Search

The epithelial derived Harderian gland consists of 2 types of secretory cells. The more numerous type A cells are responsible for the secretion of lipid droplets, while type B cells produce dark granules of multilamellar bodies. The process of autophagy is constitutively active in the Harderian gland, as confirmed by our analysis of LC3 processing in GFP-LC3 transgenic mice. This process is compromised by epithelial deletion of Atg7. Morphologically, the Atg7 mutant glands are hypotrophic and degenerated, with highly vacuolated cells and pyknotic nuclei. The mutant glands accumulate lipid droplets coated with PLIN2 (perilipin 2) and contain deposits of cholesterol, ubiquitinated proteins, SQSTM1/p62 (sequestosome 1) positive aggregates and other metabolic products such as porphyrin. Immunofluorescence stainings show that distinct cells strongly aggregate both proteins and lipids. Electron microscopy of the Harderian glands reveals that its organized structure is compromised, and the presence of large intracellular lipid droplets and heterologous aggregates. We attribute the occurrence of large vacuoles to a malfunction in the formation of multilamellar bodies found in the less abundant type B Harderian gland cells. This defect causes the formation of large tertiary lysosomes of heterologous content and is accompanied by the generation of tight lamellar stacks of endoplasmic reticulum in a pseudo-crystalline form. To test the hypothesis that lipid and protein accumulation is the cause for the degeneration in autophagy-deficient Harderian glands, epithelial cells were treated with a combination of the proteasome inhibitor and free fatty acids, to induce aggregation of misfolded proteins and lipid accumulation, respectively. The results show that lipid accumulation indeed enhanced the toxicity of misfolded proteins and that this was even more pronounced in autophagy-deficient cells. Thus, we conclude autophagy controls protein and lipid catabolism and anabolism to facilitate bulk production of secretory vesicles of the Harderian gland.

Dedifferentiation of smooth muscle cells (SMC) from the contractile to the synthetic phenotype is a key event in atherosclerosis. A comparable phenotypic change from the contractile to the synthetic state is rapidly incurred when SMC are grown in culture. To identify genes that characterize the contractile and synthetic phenotypes, we performed differential display reverse transcription polymerase chain reactions on RNA from porcine arterial contractile SMC obtained directly from medial tissues and from SMC made synthetic by cell culturing. One of the differentially expressed cDNAs we identified encoded tropomyosin 4 (TM4). Whereas basal levels of TM4 existed in contractile SMC, the amount of TM4 transcripts strongly increased in synthetic SMC (33% vs. 86-106%; p < 0.005). Induction of foam cell formation had no additional enhancing effect on the expression of TM4 in cultivated SMC. We also tested whether TM4 expression was correspondingly enhanced during atherogenesis. The number of TM4-expressing SMC increased with plaque development as demonstrated by simultaneous in situ hybridization and immunohistochemistry. We compared the localization patterns of myosin heavy chain isoforms in normal arteries and lesions of increasing severity and determined that TM4 expression was relegated mainly to SMC of the synthetic phenotype in the media and intima during atherogenesis. The present study demonstrates that upregulation of TM4 mRNA is a relevant marker of dedifferentiation in vascular SMC.

Recent studies have revealed the role of the pRb family members pRb and p130 in the response to vascular injury. We evaluated the arterial injury response in the absence of p107, a protein that shares a high degree of homology with the injury-controlling p130. Carotid artery ligation and perivascular electric injury of the femoral artery were applied to p107 knockout (p107 -/-) mice, and morphometric analysis was performed 3 wk after ligation and electric injury. Arterial vessels of p107 -/- mice were indistinguishable from controls under basal conditions. After carotid artery ligation the p107 -/- mice (n = 7) did not display an enhanced ligation response compared with controls (n = 9), which was studied over a distance of approximately 450 microm proximal and approximately 200 microm distal from the ligation site, with regard to vessel wall area, neointima area, and lumen area. Corresponding with this, morphometric data obtained from the perivascular electric injury of the femoral artery confirmed the lack of enhanced ligation and injury response in the absence of p107. We conclude that the pRb family member p107 is not a key regulator in vascular injury response. These data, in conjunction with previously reported results, indicate that the control of vascular injury response is not a redundant feature of pRb proteins but primarily specific for p130. Further studies on functional domains of p130 and p107 will help to resolve the pathways in vascular injury response.

Oxidation products of low-density lipoproteins have been suggested to promote inflammation during atherogenesis, and reticulocyte-type 15-lipoxygenase has been implicated to mediate this oxidation. In addition, the 5-lipoxygenase cascade leads to formation of leukotrienes, which exhibit strong proinflammatory activities in cardiovascular tissues. Here, we studied both lipoxygenase pathways in human atherosclerosis. The 5-lipoxygenase pathway was abundantly expressed in arterial walls of patients afflicted with various lesion stages of atherosclerosis of the aorta and of coronary and carotid arteries. 5-lipoxygenase localized to macrophages, dendritic cells, foam cells, mast cells, and neutrophilic granulocytes, and the number of 5-lipoxygenase expressing cells markedly increased in advanced lesions. By contrast, reticulocyte-type 15-lipoxygenase was expressed at levels that were several orders of magnitude lower than 5-lipoxygenase in both normal and diseased arteries, and its expression could not be related to lesion pathology. Our data support a model of atherogenesis in which 5-lipoxygenase cascade-dependent inflammatory circuits consisting of several leukocyte lineages and arterial wall cells evolve within the blood vessel wall during critical stages of lesion development. They raise the possibility that antileukotriene drugs may be an effective treatment regimen in late-stage disease.

Collagens play a central role in maintaining the integrity and stability of the undiseased as well as of the atherosclerotic vessel wall. An imbalanced metabolism may lead to uncontrolled collagen accumulation reducing vessel wall velocity, frequently resulting in arterial occlusion or thrombosis. A reduced production of collagen and its uncontrolled degradation may affect the stability of the vessel wall and especially of the atherosclerotic plaques by making them prone to rupture and aneurysm. This review presents an overview on the four groups of vascular collagens and on their role in atherogenesis. The major focus was to highlight the extraordinary role and importance of the short chain network forming type VIII collagen in the extracellular matrix of undiseased arteries and of atherosclerotic plaques. The molecular structure of type VIII collagen, its cellular origin, its implication in atherogenesis, its temporal and spatial expression patterns in human and experimental models of atherogenesis, the factors modulating its expression, and—not at least—its potential function is discussed.

