Search

The Late Triassic igneous rocks associated with post-collision are widely distributed in the East Kunlun Orogenic Belt (EKOB), but their specific dynamic mechanism and evolutional process are still controversial. To address these key issues, we investigated the geochronology and geochemistry of intermediate–felsic igneous rocks from the EKOB, including trachyandesite, rhyolite, porphyritic monzogranite, syenogranite, granite porphyry and crystalline tuff. Zircon U–Pb isotopes of these rocks indicate that they were formed between 231.1 and 215.8 Ma (i.e. Late Triassic). These igneous rocks have moderate to high SiO2 (60.29–79.56 wt%) and low mantle compatible element contents (e.g. Co: 0.37–12.62 ppm; Ni: 1.55–15.59 ppm), suggesting that continental crustal-derived material played an important role in their formation. Porphyritic monzogranite (231.1 Ma), syenogranite (228.1 Ma), trachyandesite (227.4 Ma) and rhyolite (215.8 Ma) have Nb/U (1.41–4.71) and Ce/Pb (1.48–6.19) ratios like that of the crust, with εHf(t) values (–1.31 to 2.26) and old two-stage model (TDM2) ages of 1340–1119 Ma, suggesting that they originated from the partial melting of a Mesoproterozoic crust with minor mantle material involved in their source. Crystalline tuff (224.6 Ma) and granite porphyry (222.3 Ma) have Nb/U (1.93–3.81) and Ce/Pb (0.30–3.18) ratios, negative εHf(t) values (–7.04 to −5.12) and old TDM2 ages (1703–1581 Ma) closer to those of crust, suggesting that they were derived from the partial melting of a Paleo–Mesoproterozoic continental crust without addition of mantle material. Based on our new data and published data, the Late Triassic igneous rocks from the EKOB can be divided into three stages, 236–227, 226–218 and 216–208 Ma, corresponding to slab break-off, lithospheric mantle delamination and thickened lower crust delamination, respectively. The intermediate–felsic igneous rocks from the East Kunlun Orogenic Belt are dated from 231.1 to 215.8 Ma (i.e. Late Triassic). These igneous rocks were derived from the partial melting of ancient continental crust. The Late Triassic igneous rocks from the East Kunlun Orogenic Belt can be divided into three stages, including slab break-off, lithospheric mantle delamination and thickened lower crust delamination. [ABSTRACT FROM AUTHOR]

Genetic engineering is commonly used to improve the agronomic traits of crops. However, genetic transformation in pumpkin remains a challenge. Conducting transformation trials, we accidentally created transgenic L1 periclinal chimeras in pumpkins.Using our modified Agrobacterium‐mediated transformation, we generated transgenic L1 periclinal chimeras which have high value in research on development of the meristem.Fluorescence observations of transformed L1 cells enabled us to reveal cell fates. These L1 cells can develop into stomata, epidermal hairs, seed coat, and epidermis of the root, stem, leaf, flower, and fruit. These periclinal chimeras can be propagated vegetatively with minimal risk of transgene flow.This study offers new perspectives on development of the meristem and a promising technique for creating transgenic periclinal chimeras in plants. [ABSTRACT FROM AUTHOR]

Physiological changes during pregnancy can affect the results of renal function tests (RFTs). In this population-based cohort study, we aimed to establish trimester-specific reference intervals (RIs) of RFTs in singleton and twin pregnancies and systematically investigate the relationship between RFTs and adverse pregnancy outcomes. The laboratory results of the first- and third-trimester RFTs, including blood urea nitrogen (BUN), serum uric acid (UA), creatinine (Crea) and cystatin C (Cys C), and the relevant medical records, were retrieved from 29,328 singleton and 840 twin pregnant women who underwent antenatal examinations from November 20, 2017 to January 31, 2021. The trimester-specific RIs of RFTs were estimated with both of the direct observational and the indirect Hoffmann methods. The associations between RTFs and pregnancy complications as well as perinatal outcomes were assessed by logistic regression analysis. Maternal RFTs showed no significant difference between the direct RIs established with healthy pregnant women and the calculated RIs derived from the Hoffmann method. In addition, elevated levels of RFTs were associated with increased risks of developing various pregnancy complications and adverse perinatal outcomes. Notably, elevated third-trimester RFTs posed strong risks of preterm birth (PTB) and fetal growth restriction (FGR). We established the trimester-specific RIs of RFTs in both singleton and twin pregnancies. Our risk analysis findings underscored the importance of RFTs in identifying women at high risks of developing adverse complications or outcomes during pregnancy. [ABSTRACT FROM AUTHOR]

We propose an efficient scheme for realizing the 1 → n orbital state quantum cloning by using Rydberg superatoms. We place an ultracold Rydberg atomic ensemble which contains n individual ladder type Rydberg atoms inside the blocking ball to form a superatom, the quantum information is encoded the effective energy levels of superatom. Combined with quantum Zeno dynamics and shortcuts to adiabaticity, the 1 → 3 orbital state quantum cloning process can be quickly completed. Moreover, we generalize the idea to the case of 1 → n . At last, the influence of decoherence factors on fidelity is considered. The numerical simulation results show that high fidelity can be obtained. [ABSTRACT FROM AUTHOR]

* Context.--Machine learning (ML) allows for the analysis of massive quantities of high-dimensional clinical laboratory data, thereby revealing complex patterns and trends. Thus, ML can potentially improve the efficiency of clinical data interpretation and the practice of laboratory medicine. However, the risks of generating biased or unrepresentative models, which can lead to misleading clinical conclusions or overestimation of the model performance, should be recognized. Objectives.--To discuss the major components for creating ML models, including data collection, data preprocessing, model development, and model evaluation. We also highlight many of the challenges and pitfalls in developing ML models, which could result in misleading clinical impressions or inaccurate model performance, and provide suggestions and guidance on how to circumvent these challenges. Data Sources.--The references for this review were identified through searches of the PubMed database, US Food and Drug Administration white papers and guidelines, conference abstracts, and online preprints. Conclusions.--With the growing interest in developing and implementing ML models in clinical practice, laboratorians and clinicians need to be educated in order to collect sufficiently large and high-quality data, properly report the data set characteristics, and combine data from multiple institutions with proper normalization. They will also need to assess the reasons for missing values, determine the inclusion or exclusion of outliers, and evaluate the completeness of a data set. In addition, they require the necessary knowledge to select a suitable ML model for a specific clinical question and accurately evaluate the performance of the ML model, based on objective criteria. Domain-specific knowledge is critical in the entire workflow of developing ML models. [ABSTRACT FROM AUTHOR]

Underexposure to daylight in windowless factories puts assembly-line workers at risk of health problems. To investigate whether the advance light exposure in the early morning and during the lunch break benefits workers' productivity and night-time sleep, a within-subject experiment was conducted in a factory. Four experimental lighting interventions were provided twice a day before work (8:30–9:00 and 12:00–12:30) for consecutive five workdays, covering two light levels (1440 lx vs. 70 lx), each with two correlated colour temperatures (CCTs) (5300 K vs. 3300 K), plus an additional benchmark dark exposure (4 lx). Participants' subjective alertness and night-time sleep were measured daily, and the chronotype was monitored once a week. Results showed that a higher illuminance was correlated with increased subjective work alertness and higher sleep efficiency, while a lower CCT slightly improved alertness. The subjective work alertness and sleep efficiency under the two advance bright light exposures were higher than those under the dark exposure, and the responses of subjective alertness were more pronounced in the afternoon than those in the morning. Yet, the chronotype had no evident change in different lighting interventions. The present study indicated that the daily advance light exposure before work could have a delayed effect on participants' alertness and sleep quality. [ABSTRACT FROM AUTHOR]

