Search

Epinephelus bilobatus, Epinephelus maculatus and Epinephelus longispinis are three groupers that share common morphological characteristics and coloration patterns and have been morphologically confused and misidentified with each other for a long time. Complete mitochondrial genomes of the three groupers were determined and analyzed in this study. Mitogenomes of E. bilobatus, E. maculatus and E. longispinis were 17, 354 bp, 17, 066 bp and 17, 221 bp in size respectively and consisted of 13 protein-coding genes, two ribosomal RNA genes and one control region. However, different from most teleosts, which contain canonical 22 tRNAs, more numbers of tRNAs were identified in the three groupers with 27 tRNAs in E. bilobatus and E. longispinis and 25 tRNAs in E. maculatus. The increased number of tRNAs was due to the presence of tandemly duplicated tRNA-Asp genes that were located between tRNA-Ser and COII genes (six duplications in E. bilobatus and E. longispinis, four duplications in E. maculatus). Intact gene tandem duplication was an uncommon feature that was found in the typical teleost mitogenomes. The phylogenetic trees of the 32 groupers (genus Epinephelus) that were constructed based on 12 protein-coding genes revealed that Epinephelus species with tandemly duplicated tRNA-Asp genes were clustered into one monophyletic group, distinct from other Epinephelus species without any duplication features, which indicated that tandemly duplicated tRNA-Asp genes may be the particular linage-specific characteristics that evolve from a common ancestor and have the ability to distinguish them from other Epinephelus species. The results of the mitogenomes comparative analyses of the three groupers revealed the genetic distance of mitogenomes between each two species to be 0.062 (E. bilobatus vs E. maculatus), 0.091 (E. bilobatus vs E. longispinis) and 0.087 (E. maculatus vs E. longispinis). All values were far greater than the minimum value of 0.020 for species identification, which shows that they were three independent species at molecular level. Regarding the relationships between the three groupers, E. bilobatus was found to be more closely related to E. maculatus in comparison to E. longispinis. The results provide valuable molecular data for the species identification and phylogenetic analyses on E. bilobatus, E. maculatus and E. longispinis, and also provided a new insight into the tandem gene duplication features of Epinephelus mitogenomes. [ABSTRACT FROM AUTHOR]

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and blackskinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different redskinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of longterm interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish. [ABSTRACT FROM AUTHOR]

The hybrid grouper (Cromileptes altivelas, ♀ × Epinephelus lanceolatus, ♂) is an economically important aquaculture species that exhibits certain growth advantages compared to its female parent, Cromileptes altivelas. However, the current understanding of the molecular mechanisms underlying the growth of hybrid groupers is lacking. Herein, we performed full-length transcriptome sequencing and next-generation sequencing on the hybrid grouper and its parents to identify growth-related genes and comprehensively analyze the regulatory mechanism of growth heterosis in the hybrid grouper. Approximately 44.70, 40.44, and 45.32 Gb of single-molecule real-time sequencing data were generated in C. altivelas (Cal), E. lanceolatus (Ela), and the hybrid (Hyb), which were combined into 204,322 non-redundant isoforms using the PacBio sequencing platform. Differentially expressed genes (DEGs) were identified between Hyb and Cal (3,494, 2,125, and 1,487 in brain, liver, and muscle tissues, respectively) and Hyb and Ela (3,415, 2,351, and 1,675 in brain, liver, and muscle tissues, respectively). Then, 27 DEGs (13 in the brain and 14 in the muscle) related to growth traits were identified using cluster and correlation network analysis. Quantitative RT-PCR validated 15 DEGs consistent with transcriptome sequencing (RNA-seq) trends. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that these 15 genes were mainly involved in regulating the actin cytoskeleton, suggesting that this pathway plays an essential role in fish growth. In addition, we found that the phosphatase and tensin homologue (PTEN) is a key regulator of growth heterosis in Hyb. These results shed light on the regulatory mechanism of growth in the Hyb, which is important for marker-assisted selection programs to improve the growth quality of groupers. [ABSTRACT FROM AUTHOR]

Oligochitosan (OCS) has many vital bioactive functions; however, its underlying mechanisms in the liver of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatu ♂) are not well studied. A comprehensive study is currently focused on the systematic effects of OCS on hybrid grouper liver, particularly their effects on transcriptome profiles, toxicity, and apoptosis. With the control diet supplemented with OCS at different dosages (0, 200, 400, 800, or 1600 mg/kg), the 30-day feeding trial was randomized to 360 fish in triplicate. The findings revealed that liver and body weight are not impacted by OCS after a 4-week feeding trial. To characterize the liver transcriptome by high-throughput sequencing, KEGG analysis showed that OCS feeding activated apoptosis-related signaling pathways. The five DEG levels, namely CYC, GADD45, PAI1, CDKN1A, and BCL2L1, were downregulated in apoptosis-related pathways for clarifying the transcriptomic data. To elucidate the immune responses stimulated by OCS by qRT-PCR, inflammation-associated cytokines' mRNA expression levels, such as TNF-α and IL-1β, were significantly upregulated in the 800 mg/kg group in contrast to the control. At the same time, OCS significantly improved antioxidant capacity by significantly decreasing apoptosis-related genes' expression and considerably enhancing CAT and GPx expression. To further test the antibacterial ability of OCS-fed hybrid groupers, the liver morphology of hybrid groupers was significantly improved after infection with Vibrio harvey, and apoptosis was significantly reduced in grouper liver according to TUNEL results. Overall, appropriate dietary OCS could improve immune responses and attenuate apoptosis-related signaling pathways in the liver of hybrid grouper, thus playing a role in bacterial resistance. [ABSTRACT FROM AUTHOR]

Global warming has resulted in rapid poleward shifts in the geographical distributions of many tropical fish species. This study conducted daily market surveys from 2008 to 2013 to investigate catch trends of seven commercially important grouper species in the temperate Goto Islands, Japan. Our results revealed that the catch numbers of tropical grouper species increased rapidly by an average of 5.9-fold (12.3-fold at maximum) within six years, whereas the temperate and subtropical species did not exhibit substantial changes. Based on the findings of several previous studies, the rapid increase in the number of tropical groupers in temperate waters was most likely caused by the successful settlement of larvae transported from tropical waters. Large-scale ocean currents may facilitate larval transport from tropical waters because the Goto Islands face the Tsushima Warm Current, which branches from the Kuroshio Current. Meanwhile, the transition processes of size distribution in tropical groupers suggest a possible hypothesis that adults migrating from tropical waters first settle in temperate waters and then enhance their populations by reproduction. Further studies are required to determine how tropical grouper species settle and how their populations increase in temperate waters. [ABSTRACT FROM AUTHOR]

Copyright of Food Research & Development is the property of Food Research & Development Editorial Department and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The present work examined the effect of different chitosan sizes (bulk and nano) on the shelf life of fillets made of Cromileptes altivelis flesh in cold temperatures. Research procedures involved the characterization of chitosan and nanochitosan from the prawn skin (the study used the Litopenaeus vannamei species) and the preservation of C. altivelis fillet in chitosan and nanochitosan solution during the cooling process. Fresh C. altivelis flesh weighing 800-950 gram were sliced into skin-off fillets before being immersed in chitosan and nanochitosan solution for 15 minutes. The flesh was then covered and stored at a cold temperature (± 5°C) for nine days with an observation interval of three days. Observations were made on the values of TVB-N, TMA-N, pH, TPC, FFA, peroxide value, and the sensory values of humpback grouper fillets. The present work employed a randomized block group with a factorial pattern. All parametric data were analyzed using the ANOVA and Duncan tests. The experiment was divided into three chitosan and nanochitosan treatments with a duration of 0 day, 3 days, 6 days, and 9 days. The results showed that chitosan and nanochitosan caused significant differences (P< 0.05) in the values of TVB-N and TPC. Similarly, a significant difference was recorded in all test parameters' storage time (P< 0.05). Using nanochitosan solution can suppress the degradation of fish fillets in terms of the TVB-N and TPC values. Moreover, the best treatment was the fillet soaked in nanochitosan solution that was stored for six days. The present work concluded that nanochitosan affects the shelf life of C. altivelis fillet during the cooling process. [ABSTRACT FROM AUTHOR]

Nervous necrosis virus (NNV) is a highly neurotropic virus that poses a persistent threat to the survival of multiple fish species. However, its inimitable neuropathogenesis remains largely elusive. To rummage potential partners germane to the nervous system, we investigated the interaction between red-spotted grouper NNV (RGNNV) and grouper brain by immunoprecipitation coupled with mass spectrometry and discerned Nectin1 as a novel host factor subtly involved in viral early invasion events. Nectin1 was abundant in neural tissues and implicated in the inception of tunnel nanotubes triggered by RGNNV. Its overexpression not only dramatically potentiated the replication dynamics of RGNNV in susceptible cells, but also empowered non-sensitive cells to expeditiously capture free virions within 2 min. This potency was impervious to low temperatures but was dose-dependently suppressed by soluble protein or specific antibody of Nectin1 ectodomain, indicating Nectin1 as an attachment receptor for RGNNV. Mechanistically, efficient hijacking of virions by Nectin1 strictly depended on intricate linkages to different modules of viral capsid protein, especially the direct binding between the IgC1 loop and P-domain. More strikingly, despite abortive proliferation in Nectin1-reconstructed CHSE-214 cells, a non-sensitive cell, RGNNV could gain access to the intracellular compartment by capitalizing on Nectin1, thereby inducing canonical cytoplasmic vacuolation. Altogether, our findings delineate a candidate entrance for RGNNV infiltration into the nervous system, which may shed unprecedented insights into the exploration and elucidation of RGNNV pathogenesis. IMPORTANCE Nervous necrosis virus (NNV) is one of the most virulent pathogens in the aquaculture industry, which inflicts catastrophic damage to ecology, environment, and economy annually around the world. Nevertheless, its idiosyncratic invasion and latency mechanisms pose enormous hardships to epidemic prevention and control. In this study, deploying grouper brain as a natural screening library, a single-transmembrane glycoprotein, Nectin1, was first identified as an emergent functional receptor for red-spotted grouper NNV (RGNNV) that widely allocated in nervous tissues and directly interacted with viral capsid protein through distinct Ig-like loops to bridge virus-host crosstalk, apprehend free virions, and concomitantly propel viral entry. Our findings illuminate the critical role of Nectin1 in RGNNV attachment and entry and provide a potential target for future clinical intervention strategies in the therapeutic race against RGNNV. [ABSTRACT FROM AUTHOR]

This paper proposes a meta-heuristic called Eel and Grouper Optimizer (EGO). The EGO algorithm is inspired by the symbiotic interaction and foraging strategy of eels and groupers in marine ecosystems. The algorithm's efficacy is demonstrated through rigorous evaluation using nineteen benchmark functions, showcasing its superior performance compared to established meta-heuristic algorithms. The findings and results on the benchmark functions demonstrate that the EGO algorithm outperforms well-known meta-heuristics. This work also considers solving a wide range of real-world practical engineering case studies including tension/compression spring, pressure vessel, piston lever, and car side impact, and the CEC 2020 Real-World Benchmark using EGO to illustrate the practicality of the proposed algorithm when dealing with the challenges of real search spaces with unknown global optima. The results show that the proposed EGO algorithm is a reliable soft computing technique for real-world optimization problems and can efficiently outperform the existing algorithms in the literature. [ABSTRACT FROM AUTHOR]

Most teleost fishes exhibit a biphasic life history with a larval oceanic phase that is transformed into morphologically and physiologically different demersal, benthic, or pelagic juveniles. This process of transformation is characterized by a myriad of hormone-induced changes, during the often abrupt transition between larval and juvenile phases called metamorphosis. Thyroid hormones (TH) are known to be instrumental in triggering and coordinating this transformation but other hormonal systems such as corticoids, might be also involved as it is the case in amphibians. In order to investigate the potential involvement of these two hormonal pathways in marine fish post-embryonic development, we used the Malabar grouper (Epinephelus malabaricus) as a model system. We assembled a chromosome-scale genome sequence and conducted a transcriptomic analysis of nine larval developmental stages. We studied the expression patterns of genes involved in TH and corticoid pathways, as well as four biological processes known to be regulated by TH in other teleost species: ossification, pigmentation, visual perception, and metabolism. Surprisingly, we observed an activation of many of the same pathways involved in metamorphosis also at an early stage of the larval development, suggesting an additional implication of these pathways in the formation of early larval features. Overall, our data brings new evidence to the controversial interplay between corticoids and thyroid hormones during metamorphosis as well as, surprisingly, during the early larval development. Further experiments will be needed to investigate the precise role of both pathways during these two distinct periods and whether an early activation of both corticoid and TH pathways occurs in other teleost species. [ABSTRACT FROM AUTHOR]

Vibrio harveyi is a normal flora present in seawater, but in recent years, with large density aquaculture, V. harveyi has become one of the causative organisms in fish and shrimp. In this study, V. harveyiVieA gene was used as the target to design primers and establish the loop-mediated isothermal amplification (LAMP) combined with visual lateral flow test strip (LFD). The optimal reaction conditions were optimized as 60°C, 45 min, 1.2 mM Mg2+, 0.64 mM dNTPs, 0.25 mM betaine, and 16:1 ratio of internal/external primers. The results showed that the established LAMP assay was able to specifically detect V. harveyi with a sensitivity of 3.4 × 10–5 ng/µL. Clinical applicability analysis revealed that only V. harveyi was detected in the samples for pearl gentian grouper and whiteleg shrimp artificially infected by Vibrio. Therefore, we established a visual, reliable, rapid and sensitive LAMP-LFD method for detecting V. harveyi in aquatic animals. [ABSTRACT FROM AUTHOR]

In this paper, we present the first machine learning package developed specifically for fish calls identification within a specific range (0-500Hz) that encompasses four Caribbean grouper species: red hind (E. guttatus), Nassau (E. striatus), yellowfin (M. venenosa), and black (M. bonaci). Because of their ubiquity in the soundscape of the grouper's habitat, squirrelfish (Holocentrus spp.) sounds along with vessel noise are also detected. In addition themodel is also able to separate grouper species call types. This package called FADAR, the Fish Acoustic Detection Algorithm Research is a standalone user-friendly application developed in Matlab™. The concept of FADAR is the product of the evaluation of various deep learning architectures that have been presented in a series of published articles. FADAR is composed of a main algorithmthat can detect all species calls including their call types. The architecture of this model is based on an ensemble approach where a bank of five CNNs with randomly assigned hyperparameters are used to form an ensemble of classifiers. The outputs of all five CNNs are combined by a fusion process for decisionmaking. At the species level, the output of the multimodel is thus used to classify the calls in terms of their types. This is done by species specific deep learningmodels that have been thoroughly evaluated in the literature on the species concerned here, including transfer learning for red hind and yellowfin groupers and custom designed CNN for Nassau grouper, which has a greater number of known call types than the other species. FADARwasmanually trained on a diversity of data that span various regions of the Caribbean Sea and also two recorder brands, hydrophone sensitivities, calibrations and sampling rates, including a mobile platform. This strategy has conferred FADAR substantive robustness to a diversity of noise level and sources that can be found in the grouper calls frequency band such as vessels and marine mammals. Performance metrics based on sensitivity (recall) and specificity showed the same performance level for both balanced and unbalanced datasets and at locations not used in the training set. [ABSTRACT FROM AUTHOR]

Pseudomonas plecoglossicida, a gram-negative bacterium, is the main pathogen of visceral white-point disease in marine fish, responsible for substantial economic losses in the aquaculture industry. The FliL protein, involved in torque production of the bacterial flagella motor, is essential for the pathogenicity of a variety of bacteria. In the current study, the fliL gene deletion strain (DfliL), fliL gene complement strain (C-DfliL), and wild-type strain (NZBD9) were compared to explore the influence of the fliL gene on P. plecoglossicida pathogenicity and its role in host immune response. Results showed that fliL gene deletion increased the survival rate (50%) and reduced white spot disease progression in the hybrid groupers. Moreover, compared to the NZBD9 strain, the DfliL strain was consistently associated with lower bacterial loads in the grouper spleen, head kidney, liver, and intestine, coupled with reduced tissue damage. Transcriptomic analysis identified 2 238 differentially expressed genes (DEGs) in the spleens of fish infected with the DfliL strain compared to the NZBD9 strain. Based on Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis, the DEGs were significantly enriched in seven immune systemassociated pathways and three signaling molecule and interaction pathways. Upon infection with the DfliL strain, the toll-like receptor (TLR) signaling pathway was activated in the hybrid groupers, leading to the activation of transcription factors (NFkB and AP1) and cytokines. The expression levels of proinflammatory cytokinerelated genes IL-1b, IL-12B, and IL-6 and chemokine-related genes CXCL9, CXCL10, and CCL4 were significantly up-regulated. In conclusion, the fliL gene markedly influenced the pathogenicity of P. plecoglossicida infection in the hybrid groupers. Notably, deletion of fliL gene in P. plecoglossicida induced a robust immune response in the groupers, promoting defense against and elimination of pathogens via an inflammatory response involving multiple cytokines. [ABSTRACT FROM AUTHOR]

The objective of this study is to provide information on the reproductive biology of tomato hind grouper, Cephalopholis sonnerati (Valenciennes, 1828) for conservation and management purposes. Fish caught by artisanal fishermen from September 2019 to August 2021 were analysed. A total of 280 females, 31 males, and 4 transitional and 178 sex‐undetermined fish were analysed. The female to male sex proportion was 9:1, and the fish reached a maximum total body length of 38.5 and 54.5 cm for females and males, respectively. The following microscopic stages were identified: immature, developing, ripe, running ripe/releasing, and spent in both males and females. Several asynchronous development patterns were observed in the studied gonads, including multiple oocyte stages and early and advanced stages of sexual transition. High gonadosomatic index (GSI) for both males and females was recorded in March, May, and November. Running ripe and releasing stages in females were identified in the months from March to June, which indicates the spawning season. The absolute and relative fecundity of the species ranged from 162,723 ± 207,267 and 239 ± 285, respectively. An exponential relationship was found between fecundity and total body length (TL), fecundity and total body weight (TW), and fecundity and gonad weight (GW). [ABSTRACT FROM AUTHOR]

Jinhu groupers, the hybrid offspring of tiger groupers (Epinephelus fuscoguttatus) and potato groupers (Epinephelus tukula), have excellent heterosis in fast growth and strong stress resistance. However, compared with the maternal tiger grouper, Jinhu groupers show delayed gonadal development. To explore the interspecific difference in gonadal development, we compared the transcriptomes of brain, pituitary, and gonadal tissues between Jinhu groupers and tiger groupers at 24-months old. In total, 3034 differentially expressed genes (DEGs) were obtained. KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analyses showed that the osteoclast differentiation, oocyte meiosis, and ovarian steroidogenesis may be involved in the difference in gonadal development. Trend analysis showed that the DEGs were mainly related to signal transduction and cell growth and death. Additionally, differences in expression levels of nr4a1, pgr, dmrta2, tbx19, and cyp19a1 may be related to gonadal retardation in Jinhu groupers. A weighted gene co-expression network analysis revealed three modules (i.e., saddlebrown, paleturquoise, and greenyellow) that were significantly related to gonadal development in the brain, pituitary, and gonadal tissues, respectively, of Jinhu groupers and tiger groupers. Network diagrams of the target modules were constructed and the respective hub genes were determined (i.e., cdh6, col18a1, and hat1). This study provides additional insight into the molecular mechanism underlying ovarian stunting in grouper hybrids. [ABSTRACT FROM AUTHOR]

Vibrio alginolyticus is the causative agent of vibriosis, a common bacterial infection in grouper aquaculture that is associated with the development of haemorrhagic and non‐haemorrhagic ulcerations on the fish. In the present study, comparative proteome analysis was performed on serum samples from Vibrio‐resistant and Vibrio‐susceptible grouper. Samples were analysed using high‐throughput LC‐MS/MS and identified 2770 unique peptides that corresponded to 344 proteins. Subsequent analysis identified 21 proteins that were significantly up‐regulated in the resistant group compared to the control and the susceptible groups. Those proteins are associated with immunostimulatory effects, signalling and binding cascade, metabolism, and maintaining tissue integrity and physiological condition. Besides, potential protein biomarkers related to the immune system were identified, which could be associated with the disease‐resistant phenotype. These data provide insights into the underlying immune mechanism of hybrid groupers upon Vibrio sp. infection. [ABSTRACT FROM AUTHOR]

The dusky grouper (Epinephelus marginatus) is a vulnerable predatory fish found in the Atlantic and Indian oceans, and in the Mediterranean Sea. This study investigates the movement patterns of grouper larvae (151 individuals) during their first feeding period (three to ten days post hatching) through laboratory experiments offering rotifers (Brachionus sp.) and copepod nauplii as food. High-speed cameras and imaging techniques including bright field microscopy, matched filters, and holography captured rapid displacements (up to 25 body lengths per second), peduncle caudal beats (up to 40 beats s−1), turns, and resting periods. Reynolds numbers ranged from <45 for routine swimming to 222 for burst swimming. Specific behaviors, including changes in swimming velocity and body movements, were observed from three days post hatching, when feeding begins, suggestive of an array of responses to environmental forcing, predator avoidance, food search, and feeding success. These findings provide insights into the critical movement performances of E. marginatus larvae, which help to unravel their ecological interactions and survival strategies. Understanding grouper larval swimming behavior is pivotal for devising effective cultivation strategies aimed at replenishing wild stocks and enhancing production for human consumption. [ABSTRACT FROM AUTHOR]

Although numerous coral reef fish species utilize substrates with high structural complexities as habitats and refuge spaces, quantitative analysis of nocturnal fish substrate associations has not been sufficiently examined yet. The aims of the present study were to clarify the nocturnal substrate associations of 17 coral reef fish species (nine parrotfish, two surgeonfish, two grouper and four butterflyfish) in relation to substrate architectural characteristics. Substrate architectural characteristics were categorized into seven types: (1) eave-like space, (2) large inter-branch space, (3) overhang by protrusion of fine branching structure, (4) overhang by coarse structure, (5) uneven structure without large space or overhang, (6) flat and (7) macroalgae. Overall, fishes were primarily associated with three architectural characteristics (eave-like space, large inter-branch space and overhang by coarse structure). The main providers of these three architectural characteristics were tabular and corymbose Acropora, staghorn Acropora, and rock. Species-specific significant positive associations with particular architectural characteristics were found as follows. For the nine parrotfish species, Chlorurus microrhinos with large inter-branch space and overhang by coarse structure; Ch. spilurus with eave-like space and large inter-branch space; Hipposcarus longiceps with large inter-branch space; Scarus ghobban with overhang by coarse structure; five species (Scarus forsteni, S. niger, S. oviceps, S. rivulatus and S. schlegeli) with eave-like space. For the two surgeonfish species, Naso unicornis with overhang by coarse structure; N. lituratus with eave-like space. For the two grouper species, Plectropomus leopardus with eave-like space; Epinephelus ongus with overhang by coarse structure. For the four butterflyfish species, Chaetodon trifascialis with eave-like space and large inter-branch space; C. lunulatus and C. ephippium with large inter-branch space; C. auriga showed no significant associations with any architectural characteristics. Four species (Ch. microrhinos, H. longiceps, S. niger and N. unicornis) also showed clear variations in substrate associations among the different fish size classes. Since parrotfishes, surgeonfishes and groupers are main fisheries targets in coral reefs, conservation and restoration of coral species that provide eave-like space (tabular and corymbose Acropora) and large inter-branch space (staghorn Acropora) as well as hard substrates with coarse structure that provide overhang (rock) should be considered for effective fisheries management in coral reefs. For butterflyfishes, coral species that provide eave-like space (tabular Acropora) and large inter-branch space (staghorn Acropora) should also be conserved and restored for provision of sleeping sites. [ABSTRACT FROM AUTHOR]

This study investigated the effect of adding the compound acidifiers on the intestine health of hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) fed diet with higher cottonseed protein concentrate (CPC). To assess the benefits of compound acidifiers helping CPC to replace more fish meal (FM) for hybrid grouper, five isonitrogen and isolipid experimental diets were formulated. The five diets consisted of a control diet (FM, 50%) and four experimental diets (27.5% FM, 27.27% CPC), each of which contained compound acidifiers to varying degrees (FCA0, FCA0.05, FCA0.1, and FCA0.2). Each diet was fed to three replicates of each group for 8 weeks. In the FCA0.05 group, the results demonstrated a statistically significant increase in protein efficiency ratio, lipid efficiency ratio, and the activity of digestive enzymes in the intestine (P < 0.05). In the FCA0.05 group, there was a clearly enhanced expression of anti‐inflammatory cytokines in the intestines (P < 0.05). In the FCA0.1 group, there may be an increase in the expression of important genes involved in fatty acid metabolism in the intestinal (P < 0.05). Appropriate compound acidifiers decreased the relative abundance of Vibrio and other harmful bacteria in the intestine flora that were brought by high CPC. In conclusion, when the hybrid grouper was given a diet containing more CPC, the FCA0.05 group was able to promote intestinal development, enhance digestive enzyme activity and feed consumption, raise antioxidant enzyme activity and anti‐inflammatory factor expression, and improve intestinal health. [ABSTRACT FROM AUTHOR]

Groupers, as a popular economic fish species, are now more frequently cultured in land-based facilities, however, traditional pond-farming methods are plagued by frequent disease outbreaks, unstable economic benefits, and environmental pollution. To explore a new farming mode for a grouper, an 80-day cultivation experiment was conducted using both a simulated pond system (SPS) and a recirculating aquaculture system (RAS). The research aims to evaluate the growth performance, health (pathogenic bacteria, intestinal microbiota), off-flavor compounds (geosmin, 2-methylisoborneol), and nutritional component (amino acids, fatty acid composition and content) of a hybrid grouper (Pinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) under different aquaculture systems. The results showed that the hybrid grouper in a RAS exhibited better growth performance; the concentration of Vibrio in the fish tissue in the RAS was significantly lower than that in the SPS. Moreover, the content of fresh amino acids in the RAS was significantly higher, and the levels of saturated fatty acids (SFAs) and w-6 polyunsaturated fatty acids (w-6PUFAs) were significantly higher in the RAS. This finding indicates the superior flavor and nutritional value of the grouper. These results prove that the RAS is suitable for the widespread cultivation of grouper. [ABSTRACT FROM AUTHOR]

Simple Summary: Ciguatera poisoning is a foodborne disease caused by the consumption of fish. Ciguatoxins are toxins produced by dinoflagellates. These microalgae attached to macroalgae are consumed by herbivorous fish, which are the prey of carnivorous fish that cause food outbreaks. The dusky grouper is a species capable of bioaccumulating ciguatoxins in its tissue and causing ciguatera in humans. This experiment consisted of studying the exposure of ciguatoxins in grouper through their diet, as occurs in the wild, through flesh naturally contaminated with ciguatoxins. This study of dietary exposure of ciguatoxins in grouper fish has allowed us to know the cytotoxic effects of the diet in this species and the fish's behavior against this toxic diet throughout the study time. Ciguatera is a foodborne disease caused by ciguatoxins (CTXs), produced by dinoflagellates (genera Gambierdiscus and Fukuyoa), which bioaccumulate in fish through the food web, causing poisoning in humans. Currently, the physiological mechanisms of the species with the highest amount of toxins in their adult stage of life that are capable of causing these poisonings are poorly understood. Dusky grouper (Epinephelus marginatus) is a relevant fishing species and is part of the CTX food chain in the Canary Islands. This study developed an experimental model of dietary exposure featuring adult dusky groupers with two diets of tissue naturally contaminated with CTXs (amberjack and moray eel flesh) with two different potential toxicities; both groups were studied at different stages of exposure (4, 6, 10, 12, and 18 weeks). The results showed that this species did not show changes in its behavior due to the provided feeding, but the changes were recorded in biochemical parameters (mainly lipid and hepatic metabolism) that may respond to liver damage and alterations in the homeostasis of the fish; more research is needed to understand histopathological and cytotoxic changes. [ABSTRACT FROM AUTHOR]

Interspecific hybridisation is common in aquaculture. The maturation of hybrids is an important issue for successive breeding and reducing the risk of genetic pollution if they escape from sea cages. This study examined the maturation of Kue-Tama, the hybrid of the longtooth grouper Epinephelus bruneus × giant grouper E. lanceolatus (LGGG) produced on 16 April 2014. We used 60 LGGG, five of which were treated with methyltestosterone (MT) and the others were not. We assessed the spermiation response (SpR) of all LGGG from March 2018 to May 2020 and sperm motility from September 2019 to May 2020. We also analysed seasonal fluctuations in plasma sex steroids (estradiol 17β [E2] and 11-ketotestosterone [11-KT]) and gonad histology from April 2018 to February 2019. We confirmed SpR in all MT-treated LGGG and in five out of 55 untreated LGGG. Some LGGG from both groups exhibited SpRs throughout the year. The spermatozoa from both groups showed vigorous motility. SpR in MT-treated LGGG occurred at low 11-KT levels (< 0.1 ng/ml), whereas that in untreated LGGG occurred at high levels (> 273.4 ng/ml). The E2 levels in a few LGGG without SpR increased significantly from September 2018 to February 2019. The April gonads were identified as ovaries without histological confirmation, whereas the July and September gonads were verified histologically. One of the three gonads collected in July 2019 contained vitellogenic oocytes. Our study demonstrated that male LGGG hybrids mature throughout the year and that females can undergo vitellogenesis in the subtropical waters and photoperiod conditions of Amami Islands. [ABSTRACT FROM AUTHOR]

The effects of microalgae Chlorella pyrenoidosa on the hybrid groupers' (Epinephelus lanceolatus♂ × E. fuscoguttatus♀) growth, gut microbiome, and transcriptome were examined in this study. Feeding trials with a duration of 15 days (15d) and 60 days (60d) were conducted on three experimental groups (n = 3) as follows: (T1) grouper fed with basal diet and reared in filtered seawater (control treatment); (T2) grouper fed with basal diet and reared in C. pyrenoidosa monoculture water (CMW); and (T3) grouper fed with basal diet partially replaced with 15% of dried C. pyrenoidosa (CRM) and reared in filtered seawater. The findings revealed that groupers reared 15d in T2 treatment (T2-15d) had a higher fat content, with an apparent shift of microbial composition and functional pathways in the gut. Groupers reared 60d in T2 treatment (T2-60d) displayed an increased NADH dehydrogenase and cytochrome c oxidases gene expression, indicating more robust oxidative phosphorylation activity and ATP production crucial for metabolic homeostasis. The reduction in the total amino acid content was also detected in groupers raised in T2-60d. Gastritis, enteritis, and lipid malabsorption syndrome were observed in groupers raised 60d in T3 treatment (T3-60d), with the condition likely due to a higher intake of omega-6 to omega-3 fatty acids ratio in groupers raised 15 days in T3 (T3-15d) and T3-60d. All signs of intestinal inflammation may arise from the inclusion of dried C. pyrenoidosa. Overall, outcomes from this study revealed that introducing live C. pyrenoidosa to the culture water is advantageous for digestion and enhances the energy metabolism of juvenile groupers. [ABSTRACT FROM AUTHOR]

Groupers are valuable economic fish in the southern sea area of China, but the threat of disease is becoming more and more serious. Vibrio harveyi, V. parahaemolyticus, and Singapore grouper iridovirus (SGIV) are three important pathogens that cause disease in groupers, and infection with either a single one or a mix of these pathogens poses a serious threat to the healthy development of grouper culture. To enhance the rapid diagnosis and screening in the early stages, it is necessary to develop rapid detection methods of these pathogens. To simultaneously and rapidly detect the three pathogens, in this study, we utilized the TolC of V. harveyi, DNAJ of V. parahaemolyticus, and RAD2 of SGIV as the target genes and established a triple visual loop-mediated isothermal amplification (LAMP) method. This LAMP method showed a detection time as fast as 30 min and a high sensitivity of 100 fg/μL. Moreover, this method exhibited strong specificity and no cross-reaction with seven types of Vibrio and Staphylococcus aureus, as well as five common viruses in aquatic animals. Then, the LAMP products were enzymically cut, and three characteristic strips were used to identify the pathogen species. The results of the clinical trials demonstrated that the method could accurately and specifically detect V. harveyi, V. parahaemolyticus, and SGIV in grouper tissues. In summary, this study successfully established a triple visual LAMP rapid detection method for V. harveyi, V. parahaemolyticus, and SGIV. The method offers several advantages including simple equipment, easy operation, rapid reaction, high specificity, high sensitivity, and visual results. It is suitable for the early and rapid diagnosis of groupers infected with V. harveyi, V. parahaemolyticus, and SGIV, thereby providing useful technical support for further application in the large-scale disease surveillance of aquaculture animals. [ABSTRACT FROM AUTHOR]

Simple Summary: The most prominent feature of coconut oil (CO) is that it contains over 80% saturated fatty acids and about 60% medium chain fatty acids of total fatty acids. With these characteristics, CO shows many health benefits, but concerns about the risk of cardiovascular disease still remain in dispute. So far, there has been limited research on the potential use of CO in aquafeeds, being used as an alternative to fish oil (FO), and inconsistent results were presented. Therefore, we performed an experiment to investigate the effects of CO replacing FO on the growth performance of the orange-spotted grouper (Epinephelus coioides) in an attempt to determine its potential use and pertinent lipid metabolic mechanism in the fish species. Results show that CO could completely replace FO without affecting the growth performance, but high CO feeding will compromise the liver lipid deposit and long chain polyunsaturated fatty acids reduction of fish flesh in orange-spotted groupers. In this study, we conducted an 8-week feeding trial to investigate the effects of replacing fish oil (FO) with coconut oil (CO) on the growth performance, blood components, tissue fatty acid (FA) profile, and mRNA levels of genes related to lipid metabolism in the liver of the orange-spotted grouper (Epinephelus coioides). Five isolipidic and isoproteic diets were formulated through increasing the CO levels (0, 25%, 50%, 75%, and 100%, respectively). Triplicate groups of twenty-five fish (initial wet weight of about 22.4 g/fish) were fed one of the diets twice daily to apparent satiety. The 25% CO diet had the highest growth rate and feed utilization, and the 100% CO diet exhibited a comparable growth and feed utilization with that of the control diet, indicating a suitable FO substitute. Moreover, the hepatosomatic index, intraperitoneal fat rate, liver lipid content, as well as the serum HDL-C content and ALT activity had positive linear and/or quadratic responses, but the serum TC and LDL-C contents exhibited the opposite trend, with an increasing CO inclusion level. The FA profile in the liver and muscle generally mirrored the FA profile in the feed. Furthermore, the mRNA levels of the fas, acc, g6pd, srebp-1c, and δ6fad genes in the liver had positive linear and/or quadratic responses, but the mRNA levels of elovl 4 and elovl 5 had the opposite trend, with increasing dietary CO inclusion levels. When compared with the control diet, 25% and 50% CO diets up-regulated the mRNA levels of cpt 1, while the 75% and 100% CO diets down-regulated its mRNA levels. The hsl and atgl were down-regulated through the addition of dietary CO. The mRNA level of lpl was not affected by dietary treatments. Results showed that CO could completely replace FO without affecting growth performance, but high CO will lead to the significant liver lipid deposition and lower LC-PUFAs contents of fish flesh. [ABSTRACT FROM AUTHOR]

Misty Groupers (Hyporthodus mystacinus) are one of the largest and most geographically widespread grouper species and one of the few grouper species known to occur at depths greater than 200 m. However, aspects of their basic biology, behavior, and ecology remain poorly understood, leaving significant gaps in our ability to evaluate their functional role throughout the vertical water column, as well as our understanding of their conservation needs in a changing ocean. Through in-situ video observation obtained using deep-sea landers in both The Bahamas and Cayman Islands over multiple years, we documented Misty Grouper occurrence up to 470 m depth in the mesopelagic zone. These observations provide a new depth range extension for the species and illuminate the potential importance of deep-water habitats for large grouper species in the wider Caribbean. [ABSTRACT FROM AUTHOR]

The present study investigated the biosensitivity of Epinephelus coioides spermatozoa under various ionic and osmolality conditions. Activation and sensitivity of sperm started at different pH (7, 7.5, 8, 8.5, and 9) level. The highest motility duration was obtained in pH 8.5 with a significant difference to other groups (P <.001). The E. coioides spermatozoa exposed to 600 mM NaCl solution, 300 mM KCl (in the medium containing 200 mM sucrose), and sucrose solutions with 1100 mosmol/kg osmolality had significantly higher duration of motility than those exposed to solutions with the lower amount of NaCl, KCl and osmolality. Any amount greater than 600 mM NaCl, 300 mM KCl and 1100 mosmol/kg osmolality showed a remarkable reduction in the motility of spermatozoa. Results also showed that the amount of 100 and 450 mM K+, and osmolality lower than 400 mosmol/kg had a significant inhibitory effect and prevented the activity of spermatozoa. The findings of this study showed that changes in K+, Na+ and osmolality of the external solutions affects the spermatozoa and its motility. The potential use of these ions could be applicable for the improvement of the spermatozoa quality of E. coioides during artificial reproduction. [ABSTRACT FROM AUTHOR]

The giant grouper fish (Epinephelus lanceolatus), one of the largest and rarest groupers, is a fast-growing economic fish. Grouper sperm is often used for cross-breeding with other fish and therefore sperm cryopreservation is important. However, freezing damage cannot be avoided. Herein, we performed a transcriptome analysis to compare fresh and frozen sperm of the giant grouper with frozen storage times of 0, 23, 49, and 61 months. In total, 1911 differentially expressed genes (DEGs), including 91 in El-0-vs-El-23 (40 upregulated and 51 downregulated), 251 in El-0-vs-El-49 (152 upregulated and 69 downregulated), and 1569 in El-0-vs-El-61 (984 upregulated and 585 downregulated), were obtained in the giant grouper sperm. DEGs were significantly increased at 61 months of cryopreservation (p < 0.05). GO and KEGG enrichment analyses of the DEGs revealed significant enrichment in the pilus assembly, metabolic process, MAPK signaling pathway, apoptosis, and P53 signaling pathway. Time-series expression profiling of the DEGs showed that consistently upregulated modules were also significantly enriched in signaling pathways associated with apoptosis. Four genes, scarb1, odf3, exoc8, and atp5f1d, were associated with mitochondria and flagella in a weighted correlation network analysis. These genes may play an important role in the response to sperm freezing. The experimental results show that long-term cryopreservation results in freezing damage to the giant grouper sperm. This study provides rich data for studies of the mechanism underlying frozen fish sperm damage as well as a technical reference and evaluation index for the long-term cryopreservation of fish sperm. [ABSTRACT FROM AUTHOR]

The study calculated the Length-Based Spawning Potential Ratio (LB-SPR) for several species, including red grouper (Epinephelus morio), black grouper (Mycteroperca bonaci), gag grouper (M. microlepis), yellowtail snapper (Ocyurus chrysurus), lane snapper (Lutjanus synagris), hogfish (Lachnolaimus maximus), and white grunt (Haemulon plumierii). Data were obtained from the small-scale commercial fleet operating in the red grouper fishery on the Campeche Bank within the Yucatan Peninsula. Monthly records of total length (cm) from April 2017 to May 2018, totaling 10,182 fish, were collected from five fishing ports along the Yucatan Peninsula coast. Biological data, such as growth and reproductive patterns and exploitation parameters were gathered from scientific literature. The LB-SPR package on the R Core Team platform was utilized for analysis. Despite being the largest, groupers exhibited immaturity ( SL 50 < L 50 ) and low Spawning Potential Ratio (SPR). Red and black groupers showed particularly low SPR values (0.10 and 0.05, respectively), indicating a looming risk of local extinction. The gag grouper achieved the highest SPR value (0.26) among groupers, although it was very close to the minimum critical value (i.e., 0.20). Snappers, hogfish, and white grunt were generally captured in the adult state ( SL 50 > L 50 ). Yellowtail, hogfish, and white grunt displayed high SPR values (0.44, 0.72, and 0.98, respectively). Lane snapper had a low SPR (0.28) but fell within the range for maintaining satisfactory stock productivity, albeit with reduced yields. The findings emphasize the urgent need to adjust the current management framework for the red grouper fishery, focusing on improving fishing gear selectivity to address heightened pressure on both juvenile groupers and adult lane snapper. Implementing these measures is crucial to mitigate the risks of local extinction and population decline for each species. [ABSTRACT FROM AUTHOR]

To determine the optimal temperature in rearing of fry stream groupers, Acrossocheilus fasciatus, a total of 540 fry fish with an initial body weight of (0.57 ± 0.16) g, and body length of (4.08 ± 0.40) cm were randomly distributed to 18 15‐L tanks and reared at six different temperatures (12, 16, 20, 24, 26, and 28°C) for a period of 60 days. Fish were hand‐fed to satiation under all six different temperature treatments. At the end of the experiment, almost all the growth, feeding, and gonadal development parameters were higher in the 26°C group than in the rest of the groups. As temperature increased from 12 to 26°C, the specific growth rate and feeding efficiency of fry significantly increased (p < 0.05). When temperature reached 28°C, these parameters were significantly lower than in the 26°C group (p < 0.05). The histological structure of the gonads showed that in the 26°C group, a large number of sperm cells resided in the testis in a free condition, and many yolk granules aggregated together and formed plates in the ovary. This histological information indicated that the gonadal maturity of fish in the 26°C group was higher than that of the other groups. Thus showing a turning point of growth, feeding, and gonadal development in the 26°C group. In relation to the nutritive compositions of muscle tissue, fish reared at 16°C exhibited the highest content of amino acids and fatty acids. These parameters significantly (p < 0.05) decreased as the temperature increased from 16 to 28°C. The proportion of essential amino acids (EAA/NEAA) and unsaturation of fatty acids (∑UFA/FA) did not show significant temperature influence (p > 0.05). In conclusion, increases in temperature significantly improved the growth rate, feeding performance, and gonadal development rate of fry A. fasciatus. Regression analysis based on growth and feeding performance showed that the optimal temperature of rearing fry A. fasciatus was 23.81–26.57°C. [ABSTRACT FROM AUTHOR]

Growth selection in fish is essential for aquaculture; however, long generation times and artificial breeding limitations present challenges for breeding endeavors. The tomato grouper (Cephalopholis sonnerati) is an emerging aquaculture species with a generation cycle of at least 5 to 10 years. Mixed culture of broodstocks and natural mating are commonly employed in hatcheries. To expedite the selection process for tomato grouper, we utilized ISSRseq technology for assisted future growth selection. After 6 months of rearing, we selected 48 individuals, including 24 fast‐growing and 24 slow‐growing individuals (representing the top and bottom 10% of samples). These samples produced 932 SNPs. Although specific broodstock pairing information is unavailable, our results suggest that these fry likely originated from multiple broodstock exhibiting considerable diversity. Further analysis of genetic relationships among individuals revealed three main clades. One clade contained a higher proportion of faster‐growing individuals (80%), while another featured a lower proportion of rapidly growing individuals (28.6%). Through the relatedness network and further exclusion of individuals, the faster‐growth clade comprised 92.3% of fast‐growing individuals. The faster‐growth clade is appropriate for further development into a high‐growth strain. Our findings demonstrate that molecular markers can advance population selective breeding to family selection in aquaculture breeding research. [ABSTRACT FROM AUTHOR]

Microsporidia of the Glugea sp. were looked at under a light microscope in the Wavy-Lined Grouper (Epinephelus undulosus). The present study aimed to isolate and identify the microsporidian from fish. In the present study, fish gut samples of Wavy-Lined Grouper (Epinephelus undulosus) were collected from the Parangipettai landing centre and the parasite was located in the fish's internal organs. Spherical blackish xenomas ranged from different pyloric caeca and intestine sizes, such as 1.22 mm, 1.43 mm, 0.95 mm, 1.03 mm, and 1.28 mm to 1.41 mm. The largest xenoma ranged in size from 2.10 mm to 0.39 mm in diameter, surrounded by a layer of connective tissue. The observed and mm characteristics of the parasite align with those of the other Glugea sp. Based on these traits, it seemed likely that the microsporidian that infected Epinephelus Undulosus in this study was Glugea sp. [ABSTRACT FROM AUTHOR]

Globally, groupers (Serranidae) are commercially important fish species. Hybridization within this family has been reported in captivity and natural environments, usually among congeneric species. However, intergeneric hybridization has been reported only occasionally. Given the commercial interest in these fish, artisanal or recreational fishermen easily notice "weird-looking" individuals. This is the case of an unidentified grouper noticed by a spearfisher in Lebanese Mediterranean waters. Visual comparisons raised the possibility that the observed specimen was a hybrid. Molecular analysis based on two mitochondrial and three nuclear markers was performed to investigate this potential hybrid's affinity. The discordance of the phylogenetic gene trees of the mitochondrial and nuclear markers indicates that E. marginatus and M. rubra are potential parent species of a hybrid individual in our samples. The subsequent haploweb analysis based on the S7 nuclear marker reveals the affinity of the hybrid individual to both E. marginatus and M. rubra. In this specific hybridization case, the nuclear marker S7 emerges as a valuable diagnostic tool for species delineation and hybrid detection. [ABSTRACT FROM AUTHOR]

Groupers are among the fish groups that are difficult to recognize due to their high morphological similarities. Therefore, molecular techniques, particularly DNA barcoding, are extensively utilized to differentiate this fish group. This study aimed to analyze and validate six grouper species belonging to the Epinephelidae family that were harvested from Langsa district waters in Aceh province, Indonesia, based on DNA barcode data. It was conducted from June to December 2021, with the fish specimens collected from fishers at fish landing sites and the fish market in Langsa City, Aceh province. A total of 22 grouper sequences belonging to six species were generated, namely Epinephelus coioides, E. bleekeri, E. malabaricus, E. erythrurus, E. sexfasciatus and Mycteroperca poecilonotus (formerly Epinephelus poecilonotus). Genetic distance within these species ranged from 0.10 to 0.73% (average: 0.40%). Notably, E. malabaricus and E. coioides exhibited the closest genetic kinship (4.07%), while E. sexfasciatus and M. poecilonotus displayed the greatest genetic distance (19.33%). This study provides the first DNA reference for grouper in Langsa district, Indonesia, with significant implications for future sustainable grouper management. [ABSTRACT FROM AUTHOR]

Enterospora epinepheli is an intranuclear microsporidian parasite causing serious emaciative disease in hatchery‐bred juvenile groupers (Epinephelus spp.). Rapid and sensitive detection is urgently needed as its chronic infection tends to cause emaciation as well as white faeces syndrome and results in fry mortality. This study established a TaqMan probe‐based real‐time quantitative PCR assays targeting the small subunit rRNA (SSU) gene of E. epinepheli. The relationship between the standard curve of cycle threshold (Ct) and the logarithmic starting quantity (SQ) was determined as Ct = −3.177 lg (SQ) + 38.397. The correlation coefficient (R2) was 0.999, and the amplification efficiency was 106.4%. The detection limit of the TaqMan probe‐based qPCR assay was 1.0 × 101 copies/μL and that is 100 times sensitive than the traditional PCR method. There is no cross‐reaction with other aquatic microsporidia such as Ecytonucleospora hepatopenaei, Nucleospora hippocampi, Potaspora sp., Ameson portunus. The intra‐assay and inter‐assay showed great repeatability and reproducibility. In addition, the test of clinical samples showed that this assay effectively detected E. epinepheli in the grouper's intestine tissue. The established TaqMan qPCR assays will be a valuable diagnostic tool for the epidemiological investigation as well as prevention and control of E. epinepheli. [ABSTRACT FROM AUTHOR]

Animal body size variation is of particular interest in evolutionary biology, but the genetic basis remains largely unknown. Previous studies have shown the presence of two parallel evolutionary genetic clusters within the fish genus Epinephelus with evident divergence in body size, providing an excellent opportunity to investigate the genetic basis of body size variation in vertebrates. Herein, we performed phylotranscriptomic analysis and reconstructed the phylogeny of 13 epinephelids originating from the South China Sea. Two genetic clades with an estimated divergence time of approximately 15.4 million years ago were correlated with large and small body size, respectively. A total of 180 rapidly evolving genes and two positively selected genes were identified between the two groups. Functional enrichment analyses of these candidate genes revealed distinct enrichment categories between the two groups. These pathways and genes may play important roles in body size variation in groupers through complex regulatory networks. Based on our results, we speculate that the ancestors of the two divergent groups of groupers may have adapted to different environments through habitat selection, leading to genetic variations in metabolic patterns, organ development, and lifespan, resulting in body size divergence between the two locally adapted populations. These findings provide important insights into the genetic mechanisms underlying body size variation in groupers and species differentiation. [ABSTRACT FROM AUTHOR]

In the dynamic field of intensive aquaculture, the strategic application of probiotics has become increasingly crucial, particularly for enhancing resistance to environmental stressors such as ammonia-nitrogen. Over a 42-day period, this study investigated the effects of different probiotic strains—Bacillus subtilis (BS, 6-3-1, and HAINUP40)—on the health and resilience of hybrid groupers. Each strain, distinct in its origin, was assessed for its influence on growth performance, antioxidant capacity, immune gene expressions, and ammonia-nitrogen stress response in the hybrid grouper. The experimental design included a control group and three experimental groups, each supplemented with 1 × 108 CFU/g of the respective probiotic strains, respectively. Our results demonstrated notable differences in growth parameters, including final body weight (FBW) and feed conversion ratio (FCR). The 6-3-1 strain, originating from grouper, exhibited significant improvements in growth, oxidative capacity, and intestinal health. Conversely, the BS strain achieved the highest survival rates under ammonia-nitrogen stress, indicating its superior ability to regulate inflammatory responses despite its less pronounced growth-promoting effects. The HAINUP40 strain was distinguished for its growth enhancement and improvements in intestinal health, though it also showed significant activation of inflammatory genes and decreased resistance to ammonia-nitrogen stress after extended feeding. The uniqueness of this study lies in its detailed examination of the strain-specific effects of probiotics on fish in the context of ammonia-nitrogen stress, a significant challenge in contemporary aquaculture. The research revealed that host-derived probiotics, particularly the 6-3-1 strain, provided more comprehensive benefits for growth performance and stress resilience. In contrast, the BS and HAINUP40 strains exhibited varying efficiencies, with BS excelling in stress resistance and HAINUP40 promoting growth and gut health. In conclusion, this study underscores the complex roles of different probiotic strains in aquaculture, contributing to the understanding of probiotic applications and presenting new approaches to address the challenges of intensive farming. [ABSTRACT FROM AUTHOR]

Although numerous coral reef fish species utilize substrates with high structural complexities as habitats and refuge spaces, quantitative analysis of nocturnal fish substrate associations has not been sufficiently examined yet. The aims of the present study were to clarify the nocturnal substrate associations of 17 coral reef fish species (nine parrotfish, two surgeonfish, two grouper and four butterflyfish) in relation to substrate architectural characteristics. Substrate architectural characteristics were categorized into seven types: (1) eave-like space, (2) large inter-branch space, (3) overhang by protrusion of fine branching structure, (4) overhang by coarse structure, (5) uneven structure without large space or overhang, (6) flat and (7) macroalgae. Overall, fishes were primarily associated with three architectural characteristics (eave-like space, large inter-branch space and overhang by coarse structure). The main providers of these three architectural characteristics were tabular and corymbose Acropora, staghorn Acropora, and rock. Species-specific significant positive associations with particular architectural characteristics were found as follows. For the nine parrotfish species, Chlorurus microrhinos with large inter-branch space and overhang by coarse structure; Ch. spilurus with eave-like space and large inter-branch space; Hipposcarus longiceps with large inter-branch space; Scarus ghobban with overhang by coarse structure; five species (Scarus forsteni, S. niger, S. oviceps, S. rivulatus and S. schlegeli) with eave-like space. For the two surgeonfish species, Naso unicornis with overhang by coarse structure; N. lituratus with eave-like space. For the two grouper species, Plectropomus leopardus with eave-like space; Epinephelus ongus with overhang by coarse structure. For the four butterflyfish species, Chaetodon trifascialis with eave-like space and large inter-branch space; C. lunulatus and C. ephippium with large inter-branch space; C. auriga showed no significant associations with any architectural characteristics. Four species (Ch. microrhinos, H. longiceps, S. niger and N. unicornis) also showed clear variations in substrate associations among the different fish size classes. Since parrotfishes, surgeonfishes and groupers are main fisheries targets in coral reefs, conservation and restoration of coral species that provide eave-like space (tabular and corymbose Acropora) and large inter-branch space (staghorn Acropora) as well as hard substrates with coarse structure that provide overhang (rock) should be considered for effective fisheries management in coral reefs. For butterflyfishes, coral species that provide eave-like space (tabular Acropora) and large inter-branch space (staghorn Acropora) should also be conserved and restored for provision of sleeping sites.

This study investigated the effects of varying doses of dietary aflatoxin B1 (AFB1) on the growth, intestinal health, and muscle quality of hybrid grouper. Four diets with varying AFB1 concentrations (0, 30, 445, and 2,230 μg kg−1) were used. Elevating AFB1 concentrations led to a decline in growth indexes, specifically the weight gain rate and the specific growth rate, although the survival rate remained unchanged. Morphological indicators showed a dose-dependent decline with AFB1 exposure. Intestinal MDA content and hindgut reactive oxygen species (ROS) levels increased, while antioxidant indexes and digestive enzymes decreased with higher AFB1 levels. AFB1 negatively influenced hindgut tight junction protein and antioxidant-related gene expression while promoting inflammation-related gene expression. The presence of AFB1 in the experiment led to a decrease in beneficial intestinal bacteria, such as Prevotella, and an increase in harmful intestinal bacteria, such as Prevotellaceae_NK3B31_group. Muscle lipid and unsaturated fatty acid content significantly decreased, while muscle protein and liver AFB1 content increased dramatically with higher AFB1 concentrations. AFB1 caused myofibrillar cleavage and myofilament damage, leading to increased spaces between muscle fibers. In conclusion, diets with AFB1 levels exceeding 30 μg kg−1 inhibited hybrid grouper growth, while levels surpassing 445 μg kg−1 resulted in hindgut ROS accumulation, inflammation, elevated intestinal permeability, reduced digestive enzyme activity, and compromised muscle quality. [ABSTRACT FROM AUTHOR]

This study examined the effects of L-carnitine (LC) supplementation in corn gluten meal (CGM) diets for juvenile hybrid grouper on growth, immunity, lipid metabolism, and metabolomic analysis to discover possible biomarkers and metabolites (UPLC-MS) with the aid of ultra-performance liquid chromatography-mass spectrometry. With LC levels of 0, 200, 400, 600, 1200, 1400, and 1600 mg/kg, 630 juvenile hybrid groupers with an initial weight average of 13.7 ± 0 0.09 g were randomly divided into seven groups. These groups were named control group LC0 (FM diets without LC), LC0.2, LC0.4, LC0.6, LC1.2, LC1.4, and LC1.6 respectively. Fish fed LC0.2 diets had higher final weight, weight gain (WG), and condition factor (CF) than the control group after a feeding trial for 56 days. However, they were not substantially different from the control group. Fish fed LC0.2 had the highest values of 368.09% and 1.69 g/cm3 for WG, and CF, respectively. With rising dietary LC levels, antioxidant parameters such as glutathione peroxidase (GSH-Px) in the liver substantially increased and then decreased (P < 0.05). Superoxide dismutase (SOD) and total antioxidant capacity (T-AOC), however, were unaffected (P < 0.05). Fish fed the LC0.2 diet had significantly greater pparα mRNA expression compared to fish fed the basal diet (LC0) in terms of gene expression related to lipid metabolism. Bile secretion, ABC transporters, and glycerophospholipid have been identified as the differential metabolites in the distal gut of fish, with an upregulation occurring after feeding with experimental diets. Based on the findings of the current study, we propose that LC level of 200 mg/kg in CGM diets increases fish growth and immunity and regulates hepatic metabolism. [ABSTRACT FROM AUTHOR]

Astaxanthin (ASX) shows strong antioxidant property and is widely used as a fish feed additive. However, the underlying molecular mechanism of how ASX improves the ability of fish to resist bacterial infection remains largely unknown. To investigate the effects of dietary ASX from Haematococcus pluvialis on pearl gentian grouper, transcriptome combined with intestinal microbe analysis was conducted. The results of RNA-Seq analysis demonstrated that compared with the control group, the differently expressed genes of ASX-treated group were enriched in AMPK, autophagy, HIF-1, and PI3K-Akt signaling pathway. 16 s rDNA of intestinal microbiota analysis revealed that the dominant bacteria in the intestine of fish fed with ASX were Proteobacteria and Bacteroidetes. Moreover, ASX-fed significantly reduced the level of reactive oxygen species (ROS) and NF-κb mRNA expression in fish with bacterial infection. ASX treatment also prolonged the survival time of fish in the infection condition. Our work reveals that ASX systematically improves the antibacterial ability of grouper by regulating AMPK, autophagy, HIF-1, and PI3K-Akt signaling pathway and assisting in the colonization of intestinal dominant flora. [ABSTRACT FROM AUTHOR]

The purpose of this study was to investigate the effects of dietary Saccharina japonica and Pyropia yezoensis hydrolysates (Sj and Py) treatment on the growth, biochemistry, and immunity of hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatu♂). The adding 0.1% of Sj and Py to the diet (SjE and PyE) was fed to hybrid grouper for 8 weeks, respectively. The results showed that the SjE and PyE feeding have the potential to significantly improve fish weight gain, survival rate, and specific PyE could reduce the content of triglycerides and high-density lipoprotein cholesterol to maintain body health. SjE and PyE could improve immunity enzyme LZM, AKP, and ACP and increase the activity of digestion enzyme PR and AMS and antioxidant enzyme SOD. In addition, SjE and PyE may reduce the conditionally pathogenic bacteria and increase the probiotics content, and improve nutrient uptake in the intestines. In an 8-day challenge experiment, SjE and PyE improved fish survival, increased specific immune indices, and improved intestinal morphology and resistance to Vibrio harveyi. Sj and Py can be new aquafeed additives for aquatic animals, which can effectively improve aquatic disease problems. [ABSTRACT FROM AUTHOR]

The global exploration of evolutionary trends in groupers, based on mitogenomes, is currently underway. This research extensively investigates the structure of and variations in Cephalopholis species mitogenomes, along with their phylogenetic relationships, focusing specifically on Cephalopholis taeniops from the Eastern Atlantic Ocean. The generated mitogenome spans 16,572 base pairs and exhibits a gene order analogous to that of the ancestral teleost's, featuring 13 protein-coding genes (PCGs), two ribosomal RNA genes (rRNAs), 22 transfer RNA genes (tRNAs), and an AT-rich control region. The mitogenome of C. taeniops displays an AT bias (54.99%), aligning with related species. The majority of PCGs in the mitogenome initiate with the start codon ATG, with the exceptions being COI (GTG) and atp6 (TTG). The relative synonymous codon usage analysis revealed the maximum abundance of leucine, proline, serine, and threonine. The nonsynonymous/synonymous ratios were <1, which indicates a strong negative selection among all PCGs of the Cephalopholis species. In C. taeniops, the prevalent transfer RNAs display conventional cloverleaf secondary structures, except for tRNA-serine (GCT), which lacks a dihydrouracil (DHU) stem. A comparative examination of conserved domains and sequence blocks across various Cephalopholis species indicates noteworthy variations in length and nucleotide diversity. Maximum likelihood, neighbor-joining, and Bayesian phylogenetic analyses, employing the concatenated PCGs and a combination of PCGs + rRNAs, distinctly separate all Cephalopholis species, including C. taeniops. Overall, these findings deepen our understanding of evolutionary relationships among serranid groupers, emphasizing the significance of structural considerations in mitogenomic analyses. [ABSTRACT FROM AUTHOR]

The giant grouper (Epinephelus lanceolatus) is the largest reef fish in the Indo‐Pacific (~2.5 m TL, >400 kg), and it is highly susceptible to overfishing. Despite regional protections and documented population declines, the species is listed by IUCN as Data Deficient due to minimal long‐term population data and a paucity of life history information. This study used historical fishing records derived from newspaper articles, fishing magazines, grey literature and naturalists' descriptions to collate life history information and reconstruct giant grouper population trends from 1854 to 1958 in Queensland, Australia. Historical recreational catch trends of four biologically distinct grouper size classes demonstrated that over 92 years, fishing disproportionately affected two size classes: immature (fish below reproductive size) and mature individuals. Changes in the probability of capturing a grouper within a recreational fishery were examined as a proxy of relative abundance. The probability of catching a giant grouper within a popular recreational fishery significantly declined from 81% in 1860 to 2% in 1958. Further analysis based on a non‐probabilistic method of giant grouper sighting records showed fluctuations in the giant grouper population trajectory, from a steady decline during the early 20th century to an increase during WWII (1939–1945) followed by a reduction in the last half of the 20th century. This study highlights the importance of archival sources to uncover population trends of rare species by combining quantitative assessments and biological inferences to determine the timing and occurrence of population declines and recoveries and inform how vulnerable fish species respond to the cumulative effects of fishing over time. [ABSTRACT FROM AUTHOR]

Despite the considerable research effort devoted to witnessing the reproduction of the emblematic dusky grouper, Epinephelus marginatus, the underwater spawning event has rarely been observed. In this study, we document for the first time the spawning event of the dusky grouper in the Marine Protected Area (MPA) of Cabo de Palos-Islas Hormigas (SE Iberian Peninsula, Spain), which represents the first direct spawning record of the species in the last 20 years. The reproductive event occurred on a seamount located within the buffer protection zone of the MPA. On the evening of July 27, 2021, the spawning of two individuals, displaying silverstreaked (male) and uniformly dark (female) colour patterns, was observed using SCUBA diving. The event was filmed and information on the environmental conditions in which reproduction occurred was collected. Successful spawning was documented at dusk, just one minute before sunset, three days after the full moon and with almost no current. In line with published data, our observation supports sea water temperature and photoperiod as primary potential triggers of dusky grouper reproduction in the Mediterranean. The confirmation of grouper reproduction within a well-enforced MPA established more than 25 years ago suggests that the survival and reproductive output of this large predatory fish may be favoured by protection measures, stressing the critical role of MPAs for maintaining a viable population of this valuable species. [ABSTRACT FROM AUTHOR]

Investigations into the correlation between growth characteristics and DNA methylation levels, along with genetic variations, can provide fundamental insights to enhance growth performance in groupers. The Myostatin (mstn) gene plays a vital role in regulating skeletal muscle development and growth. This study scrutinized the DNA methylation levels of the mstn gene across hybrid groupers (E. fuscoguttatus (♀) × E. polyphekadion (♂)) and their parental species, to evaluate its impact on growth attributes in grouper fish. The nucleotide sequence of the mstn gene was directly sequenced in the hybrid grouper, exhibiting different growth performance to identify the single nucleotide polymorphisms (SNPs) of the mstn gene and explore their correlation with growth characteristics. The findings revealed no significant differences in global DNA methylation levels within muscle tissue among the hybrid grouper and parents. However, significant differences in DNA methylation sites were discovered between the hybrid grouper and E. polyphekadion at sites 824 and 1521 (located at exon 2 and intron 2, respectively), and between E. fuscoguttatus and E. polyphekadion at site 1521. These variations could potentially influence the mRNA expression of the mstn gene. The study also identified that SNP g.1003 T > C in exon 2 of the mstn gene was significantly associated with various growth traits including body weight, total length, body length, head length, caudal peduncle height, and body height (p < 0.01). Specimens with the TT genotype at site 1003 demonstrated superior growth performance compared to those with the TC genotype. Furthermore, microstructural analyses of muscle tissue showed that the average area and diameter of muscle fibers in TT genotype individuals were significantly greater than those in TC genotype individuals. Therefore, this research provides robust evidence linking the DNA methylation level and polymorphisms of the mstn gene with growth traits, which could be beneficial for grouper breeding programs. [ABSTRACT FROM AUTHOR]

Background: Hybridization is a useful strategy to produce offspring with more desirable phenotypic characteristics than those of parents. The hybrid grouper derived from the cross of Cromileptes altivelis (♀, 2n = 48) with Epinephelus lanceolatus (♂, 2n = 48) exhibits improved growth compared with its female parent, which makes it valuable to aquaculture. However, the genetic traits of the hybrid grouper are poorly understood. Results: The observations showed that the hybrid grouper was diploid (2n = 48) and displayed intermediate morphology with the parent's measurable characteristics. The ribosomal DNA (rDNA) and mitochondria DNA (mtDNA) were characterized at molecular and phylogenetic level. High similarity and low genetic distance of 5S rDNA and mtDNA sequences between the hybrid grouper and C. altivelis showed that the hybrid grouper had a closer genetic relationship with female parents. The reconstructed phylogenetic tree based on COI gene and D-loop region of mtDNA recovered that mtDNA was maternally inherited in the hybrid grouper. Additionally, the DNA methylation level of 5S rDNA intergenic spacers (IGS) sequence was tested in here. The results showed that the DNA methylation status of the hybrid grouper was significantly lower than that of C. altivelis. Conclusion: Results of this study provide important data on the genetic characteristics of the hybrid derived from the cross of C. altivelis and E. lanceolatus, and contribute the knowledge of both evolution and marine fish breeding. [ABSTRACT FROM AUTHOR]

The humpback grouper (Cromileptes altivelis), a medium-sized coral reef teleost, is a naturally rare species distributed in the tropical waters of the Indian and Pacific Oceans. It has high market value, but artificial reproduction and breeding remain limited and need to be improved. Here, we assembled the genome with 1.08 Gb, with a contig N50 of 43.78 Mb. A total of 96.59% of the assembly anchored to 24 pseudochromosomes using Hi-C technology. It contained 24,442 protein-coding sequences, of which 99.3% were functionally annotated. The completeness of the assembly was estimated to be 97.3% using BUSCO. The phylogenomic analysis suggested that humpback grouper should be classified into the genus Epinephelus rather than Cromileptes. The comparative genomic analysis revealed that the gene families related to circadian entrainment were significantly expanded. The high-quality reference genome provides useful genomic tools for exploiting the genomic resource of humpback grouper and supports the functional genomic study of this species in the future. [ABSTRACT FROM AUTHOR]