OBJECTIVES To assess the potential of the donor heart to respond to interleukin-6 (IL6), the present study investigated the expression of IL6 receptor components in the myocardium of donor hearts before transplantation. BACKGROUND Donor heart dysfunction early after transplantation has been associated with the cytokine storm after donor brain death. Proinflammatory cytokines are thought to play a central role in this process. Interleukin-6 is of specific interest because it has been associated with cardiac allograft dysfunction and is related to an impaired prognosis. Its action requires expression of the specific IL6 receptor (IL6R), and the common signal transducer of the IL6 family glycoprotein 130 (gp130) in the donor heart. METHODS The activation of IL6, IL6R and gp130 messenger ribonucleic acid (mRNA) and protein was studied via reverse transcription-polymerase chain reaction (RT-PCR) and immunohistology in donor hearts (n = 6) and compared with patients undergoing evaluation of ventricular arrhythmias (control, n = 9) or with advanced heart failure (n = 20). RESULTS Messenger RNA of IL6, IL6R and gp130 was strongly expressed in all chambers of donor hearts, whereas right ventricles of control patients did not show any expression (donor vs. control: p < 0.005). Right ventricles of failing hearts showed IL6, IL6R and gp130 mRNA levels comparable with those found in donor hearts. Immunohistochemistry paralleled the RT-PCR data on the protein level. While IL6 was mainly expressed by myocytes, both receptor components were preferentially found mainly on interstitial cells. CONCLUSIONS The expression of the IL6 receptor components in the donor heart before transplantation establishes the condition sine qua non for the response of the donor heart to circulating IL6. This mechanism may explain the close association of elevated IL6 serum levels to acute cardiac allograft dysfunction in the early perioperative period.

We intended to establish a pharmacologic concept of synergistic antiproliferative effects on smooth muscle cells (SMC) by using paclitaxel and cyclosporine A at clinically applicable doses. Coronary SMC were incubated with paclitaxel and cyclosporine A at concentrations of 10-20 nmol/L and 83-415 nmol/L, respectively. Antiproliferative effects were assessed by cell counts, [3H]thymidine incorporation and cell cycle analysis. In addition, apoptosis was studied by cytoplasmic histone-associated DNA fragments and in vitro protein kinase C activity (PKC) was determined by immunoassay. We found paclitaxel and cyclosporine A to exert a highly supra-additive antiproliferative effect on SMC with significant reductions of cell counts (p < 0.01) and [3H]thymidine incorporation (p < 0.05). SMC were found to be arrested at the G2/M transition. This antiproliferative effect was observed in the absence of DNA fragmentation above values obtained for single compound treatment, which had virtually no impact on cell proliferation. DNA fragmentation started to increase at a drug combination comprising paclitaxel at the higher dose of 20 nmol/L. Under the treatment with both paclitaxel and cyclosporine A, PKC activity showed a 1.8-fold increase (p < 0.05) compared with untreated controls. In conclusion, PKC mediates supra-additive antiproliferative effects of paclitaxel and cyclosporine A on SMC. The data demonstrate a highly efficient pharmacologic concept for the inhibition of SMC proliferation. Further studies are needed to test this concept under in vivo conditions for the prevention of restenosis or transplant vasculopathy by systemic application of cyclosporine A--when already applied for immunosuppressive purposes--and local delivery of paclitaxel.

Type VIII collagen is a short-chain collagen that is present in increased amounts in atherosclerotic lesions. Although the physiological function of this matrix protein is unclear, recent data suggest an important role in tissue remodeling. Type VIII collagen in the atherosclerotic lesion is mainly derived from smooth muscle cells. We now show that macrophages in the atherosclerotic vessel wall and monocytes in adjacent mural thrombi also express type VIII collagen. We demonstrated this using a novel combined fluorescence technique that simultaneously stains, within the same tissue section, specific RNAs by in situ hybridization and proteins by indirect immunofluorescence. In culture, human monocyte/macrophages expressed type VIII collagen at all time points from 1 h to 3 wk after isolation. Western blotting and immunoprecipitation also revealed secretion of type VIII collagen into the medium of 14-day-old macrophages. Because this is the first report of secretion of a collagen by macrophages, we tested the effect of lipopolysaccharide (LPS) and interferon gamma, substances that stimulate macrophages to secrete lytic enzymes, on macrophage expression of type VIII collagen. LPS and interferon gamma decreased expression of type VIII collagen. By contrast, secretion of matrix metalloproteinase 1 (MMP 1) was increased, indicating a switch from a collagen-producing to a degradative phenotype. Double in situ hybridization studies of expression of type VIII collagen and MMP 1 in human coronary arteries showed that in regions important for plaque stability, the ratio of MMP 1 RNA to macrophage type VIII collagen RNA varies widely, indicating that the transition from one phenotype to the other that we observed in vitro may also occur in vivo.

Abstract —Upregulation of connexin43-gap junctions is associated with transition of contractile vascular smooth muscle cells (SMCs) to the synthetic state. To determine whether phenotypically distinct subpopulations of medial SMCs differentially express connexin43, we investigated the human distal internal mammary artery, a structurally heterogeneous vessel with features ranging from elastic to elastomuscular to muscular. Immunoconfocal microscopy combined with quantitative analysis and complemented by in situ hybridization showed that SMCs in the elastic medial regions expressed high levels of connexin43 but low levels of desmin, whereas those of muscular medial regions expressed low levels of connexin43 but high levels of desmin. Ultrastructurally, SMCs of both regions were of the contractile phenotype, but the former cells were irregular in shape with relatively prominent synthetic organelles whereas the latter were spindle shaped with fewer synthetic organelles. Vimentin, smooth muscle α-actin, calponin, h-caldesmon, and myosin heavy chains (SM1 and SM2) were equally highly expressed by most cells in both subpopulations. The connexin43/desmin expression pattern of SMCs in regions of intimal thickening resembled those of elastic medial regions. These findings refine the view suggested from previous studies that high levels of connexin43 expression are associated with SMCs of a less contractile/more synthetic phenotype. In the internal mammary artery, the 2 subpopulations of SMCs with markedly different connexin43 expression levels both represent a differentiated contractile phenotype, but the subpopulation showing high levels of connexin43-gap junctions is characterized by low levels of desmin and structural features that reflect a more synthetic tendency.

Abstract —This study presents an analysis of the expression of type VIII collagen mRNA in response to cholesterol diet and balloon injury in the rabbit iliac artery. The design of the animal experiments was as follows: 28 male New Zealand White rabbits were divided into the 3 different treatment groups. Group 1 received regular chow; group 2 was fed with a 1% cholesterol diet for 6 weeks and normal chow for 5 weeks; and group 3 underwent balloon injury, then 6 weeks of a 1% cholesterol diet, which was followed by 5 weeks of normal chow. The expression pattern of type VIII collagen mRNA was compared with that of the fibrillar collagen types I and III, transforming growth factor-β1, a factor known to exert the most potent stimulatory effect on collagen synthesis in vitro, and matrix metalloproteinase 1, a collagen-degrading enzyme. The cholesterol diet resulted in an upregulation of type VIII collagen, fibrillar collagens, transforming growth factor-β1, and matrix metalloproteinase I in the adventitia. Although the number of type VIII collagen mRNA–expressing cells in the media increased, no significant difference in overall expression levels was detectable by northern blot analysis. The ratio of medial smooth muscle cells expressing type VIII collagen mRNA to those expressing type I and type III collagen mRNA (CVIII:CI:CIII) changed from 1:1.88:0.03 in the normal media to 1:0.78:0.29. When cholesterol feeding was preceded by balloon injury, type VIII collagen mRNA expression concomitant with the fibrillar collagens was further upregulated over and above that level reported after cholesterol diet alone. In general, low levels of transforming growth factor-β1 mRNA correlated with high expression of matrix metalloproteinase I. Our study indicates that a cholesterol diet resulted in a balanced reorganization of the collagen composition but did not result in marked collagen accumulation. This may provide an extracellular environment that favors migration and proliferation processes during early atherogenesis. It also demonstrates that type VIII collagen is highly expressed and deposited at later stages, and this may be linked to processes such as tissue reorganization during vascular repair and plaque stabilization.

Colony stimulating factors belong to a family of cytokines that regulate proliferation in macrophages and other vascular cell types. They have been implicated in the inflammatory-fibroproliferative response of atherosclerosis. The present study was undertaken to assess the effect of granulocyte-macrophage and macrophage colony stimulating factors on the transcription of type VIII collagen by vascular smooth muscle cells and their potential relevance for the expression of collagen in atherosclerotic lesions. The influence of colony stimulating factors was studied in relation to transforming growth factor beta1, the factor exhibiting the most potent effect on collagen metabolism. Northern blot experiments showed that treatment with both colony stimulating factors and transforming growth factor beta1 transiently stimulated the transcription of type VIII collagen mRNA. Maximal levels were reached after 2 h and 100 pg/ml granulocyte macrophage colony stimulating factor (4-fold), 1 U/ml macrophage colony stimulating factor (4.6-fold) and 1 ng/ml transforming growth factor beta1 (1.6-fold). While overnight treatment with colony stimulating factors stimulated the expression of transforming growth factor beta1 mRNA, short incubations did not influence or downregulate the transcription. In turn, treatment with transforming growth factor beta1 reduced the expression of granulocyte-macrophage and macrophage colony stimulating factor mRNA. The in vitro mRNA expression patterns were directly reflected in the distribution patterns found in intimal thickenings and advanced atherosclerotic lesions. This study demonstrates that colony stimulating factors and transforming growth factor beta1 modulate the transcription of type VIII collagen in vitro. Our data indicate a direct mechanism and exclude a pathway, which is mediated via the stimulation of transforming growth factor beta1 transcription. Our studies further support the hypothesis that colony stimulating factors in concert with transforming growth factor beta1 affect the collagenous composition of the extracellular vascular matrix.

Die Beteiligung immunologischer Mechanismen bei Krankheitsbildern mit Storung der kardialen Pumpfunktion ist in den letzten Jahren verstarkt in den Vordergrund geruckt. In verschiedenen pathophysiologischen Situationen wie Herzinsuffizienz, Herzoperation, Herztransplantation, Herzinfarkt und Angina pectoris wurden Muster mit Erhohung von proinflammatorischen Zytokinen wie Tumor-Nekrose-Faktor-α, Interleukin-1 und Interleukin-6 und reversibler kardialer Dysfunktion beschrieben, die moglicherweise Ausdruck einer gemeinsamen biologischen Endstrecke sind. Dabei legen die verfugbaren Daten eine Beeinflussung wichtiger Determinanten der Pumpfunktion, d.h. von Kontraktilitat, Vorlast, Nachlast und Herzfrequenz, durch Zytokine nahe. Mogliche Mechanismen schliesen den β-Adrenozeptor-Weg, den Stickstoff-Monoxid-Weg sowie eine direkte Wirkung auf die Kalzium-Homoostase ein. Therapeutische Konzepte, die auf diesem neuen Verstandnis basieren, stehen am Anfang der Entwicklung.

Caveolin-1, a putative mediator of intracellular cholesterol transport, is generally assumed to be integrated into the cytoplasmic leaflets of all cellular membranes. Lipid droplets form by budding at the endoplasmic reticulum (ER), and caveolin-1 is thought to be transferred to the droplet surface along with the cytoplasmic leaflet of ER membranes and not to enter the droplet core. We explored how caveolin-1 accesses lipid droplets from the ER by localizing caveolin-1 in ER membranes and in lipid droplets in cultured smooth muscle cells using freeze-fracture immunocytochemistry. We detected caveolin-1 in endoplasmic leaflets of ER membranes but never in cytoplasmic leaflets. Caveolin-1 was also present in lipid droplet cores. These findings are incompatible with the current hypothesis of lipid droplet biogenesis. We suggest that the inherent high affinity of caveolin-1 for neutral lipids causes caveolin-1 molecules to be extracted from the endoplasmic leaflets of ER membranes and to be transferred into the droplet core by inundating lipids during droplet formation.