Powdery mildew (PM) is one of the major fungal diseases and can cause severe damage to pumpkin (Cucurbita moschata) crops worldwide. The causative agent of pumpkin PM is Podosphaera xanthii, a biotrophic fungus. To identify PM-related genes in pumpkin seedlings, cDNA representational difference analysis was previously performed using a RNA-seq method. One of the genes cloned from the transcriptome is homologous to pumpkin MYBR1-like gene encoding the R1-type MYB-like transcription factor. Here, we characterized this MYBR1-like homolog (named CmMYB1) from pumpkin and investigated its role in biotic stresses. The expression of CmMYB1 in resistant pumpkin seedlings was dramatically induced by PM spores inoculation at the early infection stage (before 48 h), and was suppressed by exogenously sprayed hydrogen peroxide, hormones treatments (salicylic acid, abscisic acid, methyl jasmonate, ethephon), and salt stress using quantitative RT-PCR. Constitutive overexpression of CmMYB1 in tobacco slightly aggravated the visible mildew symptoms of leaves, H2O2 accumulation and cell necrosis in seedlings inoculated with PM pathogens. Furthermore, the expression of NPR1 and PDF1.2 in the transgenic plants was lower than that in the wild-type plants. On the other hand, following inoculations with bacterial wilt and scab pathogens, the concentrations of bacterial pathogens near the infection sites were higher in the transgenic lines than in the wild-type plants, respectively. In conclusions, overexpression of CmMYB1 in tobacco displayed increased susceptibility to PM, bacterial wilt and scab. CmMYB1 transgenic tobacco may reduce stress resistance by downregulating hormone-mediated defense genes to aggravate the leaf damage caused by PM. CmMYB1 may play negative roles in biotic stresses in tobacco. [ABSTRACT FROM AUTHOR]

The “amplituhedron” for tree-level scattering amplitudes in the bi-adjoint ϕ3 theory is given by the ABHY associahedron in kinematic space, which has been generalized to give a realization for all finite-type cluster algebra polytopes, labelled by Dynkin diagrams. In this letter we identify a simple physical origin for these polytopes, associated with an interesting (1 + 1)-dimensional causal structure in kinematic space, along with solutions to the wave equation in this kinematic “spacetime” with a natural positivity property. The notion of time evolution in this kinematic spacetime can be abstracted away to a certain “walk”, associated with any acyclic quiver, remarkably yielding a finite cluster polytope for the case of Dynkin quivers. The A n−3, B n−1/ C n−1 and D n polytopes are the amplituhedra for n-point tree amplitudes, one-loop tadpole diagrams, and full integrand of one-loop amplitudes. We also introduce a polytope D ¯ n, which chops the D n polytope in half along a symmetry plane, capturing one-loop amplitudes in a more efficient way. [ABSTRACT FROM AUTHOR]

Millimeter wave systems based on powerful gyrotron can deliver megawatt microwave power, which is an important auxiliary heating method for magnetic confinement fusion devices. Reflective gratings are normally used as quasi-optical polarizers for polarization control of the wave in such systems. Based on the coordinate transformation method, we developed a numerical code to study the broadband polarization strategy. By considering the synthesis of two polarizers, we designed a pair of polarizers in the W band. Calculation results indicated that almost arbitrary polarization can be achieved in a wide frequency range. To verify the design, we set up a low-power test platform and experiments were carried out. The performance of the polarizers was tested from 80 to 105 GHz with a step of 5 GHz. The test results agreed well with the numerical results, indicating that the design is reasonable. With the development of multi-frequency gyrotrons, the study in this paper can be used as a reference for the design of broadband polarizers of multi-frequency millimeter wave systems. [ABSTRACT FROM AUTHOR]

Background: Raman spectroscopy has become an effective experimental stress analysis method because of its high spatial resolution, nondestructive and noncontact, etc. However, the stress confidence of single point and single time detection is far from accurate. Especially for the component decoupling analysis of complex stress states, the characterization results of the stress components often have difficulty reflecting the real stress states. Objective: In this paper, based on stress characterization using polarized micro-Raman spectroscopy, we focus on the two main factors that affect the confidence of the Raman spectrum, namely, the frequency shift repeatability of the instrument and the polarization control accuracy. Methods: Through a combination of physical experiments and numerical ones, the influence of random error in the Raman measurement system, initial error and random error in the polarization angle on the decoupling characterization of the stress component is quantitatively analyzed. Results: The results show that due to the existence of various error factors and the influence of polarization angle combinations, the error levels for the characterization results for each stress component are not only difficult to ignore but also the difference is obvious, and the true stress state of the sample surface cannot be accurately analyzed. In particular, the influence of the random error in the polarization angle on the characterization results obtained for the stress component is dominant. Conclusions: Although various experimental error sources are difficult to eliminate, the influence of the above factors on the characterization of stress components can be effectively weakened by improving the experimental design and analysis method. [ABSTRACT FROM AUTHOR]

The study and modelling of material degradation processes, such as the initiation and growth of creep cavities in high-temperature applications, require a correlative and comprehensive knowledge of the microstructure. However, individual microscopy is limited to a small region and specific microstructural information of the specimen. This work demonstrates a novel correlative microscopy approach for characterising creep cavitation and establishing correlations with local microstructural parameters in a statistical manner. This approach combines datasets from stitched higher-resolution backscattered electron (BSE) images, XeF 2 Focused Ion Beam (FIB) images, and backscattered electron diffraction (EBSD) maps with advanced image correlation techniques. Deep-learning image segmentation techniques and statistical analysis are applied to find relations between creep cavitation and local microstructural environment. This approach is demonstrated in a cyclic creep-tested 316H stainless steel specimen with extensive creep cavities. The results show that in this material, strain localization, grain boundary misorientation, and substantial precipitation dominate the nucleation of cavities, whereas other microstructural properties such as grain size and Schmid factor play smaller roles. This study presents the use of the correlative microscopy approach to provide new insights into creep cavitation behaviour and its implications for establishing creep cavitation damage models. • A novel correlative microscopy methodology combining large scale BSE images and EBSD was developed to study creep cavitation. • Microstructural parameters in a crept steel specimen were correlated with creep cavities statistically. • Cavity location significantly correlated with heterogenous strain distribution, grain boundary precipitation, and grain size. [ABSTRACT FROM AUTHOR]

