Search

Aim: The transcriptomes of seven diverse clonal human embryonic progenitor cell lines with chondrogenic potential were compared with that of bone marrow-derived mesenchymal stem cells (MSCs)., Materials & Methods: The cell lines 4D20.8, 7PEND24, 7SMOO32, E15, MEL2, SK11 and SM30 were compared with MSCs using immunohistochemical methods, gene expression microarrays and quantitative real-time PCR., Results: In the undifferentiated progenitor state, each line displayed unique combinations of site-specific markers, including AJAP1, ALDH1A2, BMP5, BARX1, HAND2, HOXB2, LHX1, LHX8, PITX1, TBX15 and ZIC2, but none of the lines expressed the MSC marker CD74. The lines showed diverse responses when differentiated in the presence of combinations of TGF-β3, BMP2, 4, 6 and 7 and GDF5, with the lines 4D20.8, SK11, SM30 and MEL2 showing osteogenic markers in some differentiation conditions. The line 7PEND24 showed evidence of regenerating articular cartilage and, in some conditions, markers of tendon differentiation., Conclusion: The scalability of site-specific clonal human embryonic stem cell-derived embryonic progenitor cell lines may provide novel models for the study of differentiation and methods for preparing purified and identified cells types for use in therapy.

Human pluripotent stem (hPS) cells are capable of differentiation into derivatives of all three primary embryonic germ layers and can self-renew indefinitely. They therefore offer a potentially scalable source of replacement cells to treat a variety of degenerative diseases. The ability to reprogram adult cells to induced pluripotent stem (iPS) cells has now enabled the possibility of patient-specific hPS cells as a source of cells for disease modeling, drug discovery, and potentially, cell replacement therapies. While reprogramming technology has dramatically increased the availability of normal and diseased hPS cell lines for basic research, a major bottleneck is the critical unmet need for more efficient methods of deriving well-defined cell populations from hPS cells. Phage display is a powerful method for selecting affinity ligands that could be used for identifying and potentially purifying a variety of cell types derived from hPS cells. However, identification of specific progenitor cell-binding peptides using phage display may be hindered by the large cellular heterogeneity present in differentiating hPS cell populations. We therefore tested the hypothesis that peptides selected for their ability to bind a clonal cell line derived from hPS cells would bind early progenitor cell types emerging from differentiating hPS cells. The human embryonic stem (hES) cell-derived embryonic progenitor cell line, W10, was used and cell-targeting peptides were identified. Competition studies demonstrated specificity of peptide binding to the target cell surface. Efficient peptide targeted cell labeling was accomplished using multivalent peptide-quantum dot complexes as detected by fluorescence microscopy and flow cytometry. The cell-binding peptides were selective for differentiated hPS cells, had little or no binding on pluripotent cells, but preferential binding to certain embryonic progenitor cell lines and early endodermal hPS cell derivatives. Taken together these data suggest that selection of phage display libraries against a clonal progenitor stem cell population can be used to identify progenitor stem cell targeting peptides. The peptides may be useful for monitoring hPS cell differentiation and for the development of cell enrichment procedures to improve the efficiency of directed differentiation toward clinically relevant human cell types.

Aim: The identification of molecular markers that are upregulated in multiple tumor types could lead to novel diagnostic and therapeutic strategies. The authors screened a panel of RNAs prepared from diverse tumors and tumor cell lines, and compared them with normal tissues and cultured somatic cell types, in order to identify candidate genes expressed in a broad spectrum of tumor types., Materials & Methods: Gene expression microarray analysis was carried out on 128 individual tumor samples representing over 20 tumor types, 85 samples representing 31 diverse normal tissue types, 68 tumor cell lines and 97 diverse normal primary cell cultures. Genes were ranked for elevated expression across a large number and variety of tumors relative to normal tissues., Results & Conclusion: COL10A1 was identified as a gene with restricted expression in most normal tissues and elevated expression in many diverse tumor types. By contrast, COL10A1 expression was undetectable in the 68 tumor cell lines surveyed in this study. Immunofluorescence studies localized collagen, type X, α-1 (collagen X) staining to tumor vasculature in breast tumors, whereas the vasculature of normal breast tissue was either collagen X-negative or had markedly lower levels. The tumor microenvironment-specific expression of collagen X, together with its localization in the vasculature, may facilitate its use as a novel target for the diagnosis and treatment of diverse solid tumor types.

Aims: We screened 100 diverse human embryonic stem-derived progenitor cell lines to identify novel lines with chondrogenic potential., Materials & Methods: The 4D20.8 cell line was compared with mesenchymal stem cells and dental pulp stem cells by assessing osteochondral markers using immunohistochemical methods, gene expression microarrays, quantitative real-time PCR and in vivo repair of rat articular condyles., Results: 4D20.8 expressed the site-specific gene markers LHX8 and BARX1 and robustly upregulated chondrocyte markers upon differentiation. Differentiated 4D20.8 cells expressed relatively low levels of COL10A1 and lacked IHH and CD74 expression. Transplantation of 4D20.8 cells into experimentally induced defects in the femoral condyle of athymic rats resulted in cartilage and bone differentiation approximating that of the original tissue architecture. Relatively high COL2A1 and minimal COL10A1 expression occurred during differentiation in HyStem-C hydrogel with TGF-β3 and GDF-5., Conclusion: Human embryonic stem cell-derived embryonic progenitor cell lines may provide a novel means of generating purified site-specific osteochondral progenitor cell lines that are useful in research and therapy.

Copy number variation (CNV) is a common chromosomal alteration that can occur during in vitro cultivation of human cells and can be accompanied by the accumulation of mutations in coding region sequences. We describe here a systematic application of current molecular technologies to provide a detailed understanding of genomic and sequence profiles of human embryonic stem cell (hESC) lines that were derived under GMP-compliant conditions. We first examined the overall chromosomal integrity using cytogenetic techniques to determine chromosome count, and to detect the presence of cytogenetically aberrant cells in the culture (mosaicism). Assays of copy number variation, using both microarray and sequence-based analyses, provide a detailed view genomic variation in these lines and shows that in early passage cultures of these lines, the size range and distribution of CNVs are entirely consistent with those seen in the genomes of normal individuals. Similarly, genome sequencing shows variation within these lines that is completely within the range seen in normal genomes. Important gene classes, such as tumor suppressors and genetic disease genes, do not display overtly disruptive mutations that could affect the overall safety of cell-based therapeutics. Complete sequence also allows the analysis of important transplantation antigens, such as ABO and HLA types. The combined application of cytogenetic and molecular technologies provides a detailed understanding of genomic and sequence profiles of GMP produced ES lines for potential use as therapeutic agents., (Copyright © 2011 Elsevier B.V. All rights reserved.)

The R-spondin (Rspo) family of proteins consists of secreted cysteine-rich proteins that can activate beta-catenin signaling via the Frizzled/LRP5/6 receptor complex. Here, we report that targeted inactivation of the mouse Rspo2 gene causes developmental limb defects, especially in the hindlimb. Although the initiation of the expression of apical ectodermal ridge (AER)-specific genes, including fibroblast growth factor 8 (FGF8) and FGF4 occurred normally, the maintenance of these marker expressions was significantly defective in the hindlimb of Rspo2(-/-) mice. Consistent with the ligand role of R-spondins in the Wnt/beta-catenin signaling pathway, expression of Axin2 and Sp8, targets for beta-catenin signaling, within AER was greatly reduced in Rspo2(-/-) embryos. Furthermore, sonic hedgehog (Shh) signaling within the hindlimbs of Rspo2(-/-) mice was also significantly decreased. Rspo2 is expressed in the AER of all limb buds, however the stunted phenotype is significantly more severe in the hindlimbs than the forelimbs and strongly biased to the left side. Our findings strongly suggest that Rspo2 expression in the AER is required for AER maintenance likely by regulating Wnt/beta-catenin signaling.

The R-Spondin (RSpo) family of secreted proteins act as potent activators of the Wnt/beta-catenin signaling pathway. We have previously shown that RSpo proteins can induce proliferative effects on the gastrointestinal epithelium in mice. Here we provide a mechanism whereby RSpo1 regulates cellular responsiveness to Wnt ligands by modulating the cell-surface levels of the coreceptor LRP6. We show that RSpo1 activity critically depends on the presence of canonical Wnt ligands and LRP6. Although RSpo1 does not directly activate LRP6, it interferes with DKK1/Kremen-mediated internalization of LRP6 through an interaction with Kremen, resulting in increased LRP6 levels on the cell surface. Our results support a model in which RSpo1 relieves the inhibition DKK1 imposes on the Wnt pathway.

NTB-A is a CD2-related cell surface protein expressed primarily on lymphoid cells including B-lymphocytes from chronic lymphocytic leukaemia (CLL) and lymphoma patients. We have generated a series of monoclonal antibodies (mAbs) against NTB-A and assessed their therapeutic potential for CLL. Selective mAbs to NTB-A were further tested in functional complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicty (ADCC) assays in cell lines and B lymphocytes freshly isolated from CLL patients. While lower levels of NTB-A were detected in T and natural killer (NK) cells, CDC activity was demonstrated primarily in B cells isolated from CLL patients and B lymphoma cell lines. Knockdown of NTB-A by small interfering RNA in target cells results in lower cytotoxicity, demonstrating the specificity of the mAbs. Furthermore, anti NTB-A mAbs demonstrated anti-tumour activity against CA46 human lymphoma xenografts in nude mice and against systemically disseminated Raji human lymphoma cells in severe combined immunodeficient mice. Taken together, these results demonstrate NTB-A as a potential new target for immunotherapy of leukaemia and lymphomas.

Background & Aims: R-spondin 1 (Rspo1) is a novel epithelial mitogen that stimulates the growth of mucosa in both the small and large intestine., Methods: We investigated the therapeutic potential of Rspo1 in ameliorating experimental colitis induced by dextran sulfate sodium (DSS) or trinitrobenzene sulfonic acid (TNBS) as well as nonsteroidal anti-inflammatory drug-induced colitis in interleukin (IL)-10-deficient mice., Results: Therapeutic administration of recombinant Rspo1 protein reduced the loss of body weight, diarrhea, and rectal bleeding in a mouse model of acute or chronic DSS-induced colitis. Histologic evaluation revealed that Rspo1 improved mucosal integrity in both villus and/or crypt compartments in the small intestine and colon by stimulating crypt cell growth and mucosal regeneration in DSS-treated mice. Moreover, Rspo1 significantly reduced DSS-induced myeloperoxidase activity and inhibited the overproduction of proinflammatory cytokines, including tumor necrosis factor-alpha, IL-1alpha, IL-6, interferon-gamma, and granulocyte-macrophage colony-stimulating factor, in mouse intestinal tissue, indicating that Rspo1 may reduce DSS-induced inflammation by preserving the mucosal barrier function. Likewise, Rspo1 therapy also alleviated TNBS-induced interstitial inflammation and mucosal erosion in the mouse colon. Furthermore, Rspo1 substantially decreased the histopathologic severity of chronic enterocolitis by repairing crypt epithelium and simultaneously suppressing inflammatory infiltration in piroxicam-exposed IL-10(-/-) mice. Endogenous Rspo1 protein was localized to villus epithelium and crypt Paneth cells in mouse small intestine., Conclusions: Our results show that Rspo1 may be clinically useful in the therapeutic treatment of inflammatory bowel disease by stimulating crypt cell growth, accelerating mucosal regeneration, and restoring intestinal architecture.

Alfimeprase is a recombinant, direct-acting fibrinolytic zinc metalloprotease. Alfimeprase has direct proteolytic activity primarily against the fibrin(ogen) Aalpha chain. Alfimeprase is covalently bound and neutralised by serum alpha(2)-macroglobulin, a prevalent mammalian protease inhibitor. Preclinical pharmacology studies have shown that fibrinolysis with alfimeprase is up to sixfold more rapid than with select plasminogen activators, such as tissue-type plasminogen activator and urokinase. Alfimeprase directly delivered to a site of thrombosis has the potential to be a fast and effective fibrinolytic, which does not generate the systemic lytic state seen with plasminogen activators that is associated with major bleeding, including intracerebral haemorrhage. Phase I and II studies in individuals with arterial or venous thrombotic events indicate that alfimeprase is active and generally well tolerated.

We have discovered a family of small secreted proteins in Homo sapiens and Mus musculus. The IGF-like (IGFL) genes encode proteins of approximately 100 amino acids that contain 11 conserved cysteine residues at fixed positions, including two CC motifs. In H. sapiens, the family is composed of four genes and two pseudogenes that are referred as IGFL1 to IGFL4 and IGFL1P1 and IGFL1P2, respectively. Human IGFL genes are clustered together on chromosome 19 within a 35-kb interval. M. musculus has a single IGFL family member that is located on chromosome 7. Further, evolutionary analysis shows a lack of direct orthology between any of the four human members and the mouse gene. This relationship between the mouse and the human family members suggests that the multiple members in the human complement have arisen from recent duplication events that appear limited to the primate lineage. Structural considerations and sequence comparisons would suggest that IGFL proteins are distantly related to the IGF superfamily of growth factors. IGFL mRNAs display specific expression patterns; they are expressed in fetal tissues, breast, and prostate, and in many cancers as well, and this pattern is consistent with that of the IGF family members.

The R-spondin (Rspo) protein family is a recently described group of four distinct human secreted proteins. Reported activities for Rspo proteins include essential roles in vertebrate development and their ligand-type activities overlap substantially with those of the canonical Wnt ligands in that both Rspo and canonical Wnt signaling result in the activation of beta-catenin. In a general functional screen for human secreted proteins using transgenic mouse models, we identified human R-spondin1 (hRspo1) protein as a potent and specific mitogen for the gastrointestinal epithelium and demonstrated a potential therapeutic application for the protein in mouse models of cancer therapy-induced mucositis. In contrast to previous studies, our data indicated only partial overlap between Wnt and Rspo ligand activities, suggesting that there may be independent receptor/signaling pathways for Rspo proteins that intersect those of Wnt at the level of beta-catenin. Here we summarize the current reported data on the Rspo family and discuss these results in terms of alternate mechanisms of action. We have extended our observations on the potential therapeutic application of Rspo proteins by showing that all four human Rspo family members are capable of inducing epithelial proliferation and report the first non-vertebrate Rspo family member.

An emerging series of papers has identified new receptor proteins that predict seven-transmembrane pass topologies. We have consolidated this family to 11 human genes and have named the family PAQR, after two of the initially described ligands (progestin and adipoQ receptors). This protein family has ancient evolutionary roots, with identified homologs found in eubacteria. To date, published data indicate that the prokaryotic members of this family appear to encode hemolysin-type proteins, while in eukaryotes, PAQR proteins encode functional receptors with a broad range of apparent ligand specificities. We provide the complete human and mouse complement of this family, suggest a conserved structure/topology with invariant intracellular amino acid residues, and have measured mRNA expression levels for these genes across a range of human tissues.

Several described growth factors influence the proliferation and regeneration of the intestinal epithelium. Using a transgenic mouse model, we identified a human gene, R-spondin1, with potent and specific proliferative effects on intestinal crypt cells. Human R-spondin1 (hRSpo1) is a thrombospondin domain-containing protein expressed in enteroendocrine cells as well as in epithelial cells in various tissues. Upon injection into mice, the protein induced rapid onset of crypt cell proliferation involving beta-catenin stabilization, possibly by a process that is distinct from the canonical Wnt-mediated signaling pathway. The protein also displayed efficacy in a model of chemotherapy-induced intestinal mucositis and may have therapeutic application in gastrointestinal diseases.

The C-terminal domains of the A, B, C chains of C1q subcomponent of C1 complex represent a common structural motif, the C1q domain, that is found in a diverse range of proteins. We analyzed the human genome for the complete complement of this family and have identified a total of 31 independent gene sequences. The predominant organization of C1q-domain-containing (C1qDC) proteins includes a leading signal peptide, a collagen-like region of variable length, and a C-terminal C1q domain. There are 15 highly conserved residues within the C1q domain, among which 8 are invariant within the human gene set and these are predicted to cluster within the hydrophobic core of the protein. We suggest a 3-subfamily classification based on sequence homology. For some C1qDC-encoding genes, strict orthology has been retained throughout vertebrate evolution and these examples suggest a highly specific functional role for C1qDC proteins that has been under significant selective pressure. Alternatively, individual species have co-opted C1qDC proteins for roles that are highly specific to their biology, suggesting an evolutionary strategy of gene duplication and functional diversification. A more extensive analysis of the evolutionary relationship of C1qDC proteins reveals an ancient rooting, with clear members found in eubacterial species. Curiously, we have been unable to identify C1qDC-encoding genes in many eukaryotic genomcs, such as Sacchromyces cerivisae and C. elegans, suggesting that the retention or loss of this gene family throughout evolution has been sporadic.

Here we report the identification of a new insulin-like growth factor binding protein homologue, provisionally designated insulin-like growth factor binding related protein-4 (IGFBP-rP4). IGFBP-rP4 was found to be most closely related to IGFBP-7 with 52% amino acid homology and 43% amino acid identity, and shares a similar domain structure. Semi-quantitative RT-PCR expression analysis demonstrated a pattern of downregulation of this gene in multiple tumor samples including lung and colon cancer, compared to matched adjacent normal tissue. Western blotting revealed a protein of approximately 38kDa expressed in both the cell pellet and secreted into the supernatant of transiently transfected Cos-7 cells. Cos-7 supernatants containing IGFBP-RP4 protein were observed to suppress the growth of HeLa cells in culture compared to vector controls. IGFBP-RP4 directly transiently transfected into HeLa cells also further confirmed the growth suppressive properties of this protein. Together these data suggest that IGFBP-RP4 may be a novel putative tumor suppressor protein.

We have discovered a family of small secreted proteins in Homo sapiens and Mus musculus using a novel database searching strategy. The family is composed of five highly homologous genes referred to as TAFA-1 to -5. The TAFA genes encode proteins of approximately 100 amino acids that contain conserved cysteine residues at fixed positions. TAFA-1 to -4 are more closely related to each other than to TAFA-5, in which a conserved motif including CC in TAFA-1 to -4 is not present. In H. sapiens, TAFA-3 has two isoforms formed by alternative splicing. Sequence homology analyses reveal that TAFA proteins appear distantly related to MIP-1alpha, a member of the CC-chemokine family. TAFA mRNAs are highly expressed in specific brain regions, with little expression seen in other tissues.

Tankyrase (TANK1) is a human telomere-associated poly(ADP-ribose) polymerase (PARP) that binds the telomere-binding protein TRF1 and increases telomere length when overexpressed. Here we report characterization of a second human tankyrase, tankyrase 2 (TANK2), which can also interact with TRF1 but has properties distinct from those of TANK1. TANK2 is encoded by a 66-kilobase pair gene (TNKS2) containing 28 exons, which express a 6.7-kilobase pair mRNA and a 1166-amino acid protein. The protein shares 85% amino acid identity with TANK1 in the ankyrin repeat, sterile alpha-motif, and PARP catalytic domains but has a unique N-terminal domain, which is conserved in the murine TNKS2 gene. TANK2 interacted with TRF1 in yeast and in vitro and localized predominantly to a perinuclear region, similar to the properties of TANK1. In contrast to TANK1, however, TANK2 caused rapid cell death when highly overexpressed. TANK2-induced death featured loss of mitochondrial membrane potential, but not PARP1 cleavage, suggesting that TANK2 kills cells by necrosis. The cell death was prevented by the PARP inhibitor 3-aminobenzamide. In vivo, TANK2 may differ from TANK1 in its intrinsic or regulated PARP activity or its substrate specificity.

Reduced replicative capacity is a consistent characteristic of cells derived from patients with Werner syndrome. This premature senescence is phenotypically similar to replicative senescence observed in normal cell strains and includes altered cell morphology and gene expression patterns. Telomeres shorten with in vitro passaging of both WRN and normal cell strains; however, the rate of shortening has been reported to be faster in WRN cell strains, and the length of telomeres in senescent WRN cells appears to be longer than that observed in normal strains, leading to the suggestion that senescence in WRN cell strains may not be exclusively associated with telomere effects. We report here that the telomere restriction fragment length in senescent WRN fibroblasts cultures is within the size range observed for normal fibroblasts strains and that the expression of a telomerase transgene in WRN cell strains results in lengthened telomeres and replicative immortalization, thus indicating that telomere effects are the predominant trigger of premature senescence in WRN cells. Microarray analyses showed that mRNA expression patterns induced in senescent WRN cells appeared similar to those in normal strains and that hTERT expression could prevent the induction of most of these genes. However, substantial differences in expression were seen in comparisons of early-passage and telomerase-immortalized derivative lines, indicating that telomerase expression does not prevent the phenotypic drift, or destabilized genotype, resulting from the WRN defect.

The lifespan of human fibroblasts and other primary cell strains can be extended by expression of the telomerase catalytic subunit (hTERT). Since replicative senescence is accompanied by substantial alterations in gene expression, we evaluated characteristics of in vitro-aged dermal fibroblast populations before and after immortalization with telomerase. The biological behavior of these populations was assessed by incorporation into reconstituted human skin. Reminiscent of skin in the elderly, we observed increased fragility and subepidermal blistering with increased passage number of dermal fibroblasts, but the expression of telomerase in late passage populations restored the normal nonblistering phenotype. DNA microarray analysis showed that senescent fibroblasts express reduced levels of collagen I and III, as well as increased levels of a series of markers associated with the destruction of dermal matrix and inflammatory processes, and that the expression of telomerase results in mRNA expression patterns that are substantially similar to early passage cells. Thus, telomerase activity not only confers replicative immortality to skin fibroblasts, but can also prevent or reverse the loss of biological function seen in senescent cell populations., (Copyright 2000 Academic Press.)

Background: Limited replicative capacity is a defining characteristic of most normal human cells and culminates in senescence, an arrested state in which cells remain viable but display an altered pattern of gene and protein expression. To survey widely the alterations in gene expression, we have developed a DNA microarray analysis system that contains genes previously reported to be involved in aging, as well as those involved in many of the major biochemical signaling pathways., Results: Senescence-associated gene expression was assessed in three cell types: dermal fibroblasts, retinal pigment epithelial cells, and vascular endothelial cells. Fibroblasts demonstrated a strong inflammatory-type response, but shared limited overlap in senescent gene expression patterns with the other two cell types. The characteristics of the senescence response were highly cell-type specific. A comparison of early- and late-passage cells stimulated with serum showed specific deficits in the early and mid G1 response of senescent cells. Several genes that are constitutively overexpressed in senescent fibroblasts are regulated during the cell cycle in early-passage cells, suggesting that senescent cells are locked in an activated state that mimics the early remodeling phase of wound repair., Conclusions: Replicative senescence triggers mRNA expression patterns that vary widely and cell lineage strongly influences these patterns. In fibroblasts, the senescent state mimics inflammatory wound repair processes and, as such, senescent cells may contribute to chronic wound pathologies.

We have identified and cloned a cDNA encoding a new member of the monooxygenase family of enzymes. This novel enzyme, which we call MOX (monooxygenase X; unknown substrate) is a clear sequence homologue of the enzyme dopamine beta-hydroxylase (DBH). MOX maintains many of the structural features of DBH, as evidenced by the retention of most of the disulfide linkages and all of the peptidyl ligands to the active site copper atoms. Unlike DBH, MOX lacks a signal peptide sequence and therefore is unlikely to be a secreted molecule. The steady-state mRNA levels of MOX are highest in the kidney, lung, and adrenal gland, indicating that the tissue distribution of MOX is broader than that of DBH. Antisera raised to a fusion protein of MOX identifies a single band of the expected mobility by Western blot analysis. MOX mRNA levels are elevated in some fibroblast cell strains at replicative senescence, through this regulation is not apparent in all primary cell strains. The gene for MOX resides on the q arm of chromosome 6 and the corresponding mouse homolog has been identified.

Telomerase is a ribonucleoprotein enzyme with an essential RNA component. Embedded within the telomerase RNA is a template sequence for telomere synthesis. We have characterized the structure of the 5' regions of the human and mouse telomerase-RNA genes, and have found a striking difference in the location of the template sequence: Whereas the 5'-end of the human telomerase RNA lies 45 nt from the telomerase-RNA template sequence, the 5'-end of the mouse telomerase RNA lies just 2 nt from the telomerase-RNA template sequence. Analysis of genomic sequences flanking the 5'-end of the human and mouse telomerase RNA-coding sequences reveals similar promoter-element arrangements typical of mRNA-type promoters: a TATA box-like element and an upstream region containing a consensus CCAAT box. This putative promoter structure contrasts with that of the ciliate telomerase-RNA genes whose structure resembles RNA polymerase III U6 small nuclear RNA (snRNA) promoters. These and other comparisons suggest that, during evolution, both the RNA-polymerase specificity of telomerase RNA-gene promoters and, more recently, the position of the template sequence in the telomerase RNA changed.

Telomerase is a ribonucleoprotein that catalyzes telomere elongation through the addition of TTAGGG repeats in humans. Activation of telomerase is often associated with immortalization of human cells and cancer. To dissect the human telomerase enzyme mechanism, we developed a functional in vitro reconstitution assay. After removal of the essential 445 nucleotide human telomerase RNA (hTR) by micrococcal nuclease digestion of partially purified human telomerase, the addition of in vitro transcribed hTR reconstituted telomerase activity. The activity was dependent upon and specific to hTR. Using this assay, truncations at the 5' and 3' ends of hTR identified a functional region of hTR, similar in size to the full-length telomerase RNAs from ciliates. This region is located between positions 1-203. Furthermore, we found that residues 1-44, 5' to the template region (residues 46-56) are not essential for activity, indicating a minimal functional region is located between residues 44-203. Mutagenesis of full-length hTR between residues 170-179, 180-189 or 190-199 almost completely abolished the ability of the hTR to function in the reconstitution of telomerase activity, suggesting that sequences or structures within this 30 nucleotide region are required for activity, perhaps by binding telomerase protein components.

Eukaryotic chromosomes are capped with repetitive telomere sequences that protect the ends from damage and rearrangements. Telomere repeats are synthesized by telomerase, a ribonucleic acid (RNA)-protein complex. Here, the cloning of the RNA component of human telomerase, termed hTR, is described. The template region of hTR encompasses 11 nucleotides (5'-CUAACCCUAAC) complementary to the human telomere sequence (TTAGGG)n. Germline tissues and tumor cell lines expressed more hTR than normal somatic cells and tissues, which have no detectable telomerase activity. Human cell lines that expressed hTR mutated in the template region generated the predicted mutant telomerase activity. HeLa cells transfected with an antisense hTR lost telomeric DNA and began to die after 23 to 26 doublings. Thus, human telomerase is a critical enzyme for the long-term proliferation of immortal tumor cells.

Recently, a novel PCR-based technique, differential display (DD), has facilitated the study of differentially expressed genes at the mRNA level. We report here an improved version of DD, which we call Enhanced Differential Display (EDD). We have modified the technique to enhance reproducibility and to facilitate sequencing and cloning. Using EDD, we have generated and verified a catalog of genes that are differentially expressed between young and senescent human diploid fibroblasts (HDF). From 168 genetags that were identified initially, 84 could be sequenced directly from PCR amplified bands. These sequences represent 27 known genes and 37 novel genes. By Northern blot analysis we have confirmed the differential expression of a total of 23 genes (12 known, 11 novel), while 19 (seven known, 12 novel) did not show differential expression. Several of the known genes were previously observed by others to be differentially expressed between young and senescent fibroblasts, thereby validating the technique.

The gene encoding the human erythrocyte form of cytochrome b5 (97 residues in length) has been prepared by mutagenesis of an expression vector encoding lipase-solubilized bovine liver microsomal cytochrome b5 (93 residues in length) (Funk et al., 1990). Efficient expression of this gene in Escherichia coli has provided the first opportunity to obtain this protein in quantities sufficient for physical and functional characterization. Comparison of the erythrocytic cytochrome with the trypsin-solubilized bovine liver cytochrome b5 by potentiometric titration indicates that the principal electrostatic difference between the two proteins results from two additional His residues present in the human erythrocytic protein. The midpoint reduction potential of this protein determined by direct electrochemistry is -9 +/- 2 mV vs SHE at pH 7.0 (mu = 0.10 M, 25.0 degrees C), and this value varies with pH in a fashion that is consistent with the presence of a single ionizable group that changes pKa from 6.0 +/- 0.1 in the ferricytochrome to 6.3 +/- 0.1 in the ferrocytochrome with delta H degrees = -3.2 +/- 0.1 kcal/mol and delta S degrees = -11.5 +/- 0.3 eu (pH 7.0, mu = 0.10). The 1D 1H NMR spectrum of the erythrocytic ferricytochrome indicates that 90% of the protein binds heme in the "major" orientation and 10% of the protein binds heme in the "minor" orientation (pH 7.0, 25 degrees C) with delta H degrees = -2.9 +/- 0.3 kcal/mol and delta S degrees = -5.4 +/- 0.9 eu for this equilibrium.

The objective of this work is to determine the molecular mechanism and regulation of short-chain acyl-CoA dehydrogenase (SCAD) from Megasphaera elsdenii. To achieve this, the gene coding for SCAD from M. elsdenii was cloned and sequenced. Site-directed mutagenesis was then used to identify an amino acid residue that is required for the proposed mechanism. To clone the gene, the amino acid sequence of the 50 N-terminal residues of SCAD from M. elsdenii was determined. This sequence information was utilized to synthesize two sets of mixed oligonucleotide primers which were then used to generate a 120-bp specific probe from M. elsdenii DNA by the polymerase chain reaction (PCR) method. The 120-bp probe was used to screen a M. elsdenii genomic DNA library cloned into Escherichia coli. The gene encoding M. elsdenii SCAD was identified from this library, sequenced, and expressed. The cloned SCAD gene contained an open reading frame which revealed a high degree of sequence identity with an open reading frame protein sequence of the human SCAD and the rat medium-chain acyl-CoA dehydrogenase (MCAD) (44% and 36% identical residues in paired comparisons for human SCAD and rat MCAD, respectively). Recombinant SCAD expressed from a pUC119 vector accounted for 35% of the cytosolic protein in the Escherichia coli crude extract. The expressed protein had similar activity, redox potential properties, and nearly identical amino acid composition to native M. elsdenii SCAD. In addition, a site-directed Glu367 Gln mutant of SCAD expressed from a pUC119 vector was shown to have minimal reductive and oxidative pathway activity with butyryl-CoA and crotonyl-CoA, respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

The protein product of the normal p53 gene binds to the DNA p53CON element (GGACATGCCCGGGCATGTCC, Funk et al., 1992), thereby activating transcription from adjacent promoters. Two mutants, 248 (Arg-->Trp) and 281 (Asp-->Gly), failed to bind p53CON and to activate transcription. However, in contrast to previous reports that all p53 mutants fail to bind to the other p53 binding elements, two p53 mutants, 143 (Val-->Ala) and 273 (Arg-->His), retained both p53CON binding and transcriptional activation functions. A third mutant 175 (Arg-->His) bound to the p53CON but did not activate transcription. These data suggest that the DNA binding and transcriptional activation functions of p53 mutants in tumor cells are dependent on the specific missense mutations acquired in the p53 gene and the target sequences of p53 in the genome.

Transcriptional activity of p53 was monitored by cotransfection of pCMV expression vectors containing wild-type and mutant p53 cDNAs into the p53-null H1299 lung cancer cells along with luciferase reporter plasmids containing different p53 target sequences in the 5' regulatory region: fragment A of the ribosomal gene cluster (RGC); p53 consensus sequence (p53CON); or a tandemly linked RGC+p53CON sequence. Our results show: (1) wild-type p53 stimulates the transcription of reporter genes with p53CON and RGC in their 5' region while most p53 mutants occurring in human cancers have lost this activity; (2) the R273H mutant retains transcriptional activity for the p53CON sequence but not RGC; (3) some mutants are temperature-sensitive for the transcriptional activity with the p53CON but not the RGC sequence; (4) p53 mutants vary in their ability to inhibit wild-type p53 transactivation but there is no difference between p53CON and RGC sequences; (5) lung cancer cells with endogenous mutant p53 proteins (M246I in H23 cells and R248L in H322 cells) retain transcriptional activity for the p53CON but not the RGC sequence. We conclude that p53 DNA target sequences vary in their response to mutant p53 proteins, and that p53 mutants vary in several transactivation related functions.

Residue Asn57 of bovine liver cytochrome b5 has been replaced with a cysteine residue, and the resulting variant has been isolated from recombinant Escherichia coli as a mixture of four major species: A, BI, BII, and C. A combination of electronic spectroscopy, 1H NMR spectroscopy, resonance Raman spectroscopy, electrospray mass spectrometry, and direct electrochemistry has been used to characterize these four major cytochrome derivatives. The red form A (E(m) = -19 mV) is found to possess a heme group bound covalently through a thioether linkage involving Cys57 and the alpha carbon of the heme 4-vinyl group. Form BI has a covalently bound heme group coupled through a thioether linkage involving the beta carbon of the heme 4-vinyl group. Form BII is similar to BI except that the sulfur involved in the thioether linkage is oxidized to a sulfoxide. The green form C (E(m) = 175 mV) possesses a noncovalently bound prosthetic group with spectroscopic properties characteristic of a chlorin. A mechanism is proposed for the generation of these derivatives, and the implications of these observations for the biosynthesis of cytochrome c and naturally occurring chlorin prosthetic groups are discussed.

The coding sequence for human serum transferrin was assembled from restriction fragments derived from a full-length cDNA clone isolated from a human liver cDNA library. The assembled clone was inserted into the expression vector pNUT and stably transfected into transformed baby hamster kidney (BHK) cells, leading to secretion of up to 125 mg/L recombinant protein into the tissue culture medium. As judged by mobility on NaDodSO4-PAGE, immunoreactivity, spectral properties (indicative of correct folding and iron binding), and the ability to bind to receptors on a human cell line, initial studies showed that the recombinant transferrin, is identical to three commercial human serum transferrin samples. Electrospray mass spectrometry (ESMS), anion-exchange chromatography, and urea gel analysis showed that the recombinant protein has an extremely complex carbohydrate pattern with 16 separate masses ranging from 78,833 to 80,802 daltons. Mutation of the two asparagine carbohydrate linkage sites to aspartic acid residues led to the expression and secretion of up to 25 mg/L nonglycosylated transferrin. ESMS, anion-exchange chromatography, and urea gel analysis showed a single molecular species that was consistent with the expected theoretical mass of 75,143 daltons. In equilibrium binding experiments, the nonglycosylated mutant bound to HeLa S3 cells with the same avidity and to the same extent as the glycosylated protein and the three commercial samples. These studies demonstrate conclusively that carbohydrate has no role in this function.

Degenerate oligonucleotides and polymerase chain reaction-based reiterative selection techniques have been used to define the consensus binding sites for an increasing number of transcription factors. The use of crude nuclear extracts rather than purified proteins permits multicomponent complexes to form, and allows the technique to generate information about the combinatorial interactions involved in gene regulation.

Myogenin is one of four muscle-specific basic helix-loop-helix regulatory factors involved in controlling myogenesis. We here describe various protein complexes that increase the affinity of myogenin for DNA. We mixed an oligonucleotide containing a degenerate center large enough to accommodate multiple binding sites with crude myotube nuclear extracts and used cyclic amplification and selection of targets with an antimyogenin monoclonal antibody to isolate protein-DNA complexes. Since each cycle of selection results in the enrichment for the sequences with the highest affinity, we isolated multicomponent sites in which myogenin binding was increased by its interaction with other DNA binding proteins. Myogenin interacts with members of the nuclear factor 1 family, the muscle-specific factor myocyte-specific enhancer-binding factor 2, and another factor, COMP1 (cooperates with myogenic proteins 1), that binds to the sequence TGATTGAC. Myogenin also exhibits cooperative binding with other proteins that recognize CANNTG motifs, and various constraints on spacing and orientation were observed. The application of this approach to other transcription factors should not only help identify the different functions of myogenin versus other members of the muscle basic helix-loop-helix regulatory family but also help define the general combinatorial mechanisms involved in eukaryotic gene regulation.

The N-terminal lobe of recombinant human serum transferrin (residues 1 to 337) has been crystallized in a form suitable for high-resolution three-dimensional X-ray crystallographic analyses. Crystals are of the orthorhombic space group P2(1)2(1)2(1), with unit cell dimensions of a = 44.9 A, b = 57.0 A and c = 135.9 A, and diffract to beyond 2 A resolution. Further studies show that isomorphous crystals of specifically designed mutants of this protein can also be grown. Structural studies of both recombinant and mutant protein forms will provide a basis for understanding the mechanism by which human serum transferrin functions.

The finding that in many human tumors there is allelic loss and/or mutations in p53, in combination with recognition that these events may play a role in multi-stage carcinogenesis, has focused considerable interest on this gene. To help keep abreast of this rapidly expanding field, recent experiments on the role and potential regulation of p53 are described: these include discussions of p53 as an anti-proliferative agent, the p53 mutations found in human tumors and tumor cell lines, the conformational states of p53, phosphorylation of p53 by p34cdc2, and signals for the nuclear localization of p53. p53 may act as a transcriptional activator and the specific DNA sequences to which p53 protein binds are also discussed as is the importance of abrogation of p53 function in overcoming cellular senescence.

Recent studies have demonstrated transcriptional activation domains within the tumor suppressor protein p53, while others have described specific DNA-binding sites for p53, implying that the protein may act as a transcriptional regulatory factor. We have used a reiterative selection procedure (CASTing: cyclic amplification and selection of targets) to identify new specific binding sites for p53, using nuclear extracts from normal human fibroblasts as the source of p53 protein. The preferred consensus is the palindrome GGACATGCCCGGGCATGTCC. In vitro-translated p53 binds to this sequence only when mixed with nuclear extracts, suggesting that p53 may bind DNA after posttranslational modification or as a complex with other protein partners. When placed upstream of a reporter construct, this sequence promotes p53-dependent transcription in transient transfection assays.

Five site-directed mutants of the N-terminal half-molecule of human serum transferrin have been expressed in baby hamster kidney cells and purified to homogeneity. Expression levels and overall yields varied considerably from the wild-type protein, depending on the mutant in question. The mutants are D63S, D63C, G65R, K206Q, and H207E and are based on mutations observed in a variety of transferrins of known sequence. Their molecular masses, determined by electrospray mass spectrometry, agree with theory, except for the D63C mutant, which appears to be cysteinylated. All mutants bind iron but with varying affinities; qualitatively, in increasing order D63S approximately D63C approximately G65R much less than wild type less than or equal to H207E much less than K206Q. In general, reduction of formal negative charge within the binding cleft shifts the visible spectral maximum of the iron complex toward the blue and reduces the affinity for iron, and increasing the formal negative charge shifts the visible maximum toward the red and increases the affinity for iron. The K206Q mutant is exceptional inasmuch as its visible maximum shows a blue shift, but its affinity for iron is the greatest of all of the mutants studied. All mutants reported, in addition to the wild-type protein, exhibit very similar visible molar extinction coefficients for the iron complex and very similar changes in extinction coefficients at 240 nm on binding Fe(III) or Ga(III). These results suggest that in all cases the bound metal ion is coordinated by two tyrosyl side chains.

The cDNA sequence of rabbit liver transferrin has been determined. The largest cDNA was 2279 base pairs (bp) in size and encoded 694 amino acids consisting of a putative 19 amino acid signal peptide and 675 amino acids of plasma transferrin. The deduced amino acid sequence of rabbit liver transferrin shares 78.5% identity with human liver transferrin and 69.1% and 44.8% identity with porcine and Xenopus transferrins, respectively. At the amino acid level, vertebrate transferrins share 26.4% identity and 56.5% similarity. The most conserved regions correspond to the iron ligands and the anion binding region. Optimal alignment of transferrin sequences required the insertion of a number of gaps in the region corresponding to the N-lobe. In addition, the N-lobes of transferrins share less amino acid sequence similarity than the C-lobes.

Human lactoferrin was expressed from a cloned cDNA introduced into mammalian cells in tissue culture. Total RNA was extracted from human bone marrow, and lactoferrin cDNA was synthesized by primer-specific polymerase chain reaction after oligo(dT)-primed first-strand synthesis. The cDNA was sequenced to confirm its identity with previously published human lactoferrin sequences and cloned into the eukaryotic expression vector pNUT. Recombinant vector DNA containing the human lactoferrin sequence was introduced into baby-hamster kidney (BHK) cells in culture, and stable transfectants were produced by dominant marker selection. Human lactoferrin was expressed from the metallothionein promoter of pNUT by Zn2+ induction. The protein was secreted into the tissue-culture medium and was subsequently purified to homogeneity in a single step. Initial characterization suggests that the protein expressed by BHK cells is identical with native human lactoferrin.

A family of proteins has recently been identified, each member of which has the capacity to initiate muscle differentiation in many non-muscle cell types. These factors, which include MyoD1, myogenin, myf-5 and MRF4, share homologies with each other and belong to a superfamily of Myc-related proteins. Expression of these regulatory proteins results in auto-activation and cross-activation of other members of the family and in the transcriptional activation of the markers of terminal differentiation. Sequence analysis has shown a conserved basic domain in each protein that is required for binding to specific DNA sequences of the E-box type and for myogenic activation. A conserved helix-loop-helix (HLH) domain allows homo- and heterodimerization of these muscle-specific proteins with each other and with ubiquitously expressed proteins such as the E2A gene products (E12/E47). This review describes the discovery and characterization of these muscle regulatory proteins and their actions in the context of proposed models for the determination and differentiation of muscle tissue.

Expression of the amino-terminal lobe of human serum transferrin secreted into the culture medium by transformed baby hamster kidney (BHK) cells has been increased from the levels reported originally of 10-15 micrograms/ml to 55-120 micrograms/ml. Use of the serum substitute, Ultraser G, has facilitated isolation of the recombinant protein, resulting in approximately 80% recovery of expressed hTF/2N from the culture medium. In the three experiments described, 300-750 mg of recombinant protein was collected over a period of 25 days from five expanded surface roller bottles each containing 200 ml of medium (seven to nine collections). The use of alginate beads to encapsulate the transformed BHK cells provided no advantage over normal culturing over 25 days. A lag in production resulting in 30% less recombinant protein over this time period was observed. The production and isolation procedures described are easily handled by one person. The system is amenable to incorporation of isotopically substituted amino acids useful in NMR studies.

A gene coding for lipase-solubilized bovine liver microsomal cytochrome b5 has been synthesized, expressed in Escherichia coli, and mutated at functionally critical residues. Characterization of the recombinant protein revealed that it has a reduction potential that is approximately 17 mV lower than that of authentic wild-type protein at pH 7 (25 degrees C). Structural studies determined that the recombinant protein differed in sequence from authentic wild-type cytochrome b5 owing to three errors in amidation status in the published sequence for the protein on which the gene synthesis was based. The structural origin of the lower reduction potential exhibited by the triple mutant has been investigated through X-ray crystallographic determination of the three-dimensional structure of this protein and is attributed to the presence of Asp-57 within 3.3 A of heme vinyl-4 in the mutant. In addition, the model developed by Argos and Mathews [Argos, P., & Mathews, F.S. (1975) J. Biol. Chem. 250, 747] for the change in cytochrome b5 oxidation state has been studied through mutation of Ser-64 to Ala. In this model, Ser-64 is postulated to stabilize the oxidized protein through H-bonding interactions with heme propionate-7 that orients this propionate group 6.2 A from the heme iron. Spectroelectrochemical studies of a mutant in which Ser-64 has been changed to an alanyl residue demonstrate that this protein has a reduction potential that is 7 mV lower than that of the wild-type protein; moreover, conversion of the heme propionate groups to the corresponding methyl esters increases the potential by 67 mV.(ABSTRACT TRUNCATED AT 250 WORDS)

The complex formed in solution by native and chemically modified cytochrome c with cytochrome b5 has been studied by 1H and 13C nuclear magnetic resonance spectroscopy (NMR). Contrary to predictions of recent theoretical analysis, 1H NMR spectroscopy indicates that there is no major movement of cytochrome c residue Phe82 on binding to cytochrome b5. The greater resolution provided by 13C NMR spectroscopy permits detection of small perturbations in the environments of cytochrome c residues Ile75 and Ile85 on binding with cytochrome b5, a result that is in agreement with earlier model-building experiments. As individual cytochrome c lysyl residues are resolved in the 1H NMR spectrum of N-acetimidylated cytochrome c, the interaction of this modified protein with cytochrome b5 has been studied to evaluate the number of cytochrome c lysyl residues involved in binding to cytochrome b5. The results of this experiment indicate that at least six lysyl residues are involved, two more than predicted by static model building, which indicates that cytochrome c and cytochrome b5 form two or more structurally similar 1:1 complexes in solution.

A human liver cDNA library was screened with a synthetic oligonucleotide, complementary to the 5' region of human transferrin mRNA, as a hybridization probe. The full-length human cDNA clone isolated from this screen contained part of the 5' untranslated region, the complete coding region for the signal peptide and the two lobes of transferrin, the 3' untranslated region, and a poly(A) tail. By use of oligonucleotide-directed mutagenesis in vitro, two translational stop codons and a HindIII site were introduced after the codon for Asp-337. This fragment was inserted into two different expression vectors that were then introduced into Escherichia coli. As judged by NaDodSO4-polyacrylamide gel electrophoresis and Western blot analysis, however, recombinant hTF/2N was undetectable in bacteria transformed by these plasmids. Concurrently, we developed a plasmid vector for the expression of recombinant hTF/2N in eukaryotic cells. In this case, a DNA fragment coding for the natural signal sequence, the hTF/2N lobe, and the two stop codons was cloned into the expression vector pNUT, such that the expression of hTF/2N was controlled by the mouse metallothionein promoter and the human growth hormone termination sequences. Baby hamster kidney cells containing this hTF/2N-pNUT plasmid secreted up to 20 mg of recombinant hTF/2N per liter of tissue culture medium. Recombinant hTF/2N was purified from the medium by successive chromatography steps on DEAE-Sephacel, Sephadex G-75, and FPLC on Polyanion SI. The purified protein was characterized by NaDodSO4-PAGE, urea-PAGE, amino-terminal sequence analysis, UV-visible spectroscopy, iron-binding titration, and proton NMR.(ABSTRACT TRUNCATED AT 250 WORDS)

A cDNA for human ceruloplasmin (EC 1.16.3.1) was identified in a human liver cDNA library by screening with two mixtures of synthetic oligodeoxyribonucleotides that were complementary to two regions of ceruloplasmin mRNA as predicted from the amino acid sequence of plasma ceruloplasmin. The resulting clone (phCP1) contained DNA coding for amino acid residues 202-1046 of the protein, followed by a stop codon, a 3' untranslated region of 123 base pairs, and a poly(A) tail. To isolate cDNAs encoding the 5' end of ceruloplasmin mRNA, a cDNA library was constructed in lambda gt10. The cDNA for this library was synthesized by reverse transcription of human liver poly(A)+ RNA, using random oligonucleotides as primers. When this cDNA library was screened by using a 5' fragment of phCP1 as a hybridization probe, several positive clones were identified. One of these clones (lambda hCP1) contained DNA coding for a probable signal peptide of 19 amino acid residues followed by DNA coding for residues 1-380 of plasma ceruloplasmin. Blot hybridization analysis showed that ceruloplasmin mRNA from human liver and the human hepatoma cell line HepG2 is 3700 nucleotides in size. Liver contained an additional mRNA species that is like ceruloplasmin mRNA and is 4500 nucleotides in size. Comparison of the complete nucleotide sequences of human ceruloplasmin cDNA and human clotting factor VIII cDNA showed regions of sequence homology, suggesting that these two proteins have evolved from a common ancestor.