For assessing clinical events associated with cardiac allograft vasculopathy, parameters relating to nonimmunological or immunological risk factors, epicardial coronary vessels, microvasculature, or left ventricular function may be utilized.

Mouse models are employed to unravel the pathophysiology of vascular restenosis. Although much effort has been spent on how to apply an adequate arterial injury, the influence of the genetic background of mice has not yet received sufficient consideration. The study presented herein was designed to demonstrate the influence of the mouse strain on vascular injury response. Mice of a defined background (50% 129 strain and 50% DBA strain) were backcrossed into either the 129 strain or the DBA strain. Male offspring were subjected to a femoral artery injury model by applying an electric current. Morphometric analysis revealed that backcrossing into the 129 strain resulted in a significant ( P < 0.001) 17-fold increase in neointima formation ( n = 17 mice) compared with backcrossing into the DBA strain ( n = 19). The values of neointima area were 9.18 × 103 ± 2.13 × 103 and 0.54 × 103 ± 0.39 × 103 μm2, respectively. In conjunction, the vessel wall area was enhanced by 1.8-fold ( P < 0.001). In contrast, no significant differences were found for the areas of the lumen and the tunica media. Similarly, a significant increase in neointima formation was also found for mice of pure 129 strain compared with pure DBA strain. The results underline the importance of the genetic background for studies on vascular injury response. Furthermore, because the mouse genome of the various strains is well defined, serial testing of the genetic background of mice will provide candidate genes and/or genetic modifiers controlling vascular injury response.

Increased expression of connexin43 gap junctions in smooth muscle cells (SMC) is implicated in the response to primary arterial injury and in the early stages of human coronary atherosclerosis, but the relevance of these findings to restenosis is unknown. Here we investigated the expression of connexin43 gap junctions in restenotic aortas of cholesterol-fed double injured rabbits. Immunofluorescence confocal microscopy was used to evaluate temporal and spatial expression patterns and to characterize the major expressing cell type. Parallel studies were conducted by electron microscopy, in situ hybridization and Northern blot analysis. Connexin43 gap junctions- and connexin43 mRNA-expressing cells were abundant in the media of non-injured control aorta. Following primary injury and 6 weeks cholesterol diet, connexin43 gap junctions were found distributed throughout the primary intimal layer; although medial expression was reduced, the overall mRNA expression level remained similar to that of non-injured controls. After secondary injury, no major change in distribution pattern of connexin43 gap junctions occurred up to day 10, when marked neointimal labeling was observed. This overall pattern persisted, though with some diminution, at later stages. On the mRNA level total connexin43 mRNA expression declined to about 40% of control values within 4 days after secondary injury (P < 0.05), but subsequently increased four-fold, attaining levels double that of non-injured controls in the 10-day group (P < 0.005 versus control and 4 days). At later stages mRNA expression levels returned to values similar to those of non-injured controls. At all stages, connexin43 gap junctions were localized to the SMC, not to macrophages. We conclude that the enhanced gap junction formation may contribute to the coordination of the response of SMC after secondary injury, particularly in the early phase of restenosis.

Phytanic Acid Causes Cardiac Conduction Block. Introduction: The sterol carrier protein-2 gene encodes two functionally distinct proteins: sterol carrier protein-2 (SCP2, a peroxisomal lipid carrier) and sterol carrier protein-x (SCPx, a peroxisomal thiolase known as peroxisomal thiolase-2), which is involved in peroxisomal metabolism of bile acids and branched-chain fatty acids. We show in this study that mice deficient in SCP2 and SCPx (SCP2 null )d evelop a cardiac phenotype leading to a high sudden cardiac death rate if mice are maintained on diets enriched for phytol (a metabolic precursor of branched-chain fatty acids). Methods and Results: In 210 surface and 305 telemetric ECGs recorded in wild-type (C57BL/6; wt; n = 40) and SCP2 null mice (n = 40), no difference was observed at baseline. However, on diet, cycle lengths were prolonged in SCP2 null mice (262.9 ± 190 vs 146.3 ± 43 msec), AV conduction was prolonged (58.3 ± 17 vs 42.6 ± 4 ms), and QRS complexes were wider (19.1 ± 5v s14.0 ± 4 ms). In 11 gene-targeted Langendorff-perfused hearts isolated from SCP2 null mice after dietary challenge, complete AV blocks (n = 5/11) or impaired AV conduction (Wenckebach point 132 ± 27 vs 92 ± 10 msec; P < 0.05) could be confirmed. Monophasic action potentials were not different between the two genotypes. Left ventricular function studied by echocardiography was similar in both strains. Phytanic acid but not pristanic acid accumulated in the phospholipid fraction of myocardial membranes isolated from SCP2 null mice. Conclusion: Accumulation of phytanic acid in myocardial phospholipid membranes is associated with bradycardia and impaired AV nodal and intraventricular impulse conduction, which could provide an explanation for sudden cardiac death in this model. (J Cardiovasc Electrophysiol, Vol. 15, pp. 1310-1316

To the Editor: Recently, Lemos et al1 and O’Neill and Leon2 provided a balanced overview about drug-eluting stents. The authors nicely addressed the various aspects of this new technology from the economical to the clinical side, including safety and side effects. We would like to supplement another important aspect of safety, the problem of drug interaction, which has not yet received sufficient …

Pelat and coworkers1 demonstrated that rosuvastatin decreases caveolin-1 expression in the cardiovasculature of dyslipidemic mice. By decreasing the expression of caveolin-1, an inhibitor of endothelial NO synthase, rosuvastatin treatment promotes endothelial NO synthase function and concomitantly stabilizes heart rate and blood pressure variabilities. Thus, rosuvastatin exerts beneficial effects on vascular function beyond those attributed to its lipid-lowering capacity. The authors presume that caveolin-1 downregulation occurs at the endothelial cell level, although they also envisioned additional effects on other vascular cells involved in atherogenesis. We agree that effects of statins on other cells are indeed to be anticipated. In our studies on the molecular mechanisms underlying lipid trafficking via caveolae in human smooth muscle cells (SMC)2 and macrophages (MΦ), we evaluated caveolin-1 expression in response to the hydrophobic and hydrophilic statins lovastatin and pravastatin using the reverse transcription–polymerase chain reaction on total RNA (primers for human caveolin-1 were as follows: forward, GAGCTGAGCGAGAAGCAAGT; reverse, ACAGCAAGCGGTAAAACCAG; GenBank accession No, NM-001753), with β-actin …

To the Editor: We read with interest the report by Podewski et al1 on the expression of interleukin-6 (IL-6) and related cytokines, their receptors, and molecules of the Janus kinase (JAK)–signal transducers and activators of transcription (STAT) signal-transduction cascade in patients with idiopathic dilated cardiomyopathy. We agree that in patients with dilated cardiomyopathy, the protein expression of IL-6–related molecules and their signal-transduction cascade have not been evaluated before in such detail. However, we have some concerns. IL-6 and its receptor subunits have been extensively investigated before in failing hearts.2,3 In one of our studies on the cardiac IL-6/IL-6 receptor system, we particularly emphasized the significance of the type of controls used.4,5 Nonfailing donor hearts showed expression levels of IL-6 receptor and glycoprotein (gp) 130 similar to those observed in failing hearts. Because these hearts were nonfailing donor hearts, just as those used by Podewski et al,1 the lack of B-type natriuretic peptide upregulation apparently does not rule out upregulation of the cardiac IL-6 system, presumably related to brain death. In …

GM-CSF takes part in the cytokine network regulating the metabolism of extracellular matrix (ECM) during atherogenesis. Since data also point to an effect of GM-CSF on the vascular ECM in general, the vascular collagenous matrix was studied in wild-type and GM-CSF-deficient mice. Histological examination revealed a disorganized vascular ECM in GM-CSF-deficient mice involving the collagenous matrix and elastic fiber system. As shown by electron microscopy, collagen bundles were disrupted and reduced. The diameter of fibrils varied widely. mRNA expression of collagens and related molecules was studied. Fibrillar collagens were markedly reduced, alpha1(I)procollagen to 16.5% of control levels alpha1(III)procollagen was abolished whereas the expression level of network-forming alpha1(VIII)procollagen was not altered. As shown by in situ hybridization, the number of collagen-expressing cells was reduced. Matrix metalloproteinases and their inhibitor 1 were not affected by GM-CSF deficiency. Our studies demonstrate that GM-CSF plays a major role in the cytokine network regulating the metabolism of vascular collagens. GM-CSF deficiency leads to an altered composition of the vascular collagenous matrix, i.e., reduced amount of fibrillar collagen, altered ratio of fibrillar and network-forming collagen, and failures in the fibrillogenesis. We suggest that GM-CSF is a basic requirement for the maintenance of vessel wall integrity and resilience.

To study the effects of enhanced smooth muscle cell (SMC) proliferation on arterial vessel geometry in the absence of vessel trauma, we developed a transgenic mouse model expressing SV40 large T antigen under control of the 2.3-kb smooth muscle-myosin heavy chain promoter. Transgenic mice studied at ages from 3 to 13 wk showed a 3.2-fold increase in arterial wall SMC density, with 28% of SMC exhibiting proliferative cell nuclear antigen staining, confirming enhanced SMC proliferation, which was accompanied by two- to threefold increases in arterial wall areas ( P < 0.05). Remarkably, despite increased vessel wall mass, the lumen area was not compromised, but rather was increased. A tightly conserved linear relationship was found between arterial circumference and wall thickness with slopes of 0.036 for both transgenics ( r = 0.93, P < 0.01) and controls ( r = 0.77, P < 0.01), suggesting the hypothesis that the conservation of wall stress functions as a primary determinant of adaptive arterial remodeling. This establishes a new model of adaptive vessel remodeling occurring in response to a proliferative input in the absence of mechanical injury or primary flow perturbation.

Remodeling of arterial morphology in atherosclerosis, hypertension, and restenosis following angioplasty involves controlled alterations in total vascular circumference which critically modulate sequelae of changes in vessel wall mass. Despite the clinical relevance of this process little is known about the pathophysiology, especially the correlation between smooth muscle cell proliferation and remodeling.Carotid artery ligation was applied to mice with targeted disruption of the p130 gene (p130 -/-). Mice were allowed to recover for 3 weeks after ligation and then perfusion fixed for histologic and morphometric analysis.P130 -/- mice were indistinguishable from control littermates concerning size and weight. As for the aorta, carotid arteries and femoral arteries, no significant differences were found between the groups with regard to vessel size and cellular density of the vessel wall of non-instrumented vessels. In contrast, following carotid artery ligation we found p130 -/- mice (n=8) to develop a significant increase in vessel wall area compared to controls (n=9). Mean values ranged from 3.07 x 10(-2)+/-0.20 x 10(-2)-3.56 x 10(-2)+/-0.62 x 10(-2) mm(2) for p130 -/- mice versus 2.26 x 10(-2)+/-0.13 x 10(-2)-2.57 x 10(-2)+/-0.26 x 10(-2) mm(2) for controls (p=0.02) along the lesion studied. This increase in vessel wall area was primarily due to a sevenfold mean increase in neointima in p130 -/- mice yielding mean values of 0.43+/-0.18 - 1.19+/-0.70 x 10(-2) mm(2). Remarkably, despite vessel wall increase, the lumen area was not statistically different for both groups.The data indicate that the loss of the cell cycle inhibitor p130 leads to an enhanced injury response, implicating a central role of p130 in cell cycle control during response to injury in the vessel wall. The enhanced injury response in the context of p130 -/- preserves the ability to perform perfect remodeling, thus the remodeling capacity is preserved even in the context of this injury model.

Objectives: The study objective was to assess the cardiac expression of interleukin-6 (IL6) and its receptor (IL6R) in advanced heart failure. Background: While IL6 plasma levels are elevated and associated with an impaired prognosis in advanced heart failure, little is known about the intracardiac expression of the IL6 system. Methods: Heart tissue was obtained from 20 patients (n - 10, idiopathic dilated cardiomyopathy, age 44±15 years; n - 10, ischemic cardiomyopathy, age 55±8 years) at the time of transplantation. Left and right ventricular tissue was subjected to in situ hybridization, Northern blot analysis, and RT-PCR. Signals were quantified by densitometric scanning and corrected for G3PDH-mRNA levels. Right ventricular biopsy specimens (n - 11) of patients with arrhythmias and normal cardiac function served as controls. In addition, data were correlated with cardiac catheterization and echocardiography data obtained at transplant evaluation. Results: Ventricular IL6 and IL6R transcripts were detected in all explant specimens examined. Expression of both mRNA species was higher than in controls (P - 0.001). Left ventricular IL6 mRNA levels correlated positively with heart rate (r - 0.77; P - 0.009), pulmonary capillary wedge pressure (r - 0.53; P - 0.03), right atrial pressure (r - 0.77; P - 0.003), and inversely with left ventricular ejection fraction (r - −0.61; P - 0.03). Right ventricular IL6 mRNA levels correlated inversely with cardiac index (r - −0.48; P - 0.05). IL6R expression did not correlate with hemodynamic data. Conclusions: In advanced heart failure, cardiac IL6/IL6R mRNA expression is increased and may play a role in the pathophysiology of advanced heart failure.

Background: Natriuretic peptides regulate Na+ and H2O transport in the cortical collecting duct (CCD). We have shown that natriuretic peptides have no effect on ion conductances or water transport of principal cells (PC) even though a cGMP-regulated K+ channel is located in the basolateral membrane of these cells. Methods: RT-PCR was used to screen for different guanylyl cyclases (GC) in CCD and to look for the expression of GC-1 and GC-A mRNA in CCD of male and female Wistar and Sprague–Dawley rats. Polyclonal antibodies were raised against the detected GC. BCECF was used to investigate the effects of ANP on intracellular pH in intercalated cells (IC). Results: GC-A and GC-1 were detected. GC-A was immunolocalized in the luminal membrane of IC while GC-1 was mainly found in the luminal membrane of PC. GC-1 is expressed in Sprague–Dawley and Wistar rats except for male Sprague–Dawley rats, while GC-A is expressed in all strains. ANP (160 nM, n =11), urodilatin (140 nM, n =6), which had no effect in PC, significantly decreased pHi by 0.02±0.01 and 0.03±0.01 Units in IC, respectively. ANP as well as urodilatin and 8-Br-cGMP decreased the pHi recovery after acidification by 30±6% ( n =12), 37±7% ( n =8), and 19±3% ( n =8), respectively. Conclusion: GC-A is located in the luminal membrane of IC of rat CCD and ANP acts through this receptor when regulating pHi via an inhibition of the Na+/H+-exchanger. PC do not possess GC-A. GC-1 seems to be the only GC in these cells of most rat strains tested and therefore, it could be responsible for the regulation of K+ channels in the basolateral membrane via cGMP-dependent protein kinase.

We examined the distribution of metallothionein (MT), a stress-inducible protein, and the cardiomyocyte diameter in human hearts after left-ventricular assist device (LVAD) support.Remodeling in end-stage heart failure is characterized by myocyte hypertrophy and alterations of several inducible proteins. LVADs used as a bridge to cardiac transplantation unload the left ventricle and may lead to a reversal of the remodeling, but little is known about the pathophysiology of this process.The immunoreactivity for MT and the cardiomyocyte diameter was analyzed in left-ventricular tissue specimens of 17 patients with end-stage heart failure before and after LVAD support.MT positive cells were mainly located sub-endocardially in vacuolized cardiomyocytes and in small vessels throughout the myocardium. During LVAD support, MT-positive myocytes decreased in the sub-endocardial (p0.008) and sub-epicardial region (p0.003), MT-positive vessels decreased similarly (p0.003). Cardiomyocyte diameter decreased significantly only in the sub-endocardium (p0.03). Hearts of patients supported longer than 88 days (= median) showed substantially lower MT reactivity at the time of LVAD explantation as compared to patients supported less than 88 days.Our results suggest that unloading of the left ventricle during prolonged LVAD support leads to regression of cellular hypertrophy and a decrease of MT expression. The preferential reduction of MT-positive vacuolized cardiomyocytes in the sub-endocardium is comparable with the concept of greatest reduction of wall stress in this area of the myocardium and may be due to the improvement of myocardial blood flow and the energy balance.

Although transplant vasculopathy and native atherosclerosis are clinically and pathologically different entities, the pathogenesis of both diseases exhibits some common mechanisms. Both may be regarded as responses to injury within a broadened concept of the immune system. Alloantigens (e. g. on donor endothelial cells) or autoantigens (e. g. oxydized LDL cholesterol) are presented by antigen presenting cells to the T cells of the body's immune system. With the appropriate costimulatory signal, this signal pattern generates a differentiated T cell, B cell, and inflammatory cell response whereas without the second signal, the immune cells undergo apoptosis. In case of immune cell proliferation and differentiation, a coordinated pattern of cytokine release is initiated. Monocyte-derived macrophages are also involved in this process which culminates in rolling, sticking, and idapedesis through the coronary vascular endothelium and phenotype switch of medial smooth muscle cells mediated by generation off growth-promoting cytokines. Thus, viewed within a broadened paradigm of the immune system's role both disease entities may represent different vignettes of an integrated pathophysiological response to an endothelial injury.

The aim of this study was to investigate the role of metallothionein in cardiac transplants in relation to cytokines and allograft function. Recent studies have revealed an association of allograft dysfunction with elevated proinflammatory cytokines independent of cellular rejection. In animal experiments, cytokines induced overexpression of metallothionein, a low-molecular-weight protein implicated in cellular stress response.In 105 consecutive biopsies from 15 patients during the first 3 months after heart transplantation, metallothionein expression was investigated immunohistochemically. Its relation to serum interleukin-6, tumor necrosis factor-alpha, interleukin-2 (IL-2), soluble interleukin-2 receptor rejection, and echocardiographic parameters was determined. Forty-three biopsies of 12 patients with idiopathic ventricular tachycardia served as controls.Metallothionein expression was demonstrated in small vessels, cardiomyocytes, fibrocytes, and interstitial round cells. A positive relation between interleukin-6 levels and the number of metallothionein-positive small vessels (p0.028) was observed. Patients with lower serum IL-2 levels showed significantly higher numbers of metallothionein-positive small vessels (p0.043). Grafts with prolonged ischemic time (150 minutes) showed a significantly higher myocardial metallothionein score (p0.021). Metallothionein expression was associated with lower fractional shortening, larger left ventricular end-systolic diameter, and lower mean arterial pressure but not with acute cellular rejection.Metallothionein expression is associated with elevated interleukin-6 and decreased interleukin-2 serum levels and left ventricular allograft dysfunction in the absence of rejection.

Our previous work has shown that in vascular tissues the elastic medial regions express high levels of the gap junctional protein, connexin43, but low levels of desmin, while the muscular medial regions express low levels of connexin43 but high levels of desmin. It is uncertain, however, whether this regional difference at the tissue level extends down to the level of the individual cell, or reflects an averaged relationship of groups of cells of different connexin43 and desmin expression. The present study has addressed this question using cultured porcine aortic smooth muscle cells. Immunoconfocal microscopic analysis of single-labeled cells showed that while smooth muscle alpha-actin, calponin and vimentin were positively labeled in the majority of medial smooth muscle cells both in intact porcine aorta and corresponding cultured cells, desmin and connexin43 labeling was highly heterogeneous. In the cultured cells, 0.3-0.5% of cells were found to be desmin-positive, and quantitative analysis after double labeling for desmin and connexin43 revealed that the desmin-positive cells were smaller, and contained significantly lower numbers and smaller sizes of connexin43 gap-junctional spots than did desmin-negative cells. Our findings demonstrate that an inverse expression pattern of connexin43 and desmin holds true at the level of the individual cell. This suggests a close relationship between intrinsic phenotypic control and the regulation of connexin43 expression in the arterial smooth muscle cell.

Abstract —The expression of granulocyte-macrophage colony-stimulating factor (GM-CSF) and type VIII collagen was studied in human arteries. GM-CSF and type VIII collagen were codistributed in all layers of the walls of nondiseased arteries and during early atherogenesis with up to type V lesions. The number of cells expressing both mRNAs increased during the development of advanced atherosclerotic lesions. Whereas type VIII collagen expression increased further in complicated lesions, GM-CSF was downregulated. During early atherogenesis smooth muscle cells (SMC) and endothelial cells were the principal GM-CSF and type VIII collagen mRNA-expressing cell types. In advanced lesions monocytes/macrophages also expressed the mRNAs. In complicated lesions the number of GM-CSF mRNA-expressing SMC was markedly reduced. In in vitro experiments transforming growth factor-β1, platelet-derived growth factor, and GM-CSF, but not basic fibroblast growth factor, stimulated the expression of type VIII collagen mRNA by SMC. GM-CSF transiently stimulated type VIII collagen transcription. Thus GM-CSF is a prominent component of the regulatory network influencing collagen metabolism during atherogenesis. By modulating the synthesis of type VIII collagen in SMC, GM-CSF may influence the course of plaque development and may govern processes such as cell movement, plaque stability, and thrombus organization.

Resting endothelial cells express the small proteoglycan biglycan, whereas sprouting endothelial cells also synthesize decorin, a related proteoglycan. Here we show that decorin is expressed in endothelial cells in human granulomatous tissue. For in vitro investigations, the human endothelium-derived cell line, EA.hy 926, was cultured for 6 or more days in the presence of 1% fetal calf serum on top of or within floating collagen lattices which were also populated by a small number of rat fibroblasts. Endothelial cells aligned in cord-like structures and developed cavities that were surrounded by human decorin. About 14% and 20% of endothelial cells became apoptotic after 6 and 12 days of co-culture, respectively. In the absence of fibroblasts, however, the extent of apoptosis was about 60% after 12 days, and cord-like structures were not formed nor could decorin production be induced. This was also the case when lattices populated by EA.hy 926 cells were maintained under one of the following conditions: 1) 10% fetal calf serum; 2) fibroblast-conditioned media; 3) exogenous decorin; or 4) treatment with individual growth factors known to be involved in angiogenesis. The mechanism(s) by which fibroblasts induce an angiogenic phenotype in EA.hy 926 cells is (are) not known, but a causal relationship between decorin expression and endothelial cell phenotype was suggested by transducing human decorin cDNA into EA.hy 926 cells using a replication-deficient adenovirus. When the transduced cells were cultured in collagen lattices, there was no requirement of fibroblasts for the formation of capillary-like structures and apoptosis was reduced. Thus, decorin expression seems to be of special importance for the survival of EA.hy 926 cells as well as for cord and tube formation in this angiogenesis model.

During end-stage heart failure, plasma levels of interleukin-6 (IL6) are elevated. This cytokine exerts a negative inotropic influence on the myocardium. The production site of IL6 is unclear. We examined the hypothesis that IL6 in end-stage heart-failure patients is produced in the myocardium itself and is differentially regulated according to etiology. Cardiac tissue was obtained from 27 patients (idiopathic dilated cardiomyopathy, (DCM) 9/6 m/f, age 46 +/- 14 y; ischemic cardiomyopathy (ICM), 11/1 m/f, age 55 +/- 8 y) at the time of transplantation. The tissue was subjected to IL6 Northern-blot analysis. Signals were quantified by densitometric scanning after normalization to G3 PDH mRNA. Data were compared by Mann-Whitney test between DCM and ICM patients, divided by chamber origin. IL6 transcripts were found in all patients. In DCM, left-ventricular IL6 mRNA expression was higher than in ICM (p = 0.006). Median right-ventricular as well as left- and right-atrial IL6 mRNA expression was not significantly different in both groups. In summary, in end-stage heart failure, IL6 mRNA is consistently expressed in the myocardium. Left-ventricular expression is higher in DCM than in ICM. These data support the concept of a potentially reversible inflammatory component in the etiology of DCM which is more pronounced than in patients with ICM of comparable clinical severity.

Summary Hydroahobins are unique fungal extracellular proteins that produce amphipathic films at interfaces, mediate contact to hydrophobic surfaces and are known to be important in phytopathogenicity. In the pathogenic ascomycete Claviceps purpurea, causing ergot disease in grasses and cereals and ergotism in livestock a gene encoding an extraordinary type of hydrophobin has been detected, which appeared to be induced during alkaloid synthesis in axenic culture of an ergotalkaloid producing strain of Claviceps (V. Garre and P. Tudzynski, pers. communication; Arntz and Tudzynski, 1997, Curr. Genet. 31, 357-360). To elucidate presence and function of this hydrophobin during infection of rye, the nonradioactive in situ hybridization technique was successfully adapted to the fungal organism and optimized in the pathogenic interaction system. Semithin cryosections proved to be suitable for microscopical gene expression analysis using immunemediated alkaline-phosphatase staining for detection of digoxigeninlabeled cRNA probes. Specific hybridization of the prepared antisense riboprobe to hydrophobin mRNA was confirmed in nonradioactive Northern blots. While Permeabilization by proteinase K had only a minor effect the inclusion of detergent into the hybridization solutions enhanced specific RNA-RNA hybridization under maximum stringency. Hydrophobin mRNA was found in fungal cells growing in axenic culture. In the disease cycle, hydrophobin transcripts were localized in abundance during vegetative fructification in conidiophores that actively produced conidia. No signals were observed in sclerotial hyphae during formation of the alkaloid-containing ergots, although they fluoresced intensely during total RNA detection using acridine orange. Notably, in situ hybridization experiments resulted in specific signals during early infection and colonization phases in the external mycelia and in hyphae penetrating the host epidermal layer. The presumed role of the hydrophobin gene product in ergot pathogenicity is discussed with respect to the described spatio-temporal distribution of the hydrophobin transcripts.

Abstract Granulocyte-macrophage colony-stimulating factor (GM-CSF), one of a family of cytokines that regulate proliferation in macrophages and other types of cells, has been implicated in the inflammatory-fibroproliferative response of atherosclerosis. However, previous studies have been restricted to cultured cells and animal models. In the present study, we investigated GM-CSF expression in undiseased and atherosclerotic human coronary arteries at both the mRNA and protein levels. Dual in situ hybridization/cell-marking experiments demonstrated that subpopulations of intimal smooth muscle cells (SMCs) and endothelial cells express the cytokine in the histologically normal human coronary artery and that augmented expression occurs at these sites, and in macrophage accumulations and medial SMCs, in the atherosclerotic vessel. Corresponding data were obtained by in situ hybridization and reverse transcription–polymerase chain reaction and Northern analyses of cultured cells. Cultured human coronary arterial SMCs showed constitutive expression of GM-CSF in cells that had adopted an activated synthetic phenotype. Electron microscope immunocytochemistry revealed that GM-CSF is a protein localized in the cytoplasmic matrix of SMCs of both the undiseased and atherosclerotic vessel wall; extracellular matrix was largely unlabeled, with only occasional small patches of amorphous immunopositive material. The expression of GM-CSF by subpopulations of intimal SMCs in the undiseased artery and the marked upregulation of GM-CSF apparent in atherosclerotic lesions suggest roles for the cytokine in the cellular events underlying initiation and progression of the human atherosclerotic lesion.

Vigilin, a 150-kDa protein, contains 14 tandemly arranged domains, each consisting of a KH RNA-binding motif and a spacer region. Here, we report on the physical structure of the human Vigilin gene with 29 exons, thereby outnumbering the chicken gene by two additional 5′ exons. These additional exons, 1A and 1B, are alternatively though concurrently spliced to exon 1C which is homologous to the first exon in the chicken gene. None of the additional human exons code for an amino-terminal extension of Vigilin, due to in-frame stop codons. Structural features of exon 1A, however, would allow the translation of a 13-amino-acid peptide from an upstream open reading frame preceding the vigilin open reading frame. We suggest that exons 1A and 1B have been gained during evolution, allowing alternative routes of expression control of the human Vigilin gene.

Chick vigilin cRNA clones were used to isolate the cognate human gene, by screening a pWE15 genomic library. Three independent cosmid clones were isolated and characterized by restriction mapping. The gene was identified by sequencing an internal EcoRI fragment containing two exons homologous to exon 24 and 25 of the chicken vigilin gene and corresponding to nucleotides 1973-2104 of the human HBP-cDNA. The homology between the chicken and human sequences was 77% and 82% at the cDNA level, and 91% and 100% at the amino acid level. In addition, the analyzed intron/exon boundaries were invariantly conserved. The 5' and 3' regions of the human gene were mapped by Southern analysis of the respective clones with synthetic oligonucleotides. The entire vigilin gene spans a region of about 50 kb and has been assigned to chromosome 2q36-q37.2 (FL-pter value of 0.96 +/- 0.03) by fluorescence in situ hybridization to metaphase spreads from normal peripheral blood lymphocytes. The vigilin gene is localized in a chromosomal region comprising a cluster of collagen genes (COLIVA3, COLVIA3) and the locus of the Waardenburg syndrome I. Only one mRNA species of 4.4 kb is transcribed from the human vigilin gene. In accordance with previous observations on chicken mRNA, the expression of the human vigilin mRNA depends on the stage of cytodifferentiation both in vitro and in situ.

To the Editor: In the November issue of Arteriosclerosis, Thrombosis, and Vascular Biology , Minami et al1 demonstrated expression of the novel scavenger receptor for phosphatidylserine and oxidized lipoprotein (SR-PSOX) in lipid-laden macrophages accumulated in the intima of human atherosclerotic lesions. Because SR-PSOX seems to be identical to the membrane-anchored chemokine CXCL16,2,3⇓ which may play a dual role in inflammation and homeostasis, Minami et al1 discussed the potential regulation of SR-PSOX by pro-inflammatory cytokines. Although the authors did not detect SR-PSOX in smooth muscle cells (SMCs) and endothelial cells (ECs), they did discuss the possible expression of SR-PSOX in these cell types. Until now, only the expression of the scavenger receptors SR-AI/II,4 CD36,5 and LOX-16 in SMCs has been described. In our studies on the formation of SMC-derived foam cells during atherogenesis, we have focused on the expression of scavenger receptors,7 including SR-PSOX, in SMCs and ECs. We have also investigated the influence of cytokines on the expression of SR-PSOX in SMCs. Reverse transcriptase–polymerase chain reaction (PCR; primers for human SR-PSOX: 5′-TACACGAGGTTCCAGCTCCT-3′ and 5′-GGGGGCTGGT- AGGAAGTAAA-3′, porcine SR-PSOX: 5′-TATGTGGAGGCAGCAG- TGAC-3′ and …