An experimental air-foil printed circuit heat exchanger (PCHE) with CO 2 as a working fluid is numerically modelled and developed within the OpenFOAM environment as a freely available package for more general PCHE designs. The conjugate heat transfer solver (chtMultiRegionFoam) is adapted to include both the hot and cold fluid streams of the PCHE, along with the solid recuperator body, within three uniquely specified overlapping mesh regions. The fluid stream momentum equation is adapted to incorporate porosity, with the additional streamwise air-foil drag (friction factor) accounted for by the Darcy–Forcheimer porous media model. A simple linear ad-hoc model for the transverse friction factor is evaluated to determine the dispersion of the momentum across the flow. Heat transfer between the fluid streams and the solid body is driven by a volumetric thermal resistance with a cell volume-weighted interpolation method (volume-to-volume coupling), with experimentally determined Nusselt number correlations applied. Temperature-dependent parameters based on isobaric NIST data for CO 2 are tabulated as a user library and integrated within the coding package. The model predictions of the solid body temperature distributions are assessed and validated against experimental data with eight equidistant fibre optical measurements across the PCHE core and compared against finite-element-based MATLAB numerical results. Thermal stresses are evaluated and qualitatively evaluated against experimental data, demonstrating the capability of the model to highlight potential design features for improvement. • A coupled thermohydraulic porous media based model is presented for printed circuit heat exchangers (PCHE) with OpenFOAM. • Experimental correlations applied for convective heat transfer with a volume-to-volume coupling, and friction factor correlations applied for momentum source term. • Model validated against thermal data from an airfoil experimental PCHE with CO 2 as working fluids, and cross comparisons with MATLAB numerical results. • User-friendly OpenFOAM coding packaged developed and freely available. [ABSTRACT FROM AUTHOR]

This article discusses concerns and suggestions regarding a study on suicidal ideation and associated risk factors among COVID-19 patients in Wuhan, China. The authors express support for the study but raise some issues with certain details. They suggest that economic problems such as unemployment should be considered as significant factors contributing to increased suicidal ideation and behavior. They also propose that other social factors, such as the stress experienced by caregivers, may play a role in the development of suicidal thoughts. The authors recommend including more information on these aspects to make the results more comprehensive. They also mention the potential overestimation of findings due to the exclusion of patients with serious cognitive impairment and suggest conducting subgroup analyses for different age groups and genders. Additionally, they suggest including information on the increased risk of suicidal ideation and mortality among individuals with diabetes. The authors caution that the study's findings should be interpreted cautiously until these issues are clarified. [Extracted from the article]

Objectives: This review aims to describe the principles underlying different types of inductively coupled plasma mass spectrometry (ICP-MS), and major technical advancements that reduce spectral interferences, as well as their suitability and wide applications in clinical laboratories.Methods: A literature survey was performed to review the technical aspects of ICP-MS, ICP-MS/MS, high-resolution ICP-MS, and their applications in disease diagnosis and monitoring.Results: Compared to the atomic absorption spectrometry and ICP-optical emission spectrometry, ICP-MS has advantages including improved precision, sensitivity and accuracy, wide linear dynamic range, multielement measurement capability, and ability to perform isotopic analysis. Technical advancements, such as collision/reaction cells, triple quadrupole ICP-MS, and sector-field ICP-MS, have been introduced to improve resolving power and reduce interferences. Cases are discussed that highlight the clinical applications of ICP-MS including determination of toxic elements, quantification of nutritional elements, monitoring elemental deficiency in metabolic disease, and multielement analysis.Conclusions: This review provides insight on the strategies of elemental analysis in clinical laboratories and demonstrates current and emerging clinical applications of ICP-MS. [ABSTRACT FROM AUTHOR]

• Siemens Centaur hs-cTnI assay provided more values above LOQ than the contemporary assay. • Using the hs-cTnI assay did not increase the incidence of elevated troponin above URLs. • There is proportional bias between the hs-cTnI and the contemporary assays. • Analytical comparisons between the two assays were consistent in two hospitals. This study aimed to compare the incidence of cardiac troponin I (cTnI) concentrations above the limit of quantification (LOQ) and the sex-specific 99th percentile upper reference limits (URLs) between the Ultra contemporary cTnI assay and the high-sensitivity (hs-cTnI) assay on Siemens Centaur in patients evaluated in the emergency department (ED) and inpatient at a U.S. urban academic hospital. A retrospective study was performed in an unselected patient cohort who presented to the hospital with symptoms suggestive of myocardial injury. All clinically ordered samples for cTnI assay (n = 1,056, LOQ 0.03 µg/L, URL 0.04 µg/L) were simultaneously tested on the hs-cTnI assay (LOQ 2.5 ng/L; URL 58 ng/L and 39 ng/L for male and female, respectively). The incidence of elevated cTnI above the 99th percentile URL in males measured by the hs-cTnI assay was significantly lower compared to the cTnI assay (31.4% vs. 38.7%, p = 0.016), whereas there was no difference in females (27.4% vs. 30.2%, p = 0.35) in all the patient samples. In ED patient samples (n = 718), the incidence of elevated cTnI above the sex-specific 99th percentile URL was not significantly different between the hs-cTnI and contemporary cTnI assays in either sex (male: hs-cTnI 16.6% vs. cTnI 21.5%, p = 0.13; female: hs-cTnI 19.6% vs. cTnI 21.1%, p = 0.66). The agreement between the two assays was 93.5% (kappa = 0.798). Results were confirmed in an independent patient cohort measured by the same instruments at another hospital. Our study suggests that implementation of the hs-cTnI assay would not lead to an increase in the proportion of elevated cTnI above the 99th percentile in the emergency department and other inpatient units. [ABSTRACT FROM AUTHOR]

This work aimed to investigate WG (WG)–related knowledge, attitudes, practices (KAPs) and factors affecting WG consumption among college students in Chongqing, China. A cross-sectional study was performed among 2500 students from six universities using a self-administered questionnaire. The chi-squared test and binary logistic regression were used for data analysis. Only 14.7% of the participants were aware of WG, 57.1% supported the consumption of WG, and only 8.5% consumed WG regularly in the last month. Participants with poor knowledge of WG were about 2 times more likely to not concern about chronic diseases (CDs) than concern about CDs (odds ratio [OR] = 2.241, 95% confidence interval [CI], 1.030–4.877). Women were less likely to have a poor attitude to WG compared with men (OR = 0.682, 95% CI, 0.529–0.878), whereas women were more likely to have a poor WG practice (OR = 2.335, 95% CI, 1.327–4.111). Although results showed low levels of WG knowledge and practices, this study still supports positive attitudes to acquire WG–related knowledge among college students in Chongqing, China. • Performing a cross-sectional study among 2500 students from six universities using a self-administered questionnaire. • College students have low levels of WG knowledge and practice. • College students hold positive attitudes to acquire WG-related knowledge. • The awareness rate of WG among 2500 college students was only 14.7%. • Factors of WG knowledge, attitudes and practices. [ABSTRACT FROM AUTHOR]

Bombyx mori nucleopolyhedrovirus (BmNPV) is one of the main pathogens causing serious economic losses in sericulture. However, the molecular mechanism of silkworm resistance to BmNPV is still largely unclear, and the differences in the anti-BmNPV response between silkworms of different genders have been rarely studied. In this study, BmNPV resistant strain NB and BmNPV sensitive strain 306 of different genders were used as experimental materials to inoculate BmNPV, and their transcriptomes were sequenced to analyze their response to BmNPV. Eighteen genes specifically differentially expressed in NB after BmNPV inoculation were finally obtained through transcriptomic analysis, fourteen of which were up-regulated and four were down-regulated, suggesting that they might be related to BmNPV resistance. Among them, the expression abundance of eight genes were higher in males than in females, and one gene was in the contrary. These genes suggested that there were certain differences in the anti-BmNPV response between silkworms of different genders. This study provided a new understanding of the molecular mechanism of silkworm resistance to BmNPV and the differences in the anti-BmNPV response between silkworms of different genders, and laid a foundation for future prevention and control of BmNPV. [ABSTRACT FROM AUTHOR]

A new species, Botrytis polygoni, was isolated from several species of Polygonaceae in 2011 and 2012 in Tongwei County, Gansu Province, China. The species infects Fagopyrum esculentum, F. tataricum, and Fallopia convolvulus, causing brown leaf spots and large blotches with concentric rings in the field. Botrytis polygoni is morphologically characterized by conidia spherical, unicellular, hyaline to pale brown or brown, (10.2–)14.3–21.4(–23.5) μm; and sclerotia black, spherical to subspherical, allantoid, or irregular-shaped, 0.2–4.1 × 0.1–3.0 mm. Comparison of the nuc rDNA internal transcribed spacer region (ITS1-5.8S-ITS2) sequences confirmed its placement in the genus Botrytis. Phylogenetic analysis based on the protein-coding genes glyceraldehyde 3-phosphate dehydrogenase (G3PDH), heat shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) showed that the new species is clustered close but separate from Botrytis pyriformis, which was distant from 37 other Botrytis species and 17 undescribed species. Pathogenicity tests showed that the new species has aggressive pathogenicity to four species of Polygonaceae, specifically Fag. tataricum, Fal. convolvulus, Polygonum sibiricum, and Pol. aviculare, weak pathogenicity to Vicia faba in the Fabaceae, and no pathogenicity to eight other tested plants: Amaranthus retroflexus, Cirsium arvense, Convolvulus arvensis, Kalanchoe blossfeldiana, Lagopsis supine, Mentha canadensis, Plantago asiatica, and Raphanus sativus. [ABSTRACT FROM AUTHOR]

Dry fractionation of legumes is used to produce protein and starch-rich fractions with a clean label and lower environmental impact than conventional wet fractionation. Dry fractionation relies on the use of ambient air that varies in humidity. This study assessed the effect of relative humidity (RH) on milling and air classification of yellow pea and chickpea. Particle size analysis and powder rheology were used to assess the particle dispersibility and flowability of the flours. The RH has limited effect on milling and air classification between 30% and 70%. However, upon storage of fine milled chickpea flour at a RH of 70% and storage of fine milled yellow pea flour at a RH of 90% the air classification performance decreased. This was linked to a poorer dispersibility and flowability. Concluding, a relative humidity above 70% should be prevented to perform robust air classification. • Humidity between 30% and 70% has limited effect on direct milling and air classification. • Particle dispersibility and flowability decreased after storage at higher humidity. • Relative humidity above 70% should be prevented to perform robust air classification. • Lower flowability and agglomerated particles were detrimental for air classification. • Yellow pea flour has better flowability than chickpea flour under similar conditions. [ABSTRACT FROM AUTHOR]

Pumpkin rootstock affects watermelon scion growth, fruit yield, and quality, but the mechanisms of related key enzymes and photosynthesis remain unclear. In this study, net photosynthetic rate (PN), chlorophyll (Chl) fluorescence parameters, fruit mass and sugar accumulation, and related key enzyme activities were determined during the fruit development stage in diploid and triploid watermelon lines and corresponding pumpkin rootstock-grafted lines. The results showed that pumpkin rootstock increased PN and Chl fluorescence parameters of diploid and triploid watermelon, indicating that pumpkin rootstock could increase photosynthesis, the utilization efficiency of light energy of diploid and triploid watermelon lines. Pumpkin-grafted lines had higher alkaline α-galactosidase activity and lower activities of insoluble acid invertase, sucrose phosphate synthase, and sucrose synthase than corresponding own-root lines in diploid and triploid watermelon. It indicates that pumpkin rootstock could increase the unloading of photoassimilates and reduce the conversion of photoassimilates into sucrose in diploid and triploid watermelon fruits. [ABSTRACT FROM AUTHOR]

Hydrogen embrittlement leads to time-dependent failure of structural components. Hydrogen absorption and diffusion contribute to the time dependency and are often treated by thermodynamic diffusion models, which consider the ideal-solution approach and spherical distortion of the lattice. The interaction of spherical lattice distortions with hydrostatic stress fields causes stress-driven hydrogen diffusion. In the present work, ab-initio calculations are used to verify and parametrise the stress dependency of the generalised chemical potential for hydrogen in nickel. Therefore, the partial molar volume for hydrogen in nickel is introduced. The assumption of linear elasticity and a linear dependency on the hydrostatic stress is sufficient to describe hydrogen diffusion on the macroscopic and mesoscopic scale. The work is concluded with hydrogen diffusion simulations, which reveal a minor influence of stress-driven hydrogen diffusion on the overall hydrogen distribution in nickel. [ABSTRACT FROM AUTHOR]

• Comprehensive evaluation of 2 SARS-CoV-2 antibody assays with excellent agreement. • Rigorously validated antibody tests are reliable to detect antibody kinetic change. • Three types of seroconversion were observed in hospitalized COVID-19 patients. • Convalescent sera show a wide range of antibody levels. • Current antibody testing is not useful in early screening for COVID-19. In the ongoing COVID-19 pandemic, there is an urgent need for comprehensive performance evaluation and clinical utility assessment of serological assays to understand the immune response to SARS-CoV-2. IgM/IgG and total antibodies against SARS-CoV-2 were measured by a cyclic enhanced fluorescence assay (CEFA) and a microsphere immunoassay (MIA), respectively. Independent performance evaluation included imprecision, reproducibility, specificity and cross-reactivity (CEFA n = 320, MIA n = 364). Clinical utility was evaluated by both methods in 87 patients at initial emergency department visit, 28 during subsequent hospitalizations (106 serial samples), and 145 convalescent patients. Totally 916 patients and 994 samples were evaluated. Agreement of CEFA and MIA was 90.4%-94.5% (Kappa: 0.81–0.89) in 302 samples. CEFA and MIA detected SARS-CoV-2 antibodies in 26.2% and 26.3%, respectively, of ED patients. Detection rates increased over time reaching 100% after 21 days post-symptom onset. Longitudinal antibody kinetic changes by CEFA and MIA measurements correlated well and exhibited three types of seroconversion. Convalescent sera showed a wide range of antibody levels. Rigorously validated CEFA and MIA assays are reliable for detecting antibodies to SARS-CoV-2 and show promising clinical utility when evaluating immune response in hospitalized and convalescent patients, but are not useful for early screening at patient's initial ED visit. [ABSTRACT FROM AUTHOR]

Fluorescent dyes rhodamine B (RhB) was successfully introduced into the porous boron nitride nanosheets to obtain an effective and rare-earth free light composite conversion materials. X-ray powder diffractions, photoluminescence spectra, etc., were used to investigate the optical performance and thermal stability of these organic-dye-impregnated phosphor composites. The experimental results evidently showed that, compared with the optical properties of RhB in aqueous solution, the composite phosphors possessed more excellent optical performance and higher thermal stability due to their structural defects, surface hydroxyl groups and nanosize pore channel. In addition, the phosphor composites exhibited greatly improved service life and had a broad visible emission wavelengths of 540–680 nm under the 363 nm light excitation. We believe that the reported work should open the way toward the practical application of organic-dye-impregnated phosphor composites in the field of illumination light source. [ABSTRACT FROM AUTHOR]

This study investigated the modulating effects of dietary fumaric acid (FA) on growth performance, quality traits and redox status of breast meat in broilers exposed to chronic heat stress (HS). Two hundred Ross 308 broilers were randomly allocated to five groups with 4 replicates from 22 to 42 days of age. The broilers of the control group were raised at 23 ± 1℃ and received a basal diet (CONT), and the broilers in the other four groups were raised at 33 ± 1℃ and fed a basal diet with FA at 0, 5, 10, or 15 g/kg, respectively. On day 42, growth performance and breast meat characteristics were determined. HS decreased (P< 0.05) final body weight (FBW), body weight gain (BWG), feed intake, dressing yield, breast muscle yield, pH, shear force (SF), moisture and crude protein but increased (P< 0.05) feed conversion ratio (FCR), meat colour values, drip loss, cooking loss, ether extract, activities of superoxide dismutase (SOD) and glutathione peroxidase (GPx), contents of malondialdehyde (MDA) and total carbonyl (TC) when compared with CONT. Dietary FA in HS groups increased (P< 0.05) FBW, BWG, breast muscle pH but decreased (P< 0.05) FCR, L* and a* values (lightness/redness) and TC in comparison with HS. In addition, dietary 10 g/kg or 15 g/kg FA increased SF and total antioxidant capacity but decreased b* value (yellowness) and MDA. In conclusion, addition of FA in the diet partially alleviated the negative effects of HS on growth performance, some traits of breast meat quality and nutrient composition by improving the antioxidative status in heat-stressed broilers. [ABSTRACT FROM AUTHOR]

Summary: Microtia is a congenital malformation of the external ear that can be observed in many species including sheep. However, the genetic basis of microtia still remains unclear. Here, a GWAS was conducted to investigate the genetic basis underlying microtia. A total of 55 samples from 26 microtia and 29 normal animals were genotyped with Illumina OvineHD BeadChip. The strongest significant SNP was identified on OAR6, approximating the evolutionarily conserved region of the HMX1 gene, which is related to congenital malformations of the external ear in other species such as cattle and rats. Sequencing an evolutionarily conserved region surrounding HMX1 revealed a duplication of 76 bp, which is concordant with microtia, suggesting a dominant inheritance mode. Identification of this causal mutation in the HMX1 gene indicates the role of this particular gene in the development of the external ear and provides a genetic marker for selection against microtia. [ABSTRACT FROM AUTHOR]

Researches on the fracmemristor have aroused increasing interest in the last several years, but there are no reports on design of the discrete fracmemristor. Based on the fractional-order difference and the mathematical model of the charge-controlled memristor, the discrete fracmemristor is designed where the amount of charge is determined by a fractional-order discrete system. In the numerical simulations, it shows that the pinched hysteresis loops are observed, which imply that the proposed memristor satisfies the definition of the memristor. As an application, the fracmemristor sine map is designed, and multistability is observed regarding the initial conditions of both the memristor and system. It provides a potential model for different applications such as cellular neural networks, modulators, sensors, chaotic systems, and programmable digital circuits. [ABSTRACT FROM AUTHOR]

The present study investigated the effects of N-acetylcysteine (NAC) supplementation on rectal temperature, respiratory rate, growth performance and redox status in broilers, over a 21-day period at an elevated environmental temperature. A total of 270 one-day-old Arbor Acres broiler chickens were randomly allocated into three groups with five replicates of 18 broilers per replicate, viz. a thermoneutral group, which was reared at standard ambient temperature and fed a basal diet (CONT); and two heat-stressed groups, which were held at 32 ± 1°C from days 22 to 42 and fed a diet without NAC (HS) or with 0.1% NAC (HS+0.1% NAC), respectively. Rectal temperature (RT), respiratory rate (RR), growth performance and serum redox parameters were analysed on d 28, d 35 and d 42. HS treatment significantly impaired growth performance (P< 0.01, P< 0.05) and increased RT and RR (P< 0.01, P< 0.05) when compared to those of the CONT group over the entire experimental period. Moreover, serum total antioxidant capacity, activities of superoxide dismutase and glutathione peroxidase, ability to inhibit hydroxyl radical, sulfhydryl group, glutathione and Vitamin C and E levels, were significantly decreased (P< 0.05, P< 0.01) in the HS birds, as compared to those of the CONT group on d 28 and d 35. Serum malondialdehyde content, however, depicted an opposite trend simultaneously. NAC supplementation significantly reversed the adverse effects by significantly decreasing RR（P< 0.01）and increasing weight gain, feed intake and partial antioxidant values on d 28 and d 35. In conclusion, addition of NAC in the diet limits effectively adverse effects of HS by decreased RR and improved performance and redox status, which indicate that NAC is potent in counteracting chronic heat stress. [ABSTRACT FROM AUTHOR]

Cyclic adenosine monophosphate response element binding (CREB)-regulated transcription coactivator 3 (CRTC3) which is interfere with the metabolism of adipose tissue through distraction catecholamine signaling pathways. On account of its impact on the metabolism, CRTC3 gene may effect mammalian growth and development. In this study, 605 samples were used to detect the Insertion/Deletion (indel) of CRTC3 gene in sheep by agarose gel and DNA sequencing. In four varieties of Chinese domestic sheep breeds, 12 bp (NC7_019475.2:g.21152662_ 21152663ins CAGGGGCACGTG) and 31bp (NC_019475.2:g.21114157_ 21114187delTTGATGGGTTGCAAAGAGTCAGACATG ACTT) indels polymorphisms of CRTC3 gene were first evaluated. The two indel loci were significantly associated with sheep growth-related traits including body length, chest depth, hip height, chest circumference and body weight. The allelic frequencies distribution of locus2 were significantly different between the high fecundity breeds (HS) and low fecundity breeds (TS, LFTS) on an χ2 test (P<0.05). This study demonstrated that the 12bp and 31bp indels could extend the spectrum of genetic variations of CRTC3 gene in sheep. Both the two loci may be considered as potential functional polymorphisms that may increase the growth traits in sheep. [ABSTRACT FROM AUTHOR]

Aim: To investigate whether conicity index, abdominal volume index, body adiposity index, body roundness index, cardiometabolic index and lipid accumulation product compared with waist circumference could predict future diabetes in a 15‐year prospective study. Methods: The data were collected in 1992 and recollected in 2007 from the same group of 687 individuals. Anthropometric indices and biochemical data were obtained. Cox's proportional hazards regression models were used to estimate the hazard ratios of anthropometric measures. The discriminatory power of anthropometric measures for incident diabetes were assessed by Harrell's C‐statistic. Results: During follow‐up, 74 participants were newly diagnosed with diabetes. In multivariable Cox regression analysis after adjusting potential for confounders, log10‐conicity index [HR: 1.67 (95% CI: 1.31–2.11) per sd; P < 0.0001], log10‐abdominal volume index [HR: 1.95 (95% CI: 1.50–2.55) per sd; P < 0.0001], log10‐body adiposity index [HR: 1.82 (95% CI: 1.33–2.50) per sd; P < 0.0001], log10‐body roundness index [HR: 2.16 (95% CI: 1.63–2.88) per sd; P < 0.0001], log10‐cardiometabolic index [HR: 1.70 (95% CI: 1.39–2.09) per sd; P < 0.0001], log10‐lipid accumulation product [HR: 2.06 (95% CI: 1.56–2.73) per sd; P < 0.0001] and log10‐waist circumference [HR: 1.99 (95% CI: 1.51–2.46) per sd; P < 0.0001] were significantly associated with incident diabetes. Additionally, lipid accumulation product had the highest Harrell's C‐statistic at 0.715 (95% CI: 0.656–0.775), followed by body roundness index at 0.714 (95% CI: 0.658–0.770) and cardiometabolic index at 0.704 (95% CI: 0.643–0.764) then by waist circumference at 0.701 (95% CI: 0.644–0.759). Conclusions: Conicity index, abdominal volume index, body adiposity index, body roundness index, cardiometabolic index and lipid accumulation product were independent predictors of future diabetes. The discriminatory power of body roundness index, cardiometabolic index and lipid accumulation product for diabetes prediction were higher than that of waist circumference. What's new?: Central obesity has long been recognized as a risk factor for the development of diabetes. Several new anthropometric measures have been proposed in recent years to reflect central obesity. We found that the conicity index, abdominal volume index, body roundness index, cardiometabolic index and lipid accumulation product were alternative indexes for diabetes prediction.The discriminatory power of body roundness index, cardiometabolic index and lipid accumulation product for diabetes prediction were higher than that of waist circumference. [ABSTRACT FROM AUTHOR]

Mango anthracnose caused by the fungal pathogen Colletotrichum gloeosporioides results in substantial economic losses in postharvest fruits. Borate is an effective fungicide against C. gloeosporioides. It appears to induce mitochondrial degradation and dysfunction in the fungal conidia, but the underlying molecular mechanism remains unclear. This study investigated the effects of borate on this pathogen by examining its mitochondrial proteins, which were extracted from C. gloeosporioides mycelium after borate treatment (5 or 10 mm potassium tetraborate for 48 and 72 h) and characterized using proteomic analysis (two‐dimensional electrophoresis, 2‐DE; and mass spectrometry, MS) and bioinformatics. In total, 600 protein spots were separated by 2‐DE, and 115 of these appeared to be differentially expressed proteins (DEPs). Among the DEPs, 58 were identified using MALDI‐TOF‐TOF MS/MS. Borate treatment was found to alter the expression levels of proteins involved in seven different metabolic pathways, mostly related to energy supply and/or biosynthesis. The effect of borate on mRNA expression levels of 17 genes involved in these metabolic pathways was confirmed by real‐time quantitative reverse transcription PCR (qRT‐PCR). The results suggest that borate might have distinct effects on mitochondrial function in C. gloeosporioides and could be used to control anthracnose in postharvest mango fruits. [ABSTRACT FROM AUTHOR]

Understanding the distribution characteristics and influencing factors of labile soil organic carbon (LSOC) and its factors in seismic fault zones are important for understanding the changes of soil carbon balance in the region. Soil samples were collected to a depth of 50 cm in the northern part of the Longmenshan seismic fault zone as the research object, to investigate the profile distribution of LSOC and its relative proportion in soil organic carbon (SOC). The results showed that the effects of pH and soil water content (SWC) on SOC and its components were related to soil depth. The content of SOC and LSOC were negatively correlated with soil pH and positively correlated with SWC. Significant differences in the contents of SOC and LSOC were found between horizons. The content of SOC and LSOC decreased with soil depth within 50 cm soil profiles; while the proportion of LSOC to SOC increased. Oxidation stability coefficient (KOS) of SOC were significantly different between different soil layers and decreased with soil depth. The significant correlations between SOC and LSOC suggested that correlations between hot water extractable organic carbon (HEOC), cold water extractable organic carbon (CEOC), dissolved organic carbon (DOC), oxidizable organic carbon fraction (ROC), microbial biomass carbon (MBC) and SOC varied with soil depth. Notably, SOC in topsoil and bottom soil was highly correlated with HEOC and CEOC, respectively. LSOC and SOC in Longmenshan seismic fault showed obvious vertical distributions and the relationship between LSOC and SOC was related to soil depth. Besides, the correlation of SWC and pH with LSOC also varied with soil depth. [ABSTRACT FROM AUTHOR]

Goats are an important domestic animal for animal husbandry that has attracted considerable research attention worldwide. Genetic diversity assessment and population genetic structure of indigenous goats can provide valuable conservation strategies. The current study aimed to evaluate the genetic diversity and population structure of six goat populations from Chongqing, China. A total of 145 animals from five local goat populations, namely, Youzhou black (UZG), Jianzhou (JZG), Banjiao (BJG), Dazu (DZG) and Hechuan white goat (HCG) and an introduced breed called Nubia goat (NBG) located in Chongqing, China were genotyped with 18 autosomal microsatellite markers. A series of genetic diversity parameters and population phylogeny were estimated and constructed. This study preliminarily showed that the six goat populations present rich genetic diversity and significant genetic divergence among them. Furthermore, material exchanges were observed between the introduced and local goat populations in Chongqing. This result will further explain the diversity conservation of Chongqing goat populations. [ABSTRACT FROM AUTHOR]

Reactions of neutral Vn, Nbn, and Tan metal clusters (n≤=11) with CO+H2 mixed gases and CH3OH in a flow tube reactor (1–50 Torr) are studied by time of flight mass spectroscopy and density functional theory calculations. Metal clusters are generated by laser ablation, and reactants and products are ionized by low fluence (∼200 μJ/cm2) 193 nm excimer laser light. Nbn clusters exhibit strong size dependent reactivity in reactions both with CO+H2 and CH3OH compared with Vn and Tan clusters. A “magic number” (relatively intense) mass peak at Nb8COH4 is observed in the reaction of Nbn clusters with CO+H2, and CH3OH is suggested to be formed. This feature at Nb8COH4 remains the most intense peak independent of the relative concentrations of CO and H2 in the flow tube reactor. No other Nbn, Tan, or Vn feature behaves in this manner. In reactions of CH3OH with metal clusters Mn (M=V, Nb, and Ta, n=3–11), nondehydrogenated products MnCOH4/MnCH3OH are only observed on Nb8 and Nb10, whereas dehydrogenated products MnCO/CMnO are observed for all other clusters. These observations support the suggestion that CH3OH can be formed on Nb8 in the reaction of Nbn with CO+H2. A reaction mechanism is suggested based on the experimental results and theoretical calculations of this work and of those in the literature. Methanol formation from CO+H2 on Nb8 is overall barrierless and thermodynamically and kinetically favorable. [ABSTRACT FROM AUTHOR]

Neutral niobium and tantalum clusters (Nbn and Tan) are generated by laser ablation and supersonic expansion into a vacuum and are reacted in a pickup cell with various low pressure (∼1 mTorr) unsaturated hydrocarbons (acetylene, ethylene, propylene, 1-butene, 1,3-butadiene, benzene, and toluene) under nearly single collision conditions. The bare metal clusters and their reaction products are ionized by a 193 nm laser and detected by a time of flight mass spectrometer. Partially and fully dehydrogenated products are observed for small (n≤=m) and large (n>=m) neutral metal clusters, respectively, with m ranging from 2 to 5 depending on the particular hydrocarbon. In addition to primary, single collision products, sequential addition products that are usually fully dehydrogenated are also observed. With toluene used as the reactant gas, carbon loss products are observed, among which Nb8C12 and Ta8C12 are particularly abundant, indicating that the Met-Car molecule M8C12 can be formed from the neutral metal cluster upon two collisions with toluene molecules. The dehydrogenation results for low pressure reactions are compared with those available from previous studies employing flow tube (high pressure) reactors. Low pressure and high pressure cluster ion reactions are also compared with the present neutral metal cluster reactions. Reactions of unsaturated hydrocarbons and metal surfaces are discussed in terms of the present neutral cluster results. [ABSTRACT FROM AUTHOR]

This paper summarizes the analysis of the influence of anisotropy on the stress-optic coefficients and the determination of the stress-optic tensor components π11-π12 and π44 using an infrared polariscope and calibration with four-point bending of thin silicon samples. Values obtained are π11-π12=9.88×10-13 Pa-1 and π44=6.50×10-13 Pa-1. A fringe multiplier was also introduced to increase the sensitivity of the infrared polariscope by up to seven times. [ABSTRACT FROM AUTHOR]

The (0,0) band of the B ²Σ[sup +]-X²Σ[sup +] transition of LaS near 726 nm has been studied at high resolution using laser vaporization/reaction supersonic free jet expansion and laser induced fluorescence spectroscopy. Spectra taken at a resolution of about 50 MHz show resolved hyperfine structure which is caused principally by the unpaired 6sσ- electron in the ground state interacting with large magnetic moment of the [sub 57][sup 139]La nucleus with nuclear spin I=7/2. The X²Σ[sup +] state of LaS is in good Hund's case (b[sub βs]) coupling, however, the upper state, B ²Σ[sup +], is close to case (b[sub βJ]) coupling. A total of 1850 rotational-hyperfine transition lines have been assigned and measured. Accurate rotational, spin and hyperfine parameters for the B ²Σ[sup +] and X²Σ[sup +] states have been obtained, which give information about the electron distribution in the molecule. [ABSTRACT FROM AUTHOR]

Provides information on a study which presented the effects of precursors and substrate materials on microstructure, dielectric properties, and step coverage of (Ba,Sr)...TiO... films grown by metalorganic chemical vapor deposition. Film composition and growth rate; Film microstructure; Summary.

Objectives: Differences in oral health perceptions complicate comparisons of self-reported oral health in countries with considerably different cultures, traditions, and dental care. We compared it in China and New Zealand (NZ), to determine whether adults in those countries differ in how self-report oral health item responses distinguish those with different clinical oral disease states. Materials and methods: Analysis of representative data on dentate 35–44-year-olds and 65–74-year-olds from the 3rd National Oral Health Survey of China in 2005 (for Sichuan province) and the NZ Oral Health Survey in 2009. Self-rated oral health in the Chinese survey was assessed by asking "Overall, how would you rate your oral health?"(responses: "Very poor," "Poor," "Fair," "Good," and "Very good"). The NZ survey asked "How would you describe the health of your teeth or mouth?" (responses: "Excellent," "Very good," "Good," "Fair," or "Poor"). To enable comparability, these were combined to create a four-category ordinal measure of self-reported oral health. The slope index of inequality (SII) and the relative index of inequality (RII) determined the extent to which the four-category self-report item distinguished those with better or poorer oral status. Results: A higher proportion of Chinese than NZ 35–44-year-olds rated their oral health as poor or fair, and the NZ proportion rating their oral health as very good was four times that observed among Chinese. The 65–74-year-olds differed even more in their overall responses. For most aspects of clinical disease experience, the two populations were responding similarly to the self-reported oral health item, although the SII and RII values were more pronounced among 35–44-year-olds in NZ than in China; among 65–74-year-olds, both countries were more similar. Conclusions: Chinese and NZ adults' self-ratings reflect their oral disease experience in largely similar ways, despite considerable absolute differences. Clinical relevance: These findings support the cross-cultural applicability of self-report oral health measures. [ABSTRACT FROM AUTHOR]

To evaluate pore networks of the lower Cambrian Niutitang Shale in the Cen-gong Block, multiple techniques, including geochemical analysis, low-pressure gas (CO2 and N2) adsorption, mercury intrusion capillary porosimetry (MICP) and field-emission scanning electron microscope (FE-SEM), were performed to investigate pore structure, including pore-size distribution (PSD), pore volume and surface area of black organic-rich shales from two wells to better understand the mechanism of shale-gas accumulation. Geochemical analysis shows that equivalent vitrinite reflectance ranges from 2.1 to 3.5% and are overmature. Surface areas and pore volumes of micropores calculated from CO2 adsorption, which vary from 8.23 to 37.39 m2/g and from 3.06  10−3 to 10.89  10−3 cm3/g, respectively, can provide large amounts of adsorptive sites for shale-gas accumulation. N2 adsorption shows reversed S-shaped isotherms, which are classified into type H2 and H3 hysteresis loops, indicative of ink-bottle pores and slit-or plate-like pores. N2 adsorption and MICP analysis indicates that the inorganic-associated pores in shales may play a significant role in the storage and production of hydrocarbons. High-resolution FE-SEM analysis suggests that OM pores (OMPs) are common in Niutitang samples with a dominant diameter less 50 nm, but a sample with the highest total organic carbon (TOC) of 10.01 wt% has few OMPs, whereas a sample with the TOC of 7.51 wt% has more OMPs. The percentage of OMP area vs total organic matter area (Øs) ranges from 1.70 to 7.92%. The pore structure characteristics of TX1 well, calculated by multiple techniques, are better than samples from TM1 well. In addition, pore types are dominated by interparticle, intraparticle and organic matter pores, and the minor amounts of OMPs in TM1 well indicates that most of the organic matter may have lost the potential to generate hydrocarbons owing to the release of formation pressure with some graphitisation and high-angle fractures larger in the TX1 well. TOC content, mineral composition and tectonically related thermal maturity may be the main controlling factors of the pore structure and the lower Cambrian Niutitang Shale demonstrates the greatest potential for shale-gas production in South China. [ABSTRACT FROM AUTHOR]

Abstract: The importance of soldiers to termite society defence has long been recognized, but the contribution of soldiers to other societal functions, such as colony immunity, is less well understood. We explore this issue by examining the role of soldiers in protecting nestmates against pathogen infection. Even though they are unable to engage in grooming behaviour, we find that the presence of soldiers of the Darwin termite, Mastotermes darwiniensis, significantly improves the survival of nestmates following entomopathogenic infection. We also show that the copious exocrine oral secretions produced by Darwin termite soldiers contain a high concentration of proteins involved in digestion, chemical biosynthesis, and immunity. The oral secretions produced by soldiers are sufficient to protect nestmates against infection, and they have potent inhibitory activity against a broad spectrum of microbes. Our findings support the view that soldiers may play an important role in colony immunity, and broaden our understanding of the possible function of soldiers during the origin of soldier‐first societies. [ABSTRACT FROM AUTHOR]

Background and purpose: Fatal familial insomnia (FFI) is an autosomal dominant disease due to the D178N mutation of PRNP gene coupling with homozygous methionine (Met) at codon 129. It is generally considered that D178N mutation cases with 129 M/M homozygotes present as FFI, and 129 V/V as genetic CJD. However, the frequency of 129 Met alleles in Chinese population is much higher than that in Caucasians. This study aims to investigate the clinical features and genetic characteristics of Chinese D178N mutants in this genetic context. Methods: We reviewed the clinical and genetic features of seven D178N patients. The clinical data, genetic data, electroencephalogram (EEG), brain magnetic resonance imaging (MRI), polysomnography (PSG), CSF 14‐3‐3 protein examinations of the seven patients were analyzed. Results: The genotypes at codon 129 were all M/M. Four of the seven cases reported positive family history. Four patients were more likely the CJD phenotype and three were FFI phenotype according to the core clinical features. No major differences were found on the EEG, CSF 14‐3‐3 protein, and PSG presentations between this study and western studies. Novel neuroimaging findings were two patients had typical neuroimaging abnormalities of CJD and frontotemporal dementia, respectively. Conclusions: Unlike the western populations, the diverse phenotypical presentations of D178N mutants were not simply determined by the 129 genotypes in Chinese. The underlying modifying factors for phenotypical variations warrant further investigations. For those with atypical clinical and imaging features, genetic testing was important for final diagnosis. [ABSTRACT FROM AUTHOR]

Large language model (LLM) chatbots possess a remarkable capacity to synthesize complex information into concise, digestible summaries across a wide range of orthopedic subject matter. As LLM chatbots become widely available they will serve as a powerful, accessible resource that patients, clinicians, and researchers may reference to obtain information about orthopedic science and clinical management. Here, we examined the performance of three well‐known and easily accessible chatbots–ChatGPT, Bard, and Bing AI–in responding to inquiries relating to clinical management and orthopedic concepts. Although all three chatbots were found to be capable of generating relevant responses, ChatGPT outperformed Bard and BingAI in each category due to its ability to provide accurate and complete responses to orthopedic queries. Despite their promising applications in clinical management, shortcomings observed included incomplete responses, lack of context, and outdated information. Nonetheless, the ability for these LLM chatbots to address these inquires has largely yet to be evaluated and will be critical for understanding the risks and opportunities of LLM chatbots in orthopedics. [ABSTRACT FROM AUTHOR]

Background: Guidelines recommend high-sensitivity cardiac troponin (hs-cTn) for diagnosis of myocardial infarction. Use of hs-cTn is increasing across the U.S., but questions remain regarding clinical and operational impact. Prior studies have had methodologic limitations and yielded conflicting results. Objective: To evaluate the impact of transitioning from conventional cardiac troponin (cTn) to hs-cTn on test and resource utilization, operational efficiency, and patient safety. Design: Retrospective cohort study in two New York City hospitals during the months before and after transition from conventional cTn to hs-cTn at Hospital 1. Hospital 2 served as a control. Participants: Consecutive emergency department (ED) patients with at least one cTn test resulted. Intervention: Multifaceted hs-cTn intervention bundle, including a 0/2-h diagnostic algorithm for non-ST-elevation myocardial infarction, an educational bundle, enhancements to the electronic medical record, and nursing interventions to facilitate timed sample collection. Main Measures: Primary outcomes included serial cTn test utilization, probability of hospital admission, ED length of stay (LOS), and among discharged patients, probability of ED revisit within 72 h resulting in hospital admission. Multivariable regression models adjusted for age, sex, temporal trends, and interhospital differences. Key Results: The intervention was associated with increased use of serial cTn testing (adjusted risk difference: 48 percentage points, 95% CI: 45–50, P < 0.001) and ED LOS (adjusted geometric mean difference: 50 min, 95% CI: 50–51, P < 0.001). There was no significant association between the intervention and probability of admission (adjusted relative risk [aRR]: 0.99, 95% CI: 0.89–1.1, P = 0.81) or probability of ED revisit within 72 h resulting in admission (aRR: 1.1, 95% CI: 0.44–2.9, P = 0.81). Conclusions: Implementation of a hs-cTn intervention bundle was associated with an improvement in serial cTn testing, a neutral effect on probability of hospital admission, and a modest increase in ED LOS. [ABSTRACT FROM AUTHOR]

Abstract: ILC populations elaborate a similar cytokine expression pattern with helper T cell subsets Th1, Th2 and Th17. Recent studies indicate that CD25+ILC2 could alleviate atherosclerosis by altering lipid metabolism, whereas the depletion of CD90‐expressing ILCs had no influence on atherosclerosis. Thus, these findings raise the question of whether ILC1 cells react on atherosclerosis. Hence, our group attempted to explore the role of ILC1 cells in atherosclerosis. We found that ILC1 cells have a high Th1‐like gene expression of T‐bet and IFN‐γ, which is distinct from ILC2, ILC3 or conventional NK (cNK) cells. Moreover, atherosclerotic lesions were greatly reduced in ApoE−/−Rag1−/− mice treated with anti‐NK1.1 mAbs for depleting ILC1 cells (ILC1+cNK cells), compared to ApoE−/−Rag1−/− mice treated with anti‐IL‐15R mAbs for depleting cNK cells, and these effects could be fully rescued through the adoptive transfer of ILC1 cells sorted from the spleen of ApoE−/−TLR4+/+ mice into ApoE−/−Rag1−/− mice treated with anti‐NK1.1 mAbs. However, the adoptive transfer of ILC1 cells sorted from the spleen of ApoE−/−TLR4−/− mice into ApoE−/−Rag1−/− mice treated with anti‐NK1.1 mAbs blocked the progression of atherosclerosis, indicating that the pro‐atherosclerotic role of ILC1 cells is dependent on TLR4. Furthermore, oxLDL‐induced increase in IFN‐γ expression from ApoE−/− ILC1 cells was correlated with the decrease in BACH2 expression. Taken together, ILC1 cells exist in atherosclerosis and aggravate atherosclerosis via increasing pro‐inflammatory cytokine expression in a TLR4/BACH2‐dependent manner. [ABSTRACT FROM AUTHOR]

Abstract: Endothelial cells (ECs) and macrophages engage in tight and specific interactions that play critical roles in cardiovascular homeostasis and the pathogenesis of atherosclerosis. Extracellular vesicles (EVs) are circular membrane fragments released from the endosomal compartment as exosomes or shed from the surfaces of the membranes of most cell types. Increasing evidence indicates that EVs play a pivotal role in cell‐to‐cell communication. However, the contribution of EVs, as determine by oxidized low‐density lipoprotein (ox‐LDL)‐exposed and/or Kruppel‐like factor 2 (KLF2)‐transduced ECs in the interaction between vascular ECs and monocytes/macrophages, which is a key event in atherosclerotic plaque development, has remained elusive. This study demonstrates the characteristic impact of EVs from ox‐LDL‐treated and/or KLF2‐transduced ECs on the monocyte/macrophage phenotype in vitro and in vivo.Q‐PCR showed that both the atherosclerosis inducer ox‐LDL and atheroprotective factor KLF2 regulated inflammation‐associated microRNA‐155 (miR‐155) expression in human umbilical vein endothelial cells (HUVECs). Moreover, coculture, immunofluorescence and flow cytometry revealed that miR‐155 was enriched in ox‐LDL‐induced ECs‐EVs and subsequently transferred to human monocytic THP1 cells, in which these vesicles enhance monocyte activation by shifting the monocytes/macrophages balance from anti‐inflammatory M2 macrophages towards proinflammatory M1 macrophages; EVs from KLF2‐expressing ECs suppressed monocyte activation by enhancing immunomodulatory responses and diminishing proinflammatory responses, which indicate the potent anti‐inflammatory activities of these cells. Furthermore, oil red staining showed that atherosclerotic lesions were reduced in mice that received EVs from KLF2‐transduced ECs with decreased proinflammatory M1 macrophages and increased anti‐inflammatory M2 macrophages, and this effect is at least partly due to the decreased expression of inflammation‐associated miR‐155, confirming our in vitro findings. In summary, this study provides novel insights into the pathophysiological effects of altered EV secretion and/or microRNA content and their influence on modulating monocyte activation depending on the environment surrounding EVs‐releasing ECs. [ABSTRACT FROM AUTHOR]