ICAR), Department of Entomology, College of Agriculture, University of Agricultural and Horticultural Sciences [Shivamogga] (UAHS), United States Department of Agriculture - Agricultural Research Service (USDA-ARS), United States Department of Agriculture - Animal and Plant Health Inspection Service, Partenaires INRAE, Agroécologie et Intensification Durables des cultures annuelles (UPR AIDA), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), Département Performances des systèmes de production et de transformation tropicaux (Cirad-PERSYST), Université Nationale des Sciences, Technologies, Ingénierie et Mathématiques (UNSTIM), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche en Informatique et en Automatique (Inria)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Centre international d'études supérieures en sciences agronomiques (Montpellier SupAgro)-Université de Montpellier (UM)-Institut de Recherche pour le Développement (IRD [France-Sud])-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), and Indian Institute of Horticultural Research (ICAR)
Subjects: 0106 biological sciences, 0303 health sciences, education.field_of_study, Old World, Population size, [SDV]Life Sciences [q-bio], Population, Zoology, 15. Life on land, Biology, biology.organism_classification, Balancing selection, 010603 evolutionary biology, 01 natural sciences, Population genomics, Loss of heterozygosity, 03 medical and health sciences, 0302 clinical medicine, Population bottleneck, Evolutionary biology, 030220 oncology & carcinogenesis, Inbreeding depression, Fall armyworm, education, 030304 developmental biology
Abstract: A successful biological invasion involves survival in a newly occupied environment. If a population bottleneck occurs during an invasion, the resulting depletion of genetic variants could cause increased inbreeding depression and decreased adaptive potential, which may result in a fitness reduction. How invasive populations survive in the newly occupied environment despite reduced heterozygosity and how, in many cases, they maintain moderate levels of heterozygosity are still contentious issues1. The Fall armyworm (FAW; Lepidoptera: Spodoptera frugiperda), a polyphagous pest, is native to the Western hemisphere. Its invasion in the Old World was first reported from West Africa in early 2016, and in less than four years, it swept sub-Saharan Africa and Asia, finally reaching Australia. We used population genomics approaches to investigate the factors that may explain the invasive success of the FAW. Here we show that genomic balancing selection played a key role in invasive success by restoring heterozygosity before the global invasion. We observe a drastic loss of mitochondrial polymorphism in invasive populations, whereas nuclear heterozygosity exhibits a mild reduction. The population from Benin in West Africa has the lowest length of linkage disequilibrium amongst all invasive and native populations despite its reduced population size. This result indicates that balancing selection increased heterozygosity by facilitating the admixture of invasive populations from distinct origins and that, once heterozygosity was sufficiently high, FAW started spreading globally in the Old World. As comparable heterozygosity levels between invasive and native populations are commonly observed1, we postulate that the restoration of heterozygosity through balancing selection could be widespread among successful cases of biological invasions.
Published: 2020

48. Adaptation by copy number variation increases insecticide resistance in fall armyworms

Author: Sabine Hänniger, Fabrice Legeai, Carlos A. Blanco, Sylvie Gimenez, Nicolas Nègre, Emmanuelle d'Alençon, Kiwoong Nam, Anthony Bretaudeau, Frédérique Hilliou, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Institut Sophia Agrobiotech (ISA), Université Nice Sophia Antipolis (... - 2019) (UNS), COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-COMUE Université Côte d'Azur (2015-2019) (COMUE UCA)-Centre National de la Recherche Scientifique (CNRS)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Université Côte d'Azur (UCA), United States Department of Agriculture (USDA), Max Planck Institute for Chemical Ecology, Max-Planck-Gesellschaft, Institut de Génétique, Environnement et Protection des Plantes (IGEPP), Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-AGROCAMPUS OUEST, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Plateforme Protéomique-Biogenouest (PPB), Institut de recherche en santé, environnement et travail (Irset), Université d'Angers (UA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-École des Hautes Études en Santé Publique [EHESP] (EHESP)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Structure Fédérative de Recherche en Biologie et Santé de Rennes ( Biosit : Biologie - Santé - Innovation Technologique )-Université d'Angers (UA)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-École des Hautes Études en Santé Publique [EHESP] (EHESP)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Structure Fédérative de Recherche en Biologie et Santé de Rennes ( Biosit : Biologie - Santé - Innovation Technologique )-Proteomics Core Facility (Protim), Université de Rennes (UNIV-RENNES)-Université de Rennes (UNIV-RENNES)-Plateforme Génomique Santé Biogenouest®-Plateforme Génomique Santé Biogenouest®, Scalable, Optimized and Parallel Algorithms for Genomics (GenScale), Inria Rennes – Bretagne Atlantique, Institut National de Recherche en Informatique et en Automatique (Inria)-Institut National de Recherche en Informatique et en Automatique (Inria)-GESTION DES DONNÉES ET DE LA CONNAISSANCE (IRISA-D7), Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National de Recherche en Informatique et en Automatique (Inria)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Université de Rennes (UNIV-RENNES)-CentraleSupélec-IMT Atlantique Bretagne-Pays de la Loire (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Bretagne Sud (UBS)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Institut de Recherche en Informatique et Systèmes Aléatoires (IRISA), Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-Institut National des Sciences Appliquées (INSA)-Université de Rennes (UNIV-RENNES)-École normale supérieure - Rennes (ENS Rennes)-Centre National de la Recherche Scientifique (CNRS)-Université de Rennes 1 (UR1), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT), Université Nice Sophia Antipolis (1965 - 2019) (UNS), Université de Rennes (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-INSTITUT AGRO Agrocampus Ouest, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Université d'Angers (UA)-Université de Rennes (UR)-École des Hautes Études en Santé Publique [EHESP] (EHESP)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Structure Fédérative de Recherche en Biologie et Santé de Rennes ( Biosit : Biologie - Santé - Innovation Technologique )-Université d'Angers (UA)-Université de Rennes (UR)-École des Hautes Études en Santé Publique [EHESP] (EHESP)-Institut National de la Santé et de la Recherche Médicale (INSERM)-Structure Fédérative de Recherche en Biologie et Santé de Rennes ( Biosit : Biologie - Santé - Innovation Technologique )-Proteomics Core Facility (Protim), Université de Rennes (UR)-Plateforme Génomique Santé Biogenouest®-Plateforme Génomique Santé Biogenouest®, Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-Institut National de Recherche en Informatique et en Automatique (Inria)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique), Institut Mines-Télécom [Paris] (IMT)-Institut Mines-Télécom [Paris] (IMT)-Université de Rennes (UR)-Institut National des Sciences Appliquées - Rennes (INSA Rennes), and Institut National des Sciences Appliquées (INSA)-Institut National des Sciences Appliquées (INSA)-Université de Bretagne Sud (UBS)-École normale supérieure - Rennes (ENS Rennes)-CentraleSupélec-Centre National de la Recherche Scientifique (CNRS)-IMT Atlantique (IMT Atlantique)
Subjects: 0106 biological sciences, 2. Zero hunger, Genetics, 0303 health sciences, biology, business.industry, [SDV]Life Sciences [q-bio], Pest control, Locus (genetics), Spodoptera, biology.organism_classification, 01 natural sciences, Lepidoptera genitalia, 010602 entomology, 03 medical and health sciences, Insecticide resistance, Copy-number variation, Allele, business, Gene, 030304 developmental biology
Abstract: Insecticide resistance is a major main challenge in pest control, and understanding its genetic basis is a key topic in agricultural ecology. Detoxification genes are well-known genetic elements that play a key role in adaptation to xenobiotics. The adaptive evolution of detoxification genes by copy number variations has been interpreted as a cause of insecticide resistance. However, the same pattern can be generated by the adaptation to host-plant defense toxins as well. In this study, we tested in fall armyworms (Lepidoptera Spodoptera frugiperda) if adaptation by copy number variation is the cause of the increased level of insecticide resistance from two geographic populations with different levels of resistance and two strains with different host plants. Following the generation of an assembly with chromosome-sized scaffolds (N50 = 13.2Mb), we observed that these two populations show a significant allelic differentiation of copy number variations, which is not observed between strains. In particular, a locus with almost complete allelic differentiation (Fst > 0.8) includes a cluster of P450 genes, which are well-known key players in detoxification. Detoxification genes are overrepresented in the genes with copy number variations, and the observed copy number variation appears to have beneficial effects in general. From this result, we concluded that copy number variation of detoxification genes in fall armyworms plays a key role in the insecticide resistance but not in the adaptation to host-plants, suggesting that the evolution of insecticide resistance may occur independently from host-plant adaptation.
Published: 2020

49. Global FAW population genomic signature supports complex introduction events across the 1 Old World 2 3

Author: Wt, Tay, R., Rane, A., Padovan, Walsh, Tom, Elfekih, Samia, Downes, Sharon, Nam, Ki Woong, d'Alencon, Emmanuelle, J., Zhang, Y., Wu, NEGRE, Nicolas, D., Kunz, Dj, Kriticos, C., Czepak, M., Otim, Khj, Gordon, Commonwealth Scientific and Industrial Research Organisation [Canberra] (CSIRO), Australian Centre for Disease Preparedness, FD McMaster Laboratories, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), College of Plant Protection, Nanjing Agricultural University, Wellcome Trust, Gordon Institute, Cambridge, University of Cambridge [UK] (CAM), Universidade Federal de Goiás [Goiânia] (UFG), and National Crops Resources Research Institute
Subjects: global agricultural biosecurity, [SDV]Life Sciences [q-bio], draft mitochondrial DNA genomes, invasion biology, Fall armyworm
Abstract: 16 Accurate genomic knowledge can elucidate the global spread patterns of invasive pests. The high-17 profile invasive agricultural pest Spodoptera frugiperda (fall armyworm; FAW) is a case in point. Native to the 18 Americas, the FAW was first reported in West Africa in 2016 and has rapidly spread to over 64 countries across 19 the Old World, resulting in significant economic losses. The chronological order of reported detections has led 20 to the hypothesis that the FAW moved eastwards across Africa and then Asia, however genomic evidence 21 remains lacking to test this hypothesis and to identify the potential origin of invasive populations. Using a whole 22 genome sequencing approach, we explored the population genomic signatures of FAW populations from the 23 Americas and the Old World. Analyses of complete mitochondrial DNA genomes identified 12 maternal lineages 24 across the invasive range, while genomic signatures from 870 high-quality nuclear genome-wide single 25 nucleotide polymorphic (SNP) DNA markers identified five distinct New World populations that broadly reflected 26 their native geographical ranges and absence of host-plant preference status. Unique FAW populations in the 27 Old World were also identified that suggested multiple introductions underpinned their rapid global spread. We 28 identified in Asian FAW individuals, genomes lacking evidence of admixture; while analysis of identified complex 29 substructure revealed significant directional geneflow from Asia into East Africa, in contrast to a simple east-to-30 west spread. Our study highlights the need for population genomics approaches in analysing complex pest 31 invasions, and the importance of international partnership to address global biosecurity challenges presented 32 by emerging high priority insect pests. 33 34 35 36
Published: 2020

50. Application of high-end sequencing technologies

Author: Nam, Ki Woong, Diversité, Génomes & Interactions Microorganismes - Insectes [Montpellier] (DGIMI), and Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)
Subjects: [SDV.BIO]Life Sciences [q-bio]/Biotechnology, ComputingMilieux_MISCELLANEOUS
Abstract: International audience
Published: 2020

Catalog

Books, media, physical & digital resources

See catalog results

Searchworks

Select search scope, currently: Articles Catalog books, media & more in Jio Institute collections Articles journal articles & other e-resources

Search

Search Constraints

Refine your results

Search Limiters

Topic

Publication Year Range

Language

Publication Type

Journal

Region

Database

Publisher

426 results on '"Interactions Microorganismes-Insectes"'

Search Results

Catalog

Select search scope, currently: Articles

Catalog

books, media & more in Jio Institute collections

Articles

journal articles & other e-resources