Search

A 75-year-old woman who was treated with methotrexate (MTX) for rheumatoid arthritis was admitted to our hospital because of fever and loss of appetite. Physical examination revealed exanthems in the upper limbs and systemic lymphadenopathy. Her blood test showed elevated levels of serum lactate dehydrogenase (LDH) and soluble interleukin-2 receptor (sIL-2R). Lymph node biopsy indicated atrophic follicles, interfollicular hyperplasia, and infiltration of macrophages phagocytosing nuclear debris and T-lymphocytes. This suggested lymphadenitis associated with viral infection. Human herpesvirus 7 (HHV-7) DNA was detected in the lymphoid tissue using polymerase chain reaction. The patient was successfully treated with MTX discontinuation and short-term administration of dexamethasone. Her symptoms improved, and LDH and sIL-2R levels were normalized. Human herpesvirus reactivates in patients with immunodeficiency on MTX administration. To the best of our knowledge, this is a valuable case of lymphadenitis considered to have been caused by HHV-7.

Background Human herpesvirus 7 (HHV-7) is a common virus that infects children early and is accompanied by lifelong latency in cells, which is easy to reactivate in immunodeficient adults, but the underlying pathological mechanism is uncertain in immunocompetent adults without peculiar past medical history. Even though the clinical manifestation of the encephalitis caused by HHV-7 is uncommon in immunocompetent adults, the HHV-7 infection should not be neglected for encephalitis for unknown reasons. Case presentation We reported here a case of HHV-7 encephalitis with epileptic seizures. While the brain computer tomography was standard, electroencephalography displayed slow waves in the temporal and bilateral frontal areas, then HHV-7 DNA was detected in the metagenomic next-generation sequencing of cerebrospinal fluid. Fortunately, the patient recovered after treatment and was discharged 2 months later. We also collected the related cases and explored a better way to illuminate the underlying mechanism. Conclusion The case indicates clinicians should memorize HHV-7 as an unusual etiology of encephalitis to make an early diagnosis and therapy.

A PCR assay has been developed to identify the DNA of the human herpes virus type 7. The search and selection of conserved regions was carried out by comparing the whole genome nucleotide sequences of HHV-7. A fragment duplicated in the HHV-7 genomes was chosen as a target for amplification. The performance of the assay was tested on a synthetic matrix and clinical samples. The developed assay has high sensitivity and specificity and showed good efficiency in detecting HHV-7 DNA in clinical samples.

Background Certain clinical manifestations of coronavirus disease (COVID-19) mimic those associated with human herpesvirus (HHV) infection. In this study, we estimated the prevalence of herpesvirus in patients with COVID-19 and determined if coinfection is associated with poorer outcomes and neurological symptoms. Methods We analyzed samples of 53 patients diagnosed with COVID-19. The samples were evaluated for the presence of alphaherpesviruses, betaherpesviruses, and gammaherpesviruses, and the viral loads were quantified using quantitative polymerase chain reaction (qPCR) method. Results Among the patients, in 79.2% had detection at least one type of herpesvirus. HHV-6 (47.2%), cytomegalovirus (43.3%), and HHV-7 (39.6%) showed the highest detection rates. Patients with a high severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) load were more likely to show herpes simplex virus 1 detection (p = 0.037). Among patients coinfected with SARS-CoV-2 and HHVs, 26.4% showed central nervous system-associated neurological symptoms and herpetic manifestations. A statistically significant association was observed between neurological changes and HHV-6 detection (p = 0.034). Conclusions The findings showed a high prevalence of herpesvirus in patients with COVID-19. Furthermore, even though SARS-CoV-2 and HHV coinfection was not associated with poorer outcomes, the findings demonstrated the association between neurological symptoms and HHV-6 detection.

Bell's palsy (BP) represents a major cause leading to facial paralysis in the world. The etiology of BP is still unknown, and virology is the prevailing theory. The purpose of this study is to explore the pathogenic microorganisms that may be related to BP, and it is of great significance to study the pathogenesis and treatment of BP. Metagenomic next-generation sequencing (mNGS) detection was performed in the epineurium of the facial nerve of 30 BP patients who underwent facial nerve epineurium decompression. A total of 84 pathogenic microorganisms were detected in 30 clinical samples, including 4 viruses, 10 fungi, and 70 bacteria. The species with the highest detection frequency in virus was human betaherpesvirus 7 (HHV-7). The species with the highest detection frequency in Fungi was Malassezia restricta. The species with the highest detection frequency in Bacteria was Pseudomonas aeruginosa. In this study, mNGS method was firstly used to detect the pathogenic microorganisms in the epineurium of the facial nerve with BP patients. We have for the first time identified HHV-7 and aspergillus in the epineurium of the facial nerve of BP patients. These results suggest that these two pathogenic microorganisms should be considered in the pathogenesis of BP.

Background Human herpesviruses (HHVs) are responsible for a significant number of clinical manifestations in systemic lupus erythematous (SLE) patients. The aim of this study was to determine the frequency of active HHV infections in SLE patients and correlating them with disease activity. Methods Serum samples were collected from 71 SLE patients and their DNAs were extracted and analyzed to detect HHV-DNA viruses using the nucleic acid amplification technique. Results Fifteen out of the 71 (21.1%) patients tested positive for the HHV-DNA virus. Of them, 11/15 HHV-DNA-positive patients (73.3%) had SLE activity index (SLEDAI – Systemic Lupus Erythematosus Disease Activity Index) ≥8 (p = 0.0001). Active HCMV infection was the mostly frequently observed infection, occurring in 6/15 patients (40%). The frequencies of other active viral infections were 22% for HSV-1, 16.7% for HHV-7, and 5.5% for HSV-2. Viral coinfection (two or more viruses detected in the same sample) occurred in three patients (16.7%). Active HHV infections in SLE patients are more frequent in those with active SLE (≥8), who is at high risk of HHV reactivation and HCMV disease. Conclusion Viral surveillance is important to identify active HHV infections that can cause clinical symptoms and other complication in SLE patients.

A new original domestic set of reagents has been developed for the determination of class G immunoglobulins to individual human herpes virus antigens of type 7 by the method of immune blotting in the “Western-blot” format. Preliminary clinical trials were conducted using 134 serums of healthy children aged 1-16 years who underwent diagnostic testing. Study of diagnostic efficiency of the new kit showed high sensitivity, comparable to the sensitivity of the reaction indirect immunofluorescence and high specificity, which is manifested in the absence of false positive results when testing samples containing immunoglobulin G to herpes virus 6 type.

Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a multifactorial disorder with many possible triggers. Human herpesvirus (HHV)–6 and HHV-7 are two infectious triggers for which evidence has been growing. To understand possible causative role of HHV-6 in ME/CFS, metabolic and antiviral phenotypes of U2-OS cells were studied with and without chromosomally integrated HHV-6 and with or without virus reactivation using the histone deacetylase inhibitor trichostatin-A. Proteomic analysis was conducted by pulsed stable isotope labeling by amino acids in cell culture analysis. Antiviral properties that were induced by HHV-6 transactivation were studied in virus-naive A549 cells challenged by infection with influenza-A (H1N1) or HSV-1. Mitochondria were fragmented and 1-carbon metabolism, dUTPase, and thymidylate synthase were strongly induced by HHV-6 reactivation, whereas superoxide dismutase 2 and proteins required for mitochondrial oxidation of fatty acid, amino acid, and glucose metabolism, including pyruvate dehydrogenase, were strongly inhibited. Adoptive transfer of U2-OS cell supernatants after reactivation of HHV-6A led to an antiviral state in A549 cells that prevented superinfection with influenza-A and HSV-1. Adoptive transfer of serum from 10 patients with ME/CFS produced a similar fragmentation of mitochondria and the associated antiviral state in the A549 cell assay. In conclusion, HHV-6 reactivation in ME/CFS patients activates a multisystem, proinflammatory, cell danger response that protects against certain RNA and DNA virus infections but comes at the cost of mitochondrial fragmentation and severely compromised energy metabolism.

This study was performed to characterise oral shedding of herpesviruses in patients who underwent allogeneic hematopoietic stem cell transplantation (alloHSCT) and to investigate its relationship with oral mucositis (OM). PCR and enzymatic digestion were conducted to identify oral shedding of herpesviruses and its correlation with OM development in 31 patients. The samples were collected at three sites in the oral cavity and at 5 times during follow-up; two additional collections were made from patients who developed ulcerative OM. HSV-1, EBV, CMV, HHV-6A, HHV-6B, and HHV-7 were detected in 4.97%, 16.02%, 4.41%, 2.20%, 3.31%, and 68% of the oral mucosal samples, respectively; 4.41%, 16.57%, 5.52%, 2.20%, 5.52%, and 63.53% of supragingival samples, respectively, and 4.41%, 18.23%, 2.76%, 1.65%, 2.75%, and 35.91% of subgingival samples, respectively. OM was diagnosed in 13 patients. The presence of HHV-7 in C1 (oral mucosa: p = 0.032) and C2 (supragingival: p = 0.009; subgingival: p = 0.002) was significantly increased in patients who developed OM, and patients exhibiting HHV-7 shedding in the oral cavity were 3.32-fold more likely to develop OM. Patients who developed OM showed higher HHV-7 shedding in the oral cavity at nadir (immediately prior to OM development), suggesting modifications to the inflammatory microenvironment. HHV-7 may be involved in oral dysbiosis in HSCT-related OM; enhanced understanding of its role in the pathogenesis of OM may lead to the development of strategies for managing and preventing this common side effect of alloHSCT.

Reactivation of Betaherpesvirinae (Human herpesvirus 6A: HHV-6A, -6B, HHV-7) may be associated with mental illness and host fatigue. This study aimed to determine whether viral reactivation, measured by monitoring salivary viral DNA load, can be used to monitor depression in pregnant and postpartum women. Saliva samples were collected from 64 pregnant women at five points of observation periods. The HHV-6- and HHV-7-specific qPCRs were carried out to measure viral DNA load. When HHV-6 DNA was detected in saliva, nested PCR was used to discriminate between HHV-6A and -6B. In both viruses, a significant correlation was observed between detection frequency and viral DNA load in saliva. In the low-shedding group, HHV-6 DNA was significantly higher in the third trimester (p 0.0001), the time of delivery (p = 0.0003), 1 month after birth (p = 0.0023) compared with the first trimester, and HHV-7 was at the time of delivery (p = 0.0277) and 1 month after birth (p = 0.0235). Most of the detected HHV-6 DNAs in saliva were HHV-6B. Both viral DNA loads were significantly lower (HHV-6: p = 0.0101, HHV-7: p = 0.0044) in the subjects with abnormal Edinburgh Postnatal Depression Scale (EPDS) scores. The detection rate and viral DNA load of both viruses in saliva increased after the third trimester. Salivary virus DNA shedding was significantly lower in subjects with an abnormal EPDS score.

Human roseolovirus U20 and U21 are type I membrane glycoproteins that have been implicated in immune evasion by interfering with recognition of classical and non-classical MHC proteins. U20 and U21 are predicted to be type I glycoproteins with extracytosolic immunoglobulin-like domains, but detailed structural information is lacking. AlphaFold and RoseTTAfold are next generation machine-learning-based prediction engines that recently have revolutionized the field of computational three-dimensional protein structure prediction. Here, we review the structural biology of viral immunoevasins and the current status of computational structure prediction algorithms. We use these computational tools to generate structural models for U20 and U21 proteins, which are predicted to adopt MHC-Ia-like folds with closed MHC platforms and immunoglobulin-like domains. We evaluate these structural models and place them within current understanding of the structural basis for viral immune evasion of T cell and natural killer cell recognition.

This study aimed to compare the efficacy of valaciclovir, valganciclovir, and artesunate in treating chronic reactivated human herpesvirus type 6 (HHV-6) and human herpesvirus type 7 (HHV-7) infection associated with myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS). From 255 patients (192 cases) with reactivated HHV-6 and HHV-7 infections (confirmed based on blood leukocyte PCR), valaciclovir, valganciclovir, or artesunate was administered at a dose of 3000, 900, and 100 mg/day, respectively, for 3 months (study group). The control group consisted of similar patients with ME/CFS (n = 63) not taking any antiviral drugs. The significance of differences was evaluated by Student's t-test and the nonparametric criterion-the number of Z-signs. Negative PCR results in patients with HHV-6 and HHV-7 treated with valaciclovir was achieved in 26% and 23% (first month), 34%, and 28% (second month), 37% and 34% of cases (third month), respectively (P 0.05; Z Z

Primary HHV7 infection is almost ubiquitous, and it can present as exanthema subitem. Little is known on the clinical relevance of HHV7 neuroinvasion in immunocompetent children.We describe 12 patients (median age 9.45 years, 50% males) with acute encephalopathy and active HHV7 infection. In all patients, HHV7-DNA was detected on cerebrospinal fluid (CSF) by RT-PCR.7/12 patients had meningoencephalitis (two with ADEM and one with MOG antibody-associated CIS); 5/12 showed acute neuropsychiatric symptoms. EEG showed anomalies exclusively in patients with meningoencephalitis. Six patients had RMN anomalies. CSF HHV7 copies ranged between 20 and 3,500 copies/mL (median 66 copies/mL) and mean HHV7 CSF/blood ratio was 0.75. Outcome was favorable in all children, although 3/12 had minor neurobehavioral sequelae. Mean follow-up period of 5.2 months.HHV7 can determine neuroinvasion in immunocompetent children, leading to acute encephalopathy. Blood-brain barrier damage and high CSF/blood viral copies ratio correlated with a more severe presentation. We speculate on the importance of immune-mediated mechanisms in provoking clinical features.

Cell–cell fusion is a fundamental and complex process that occurs during reproduction, organ and tissue growth, cancer metastasis, immune response, and infection. All enveloped viruses express one or more proteins that drive the fusion of the viral envelope with cellular membranes. The same proteins can mediate the fusion of the plasma membranes of adjacent cells, leading to the formation of multinucleated syncytia. While cell–cell fusion triggered by alpha- and gammaherpesviruses is well-studied, much less is known about the fusogenic potential of betaherpesviruses such as human cytomegalovirus (HCMV) and human herpesviruses 6 and 7 (HHV-6 and HHV-7). These are slow-growing viruses that are highly prevalent in the human population and associated with several diseases, particularly in individuals with an immature or impaired immune system such as fetuses and transplant recipients. While HHV-6 and HHV-7 are strictly lymphotropic, HCMV infects a very broad range of cell types including epithelial, endothelial, mesenchymal, and myeloid cells. Syncytia have been observed occasionally for all three betaherpesviruses, both during in vitro and in vivo infection. Since cell–cell fusion may allow efficient spread to neighboring cells without exposure to neutralizing antibodies and other host immune factors, viral-induced syncytia may be important for viral dissemination, long-term persistence, and pathogenicity. In this review, we provide an overview of the viral and cellular factors and mechanisms identified so far in the process of cell–cell fusion induced by betaherpesviruses and discuss the possible consequences for cellular dysfunction and pathogenesis.

The causes that trigger the onset of dementia are still unknown. Recently there has been an increasing interest in the possible role of infectious agents in the brain in the pathogenesis of this condition. Amongst the viruses, members of the Herpesviridae family, namely herpes simplex virus-1 (HSV1), cytomegalovirus (CMV), human herpesvirus-6 (HHV6), human herpesvirus-7 (HHV7) and varicella zoster virus (VZV) have been suggested as potential causes of the disease. However, the relative importance of these and other viruses in contributing to dementia remains unclear. We evaluated the association between seropositivity status of all viruses available in a large, population-based dataset (the UK Biobank) and dementia risk in an unbiased way. Of the 15 viruses investigated, our results showed a statistically significant increase of dementia risk associated only with HSV1 seropositivity (OR 2.14, 95% C.I. 1.21–3.81). However, by combining the data we found that seropositivity for 4 viruses (HSV1, HHV6, HHV7 and VZV) also significantly increases the risk of dementia (OR = 2.37, 95% C.I. 1.43–3.92). These four viruses have been described previously as neurotropic viruses. Our results provide support for a role for neurotropic viruses in the pathology of dementia.

Pityriasis rosea (PR) has been manifested in patients suffering from COVID‐19 as well as after vaccine protocols against SARS‐CoV‐2. It has a possible association with the HHV‐6B virus (roseola infantum) and can be controlled by antivirals such as acyclovir as well as by the amino acid l‐Lysine that showed a positive result in reducing the number of lesions and healing time. The aim of this study was to report a case of PR after a second dose of Oxford‐AstraZeneca, the adopted therapy and a brief literature review. A 53‐year‐old woman, phototype II, presented an erythematous lesion in the posterior right thigh 15 days after the second dose of Oxford‐AstraZeneca vaccine. Eight days after the initial injury, new injuries appeared in the calf, buttocks and thighs. The diagnosis was PR with a 5‐week eruption cycle. The treatment consisted of the use of l‐Lysine, 3 grams loading dose and 500 mg for 30 days and moisturizing/healing lotion, starting 14 days after the herald patch. After the 5th week of the disease cycle, there were no new eruptions and the repair cycle continued for up to 8 weeks leaving some residual skin spots. It is concluded that the patient may be a carrier a latent virus, HHV‐6, and the vaccine administration with immune system stimulation, would have activated the possible virus causing PR. l‐Lysine helped to control the manifestation by limiting the number of lesions and their location, which were restricted to the legs, thighs and buttocks.

During local small measles outbreak in Japan, 3 adolescents with febrile skin rash suspected as having measles were diagnosed with primary human herpesvirus (HHV)-7 infection. Primary HHV-7 infection can cause exanthem subitum in not only young children but also adolescents. HHV-7 should be considered as a possible causative agent for adolescent febrile skin rash during the measles outbreak.

HHV-7 (Human Herpes virus type 7) is a relatively recently discovered, ubiquitous beta herpes virus. In Russia, the diagnosis of HHV-7 infection is carried out by PCR, which determines the DNA in serum or plasma, if there are clinical indications. Laboratory serological tests for HHV-7 are not performed. Currently, in the scientific literature, information on clinical studies of HHV-7 infection, its epidemiology, and its role in the etiopathogenesis of various diseases is insufficient. This article presents the results of the development of a test kit “ELISA-HHV-7-IgG”, designed to detect specific IgG to HHV-7 by enzyme-linked immunosorbent assay (ELISA). Studies of the sensitivity and specificity of the developed test kit, including potential cross-reactive samples positive for other herpesvirus infections, were carried out. In the context of serological diagnostics, we studied samples of the sera of children (n = 167) and old people (n = 238) for the presence of IgG to HHV-7 with confirmation of the results in the indirect immunofluorescence reaction and the immune blotting reaction. The research results are evidence of the possibility of using the developed test kit for serological diagnosis of HHV-7 infection.

Like all herpesviruses, the roseoloviruses (HHV6A, -6B, and -7) establish lifelong infection within their host, requiring these viruses to evade host antiviral responses. One common host-evasion strategy is the downregulation of host-encoded, surface-expressed glycoproteins. Roseoloviruses have been shown to evade the host immune response by downregulating NK-activating ligands, class I MHC, and the TCR/CD3 complex. To more globally identify glycoproteins that are differentially expressed on the surface of HHV6A-infected cells, we performed cell surface capture of N-linked glycoproteins present on the surface of T cells infected with HHV6A, and compared these to proteins present on the surface of uninfected T cells. We found that the protein tyrosine phosphatase CD45 is downregulated in T cells infected with HHV6A. We also demonstrated that CD45 is similarly downregulated in cells infected with HHV7. CD45 is essential for signaling through the T cell receptor and, as such, is necessary for developing a fully functional immune response. Interestingly, the closely related betaherpesviruses human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV) have also separately evolved unique mechanisms to target CD45. While HCMV and MCMV target CD45 signaling and trafficking, HHV6A acts to downregulate CD45 transcripts. IMPORTANCE Human herpesviruses-6 and -7 infect essentially 100% of the world's population before the age of 5 and then remain latent or persistent in their host throughout life. As such, these viruses are among the most pervasive and stealthy of all viruses. Host immune cells rely on the presence of surface-expressed proteins to identify and target virus-infected cells. Here, we investigated the changes that occur to proteins expressed on the cell surface of T cells after infection with human herpesvirus-6A. We discovered that HHV-6A infection results in a reduction of CD45 on the surface of infected T cells and impaired activation in response to T cell receptor stimulation.

In the last 10 years, an increased number of patients presenting with acute encephalitis is being observed, a finding that is attributed to autoimmune mechanisms. Despite the fact that autoantibodies usually target the neuronal cell surface or synaptic proteins in the central nervous system (CNS), in many cases these remain undetectable, constituting a future diagnostic and therapeutic challenge. Human herpesvirus-7 (HHV-7) is proven to be a neurotropic virus, causing various neurological complications mostly in the adult population. We present the case of a 10-year-old girl, with confirmed active HHV-7 infection of the CNS, who developed acute seronegative autoimmune encephalitis. To our best knowledge, there is no literature concerning pediatric cases of autoimmune encephalitis following HHV-7 infection.

Pityriasis rosea (PR) is a dermatological disease with an erythemato-papulosquamous manifestation, distributed on the trunk and extremities affecting healthy people, especially children and young people between 10 and 35 years of age. The evolution is 6 to 8 weeks and may remain for 3 to 6 months. It regresses spontaneously and can leave changes in the skin color but reversibly. Acyclovir is indicated to minimize clinical manifestations with the suspected of viral association (HHV-6 and 7). Another group of the human herpesvirus family (HHV-1 and 2), causes herpes simplex that is controlled with the antivirals, including acyclovir, as well as the amino acid L-lysine, both showing positive and similar results in reducing the number of annual manifestations and the healing time of the lesions. The aim of this study is to report a case of PR in a child, to review the literature on the etiopathogenesis of the disease and on the effects of L-lysine as well as another amino acid in the treatment. An 11-year-old girl, phototype II, presented lesions diagnosed as PR. The cycle would be 6 to 8 weeks on average. A solution of L-lysine was prescribed for 30 days, on an empty stomach. After the fourth day of therapy, the cycle of new eruptions was interrupted, initial lesions regressed, accelerating the repair of larger lesions resulting in an improvement of the clinical condition. We concluded that the administration of L-lysine, in therapeutic doses, can be a safe alternative for the PR control.

Background In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. Methods The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. Results The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. Conclusion With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Pityriasis rosea (PR) is an exanthematous disease whose etiology is related to reactivation of herpes human herpesviruses 6 (HHV-6) and 7 (HHV-7). We observed two cases of PR arising during omalizumab therapy for chronic spontaneous urticaria (CSU). Here we report for the first time PR occurring during omalizumab treatment. After PR diagnosis, viral serology was performed. Data in literature about omalizumab mechanism of action, PR and HHV-6/7 infection were analyzed in order to identify possible correlations. In both our cases IgM against HHV-6 and HHV-7 were negative. The first patient presented altered IgG titers for both viruses (1:160 and 1:80, respectively) while only HHV-6 IgG (1:320) were detected in the second patient. From data in literature, we consider it presumable that apoptotic immune cells due to omalizumab immunomodulation could release viral proteins produced from integrated DNA. This could elicit cutaneous cross-reactivity and PR onset. In conclusion, we think there is a link between omalizumab therapy and PR occurring in patients with CSU. Our case history is too small to draw firm conclusions. Data collection of similar cases could be helpful to improve our knowledge.

A direct association between joint inflammation and the progression of osteoarthritis (OA) has been proposed, and synovitis is considered a powerful driver of the disease. Among infections implicated in the development of joint disease, human herpesvirus 7 (HHV-7) infection remains poorly characterized. Therefore, we assessed synovitis in OA patients, determined the occurrence and distribution of the HHV-7 antigen within the synovial membrane of OA-affected subjects, and correlated plasma levels of the pro-inflammatory cytokines tumor necrosis factor (TNF), interleukin-6 (IL-6), and TNF expressed locally within lesioned synovial tissues with HHV-7 observations, suggesting differences in persistent latent and active infection. Synovial HHV-7, CD4, CD68, and TNF antigens were detected immunohistochemically. The plasma levels of TNF and IL-6 were measured by an enzyme-linked immunosorbent assay. Our findings confirm the presence of persistent HHV-7 infection in 81.5% and reactivation in 20.5% of patients. In 35.2% of patients, virus-specific DNA was extracted from synovial membrane tissue samples. We evidenced the absence of histopathologically detectable synovitis and low-grade changes in the majority of OA patients enrolled in the study, in both HHV-7 PCR+ and HHV-7 PCR‒ groups. The number of synovial CD4-positive cells in the HHV-7 polymerase chain reaction (PCR)+ group was significantly higher than that in the HHV-7 PCR‒ group. CD4- and CD68-positive cells were differently distributed in both HHV-7 PCR+ and HHV-7 PCR‒ groups, as well as in latent and active HHV-7 infection. The number of TNF+ and HHV-7+ lymphocytes, as well as HHV-7+ vascular endothelial cells, was strongly correlated. Vascular endothelial cells, especially in the case of infection reactivation, appeared vulnerable. The balance between virus latency and reactivation is a long-term relationship between the host and infectious agent, and the immune system appears to be involved in displaying overreaction when a shift in the established equilibrium develops.

Stevens-Johnson syndrome (SJS)/toxic epidermal necrolysis (TEN) is a life-threatening hypersensitivity reaction. Long-term sequelae include dry eyes, visual impairment and psychological complications. TEN is mostly induced by medication; however, viral infections, such as coxsackievirus A6, are known triggers of this disease. However, how to define the role of infection in SJS/TEN is still a problem. Most patients develop SJS/TEN over the course of symptoms of the infection first, and then take medication. Therefore, virus culture and nucleic acid detection at the acute stage cannot predict that the virus itself will indeed produce such a serious reaction. Furthermore, many SJS/TEN patients who are diagnosed with an infection are afraid of receiving the drug rechallenge test. Thus, we report the first case worldwide of a patient who suffered from TEN caused by herpesvirus 7 infection, which was confirmed by both real-time polymerase chain reaction and lymphocyte transformation test.

INTRODUCTION: Human herpesvirus (HHV)-7 establishes a latent infection during the lifetime of the host and can reactivate after the primary infection, leading to lytic replication in immunosuppressed patients. METHODS: This study aimed to develop an enzyme-linked immunosorbent assay (ELISA) to identify HHV-7 serum antibodies and compare its performance with that of an indirect immunofluorescence assay (IFA). RESULTS: Serum samples (n=102) were tested by IgG-IFA and by ELISA. IFA and ELISA showed IgG-positive results in 77 and 73 samples, respectively. Qualitative concordance of 96% was demonstrated between the two techniques. CONCLUSIONS: ELISA may be useful to diagnose HHV-7 infection.

The idea that infectious agents in the brain have a role in the pathogenesis of Alzheimer disease (AD) was proposed nearly 30 years ago. However, this theory failed to gain substantial traction and was largely disregarded by the AD research community for many years. Several recent discoveries have reignited interest in the infectious theory of AD, culminating in a debate on the topic at the Alzheimer's Association International Conference (AAIC) in July 2019. In this Viewpoint article, experts who participated in the AAIC debate weigh up the evidence for and against the infectious theory of AD and suggest avenues for future research and drug development.

Acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) is a recently described entity so far exclusively in East Asian children. AESD diagnosis is based on clinicoradiologic criteria, often without pleocytic CSF and characterized by hyperglycemia and transaminasemia. Here, we present the first case of human herpesvirus 7-related AESD in an immunocompetent child >2 years old and of Caucasian origin.

Objectives: Kawasaki disease (KD) is one of the most common childhood vasculitides. Some serological studies have suggested an etiological relationship between KD and human herpesvirus (HHV)-6 or HHV-7. However, primary or reactivated HHV-6 and -7 has not been fully investigated in patients with KD. Methods: Twenty-three patients with KD were prospectively enrolled in this study. Peripheral blood was collected in the acute and convalescence phases, and HHV-6 and -7 viral loads were measured by real-time PCR. Results: In the acute phase, HHV-6 and -7 DNA was detected in 7 (30%) patients each, compared to 13 (57%) and 9 (39%) patients in the convalescence phase, respectively. HHV-6 and -7 DNA loads were significantly higher in the convalescence phase than in the acute phase. Significant increases in HHV-6 and -7 DNA loads were not observed in disease control patients. Taking into account HHV-6 and -7 serostatus, reactivation of HHV-6 and -7 was observed in 7 and 9 patients, respectively. KD patients with HHV-6 reactivation showed higher C-reactive protein levels and more frequently required steroid therapies than patients without reactivation. Conclusion: HHV-6 and -7 reactivation is frequent in KD patients. HHV-6 reactivation might exacerbate the severity of KD., Published online: 05 Sep 2018

The human herpesvirus-7 (HHV-7) U21 glycoprotein binds to class I major histocompatibility complex (MHC) molecules in the endoplasmic reticulum (ER) and reroutes them to lysosomes. How this single viral glycoprotein efficiently redirects the U21/class I MHC complex to the lysosomal compartment is poorly understood. To investigate the trafficking of HHV-7 U21, we followed synchronous release of U21 from the ER as it traffics through the secretory system. Sorting of integral membrane proteins from the trans-Golgi network (TGN) has been shown to occur through tubular carriers that emanate from the TGN or through vesicular carriers that recruit GGA (Golgi-localized, γ-ear-containing, ARF-binding protein), clathrin adaptors, and clathrin. Here, we present evidence for the existence of a third type of Golgi-derived carrier that is vesicular, yet clathrin independent. This U21-containing carrier also carries a Golgi membrane protein engineered to form inducible oligomers. We propose that U21 employs the novel mechanism of forming oligomeric complexes with class I MHC molecules that result in sorting of the oligomeric U21/class I MHC complexes to Golgi--derived quality control carriers destined for lysosomes.

Background Acute encephalitis/encephalopathy (AE/E) is a rare and severe complication of common childhood infections; however, a treatment strategy based on clinical and pathological evidence has not been established. Methods The clinical data and aetiological results using a rapid and comprehensive virological detection system of 62 Japanese children diagnosed with AE/E from 2010 to 2014 were collected. We assessed clinical differences between causes and effectiveness of our multiplex PCR system to establish a pathogen-based treatment strategy for AE/E. Results Suspected causes were detected in 84% of patients, and our multiplex PCR system contributed to diagnosing 38% of the patients. Furthermore, a negative virus PCR might be important for inferring underlying disease. Most cases were triggered by human herpes virus (HHV) 6/7 (32%) and influenza virus (24%). The causes of AE/E depended on age (p = 0.00089) but not on sex (p = 0.94). The median age of HHV6/7-associated AE/E was 2.3 years, which is lower than the median ages of AE/E associated with other viruses. Major initial treatments were pulse steroid therapy (83.9%) and acyclovir (71%). Most of the patients in this study had good prognoses: 77% recovered without neurological sequalae. Conclusions Our virological detection system was useful for detecting the cause of AE/E, and may also contribute to construction of pathogen-based treatment strategies for AE/E. Our data indicated the possibility that early intervention with pulse steroid therapy could be effective for treating AE/E. Further investigation for selection of antiepileptic drugs and additional therapies might be required to prevent progression of AE/E.

Background: Pityriasis rosea (PR) is a self-limiting exanthematous disease associated with human herpesvirus (HHV)-6 and/or HHV-7 reactivation. In pregnant women, PR may be associated with pregnancy complications. Objective: To determine relevant risk factors in the development of negative pregnancy outcome in PR. Methods: Between 2005 and 2017 at the Department of Dermatology, University of Genoa, we recruited 76 women who developed PR during pregnancy. In 60 patients without known risk factors for intrauterine fetal death (30 with pregnancy complications and 30 without) we analyzed the pregnancy week of PR onset, presence of enanthem and of constitutional symptoms, PR body surface area involvement, age, and in 50 patients (20 with pregnancy complications and 30 without), the viral load of HHV-6 and HHV-7 (copies/mL). Results: In logistic regression analysis, early onset of PR (p = 0.0017) and enanthem (p = 0.0392) proved to be significantly associated with pregnancy complications. HHV-6 viral load (copies/mL) (p < 0.0001), constitutional symptoms (p < 0.001), and PR body surface area involvement (p < 0.004) were also significantly associated with pregnancy complications. Conclusion: The onset of PR before week 15 and enanthem may be considered major risk factors that should alarm the dermatologist. Constitutional symptoms and involvement of > 50% of the body area may be considered minor risk factors.