Search

In beiden rekonstruierten Fallen sind die Lebensbereiche Religion und Arbeit miteinander verknupft. Die Ausrichtung der Lebensfuhrung ist einerseits durch die Konflikthaftigkeit einer muslimischen Identitat in der deutschen bzw. franzosischen Gesellschaft gepragt, andererseits stellt sie die Losung einer inharent biografischen Problemlage dar. Die Fusion von Religion und Arbeit in einem biografischen Gesamtprojekt, ist der Versuch einer Bewaltigung dieser doppelt gelagerten Krisenhaftigkeit. Die geradezu miteinander verschmolzenen Lebensbereiche fungieren als Grundlage fur eine spezifische Ausrichtung der Lebensfuhrung. Im Gesamtprojekt sind berufliche und religiose Identitat gleichermasen wichtig. Die Verschmelzung von Religion und Arbeit geht mit einer Orientierung einher, die uber die Existenzsicherung hinaus, das sinnstiftende Potenzial von Berufstatigkeit mobilisiert. Dieser Typus erlebt kein Vereinbarkeitsproblem, sondern stellt – vermittels eines Spharengrenzen obsolet machenden Gesamtprojekts – eine extrem hohe Vereinbarkeit her. Die Kombination aus gesellschaftlich und biografisch bedingter Krisenhaftigkeit ist fallspezifisch gelagert, ebenso stellt die inhaltliche Ausrichtung des Gesamtprojekts eine fallspezifische Losung dar.

Die beiden thematischen Falle lassen sich dem Separationstypus zurechnen. Der Typus zeichnet sich durch eine Trennung von religioser und beruflicher Sphare aus. In einem relativ stabilen Arrangement lassen sich Religion und Berufstatigkeit als Spharen mit unterschiedlichen Regeln und normativen Erwartungen bzw. Zielsetzungen identifizieren. Dass die Handlungsorientierung eng an der Verfasstheit der jeweiligen Sphare ausgerichtet ist, lasst sich daran erkennen, dass die Subjekte Ambitionen ihrer religiosen Entwicklung und berufliche Bestrebungen formulieren, die voneinander unabhangig sind.Die dem gesellschaftlichen Kontext entsprechende Spharenseparation bedeutet jedoch nicht, dass das Arbeitsleben fur Musliminnen dieses Typus konfliktfrei ablauft. In der Artikulation mit dem gesellschaftlichen Kontext, z. B. mit islambezogenen Deutungsmustern und Stereotypen der Mehrheitsgesellschaft, werden die spezifisch muslimischen Aspekte dieses Typus sichtbar. Negative Zuschreibungen und ablehnende Reaktionen konnen dazu fuhren, dass die Berufstatigen weitere Grenzziehungen vornehmen, etwa was das Sprechen uber ihre Zugehorigkeit zum Islam angeht. Dass dies fallspezifisch gehandhabt wird, lasst sich darauf zuruckfuhren, dass dieser Typus nicht auf Reprasentanz, sondern auf die Anerkennung als Individuum abzielt.Trotz der geringen Uberschneidungen von Religion und Arbeit, sind diese nicht ganzlich ausgeschlossen.

Die vorliegende Untersuchung der Lebensfuhrung berufstatiger Musliminnen der zweiten Einwanderergeneration im deutschen und franzosischen Kontext fugt dem wissenschaftlichen Diskurs zur Arbeitsmarktintegration von Musliminnen einen Beitrag hinzu, der die Vereinbarkeitsmuster von Religiositat und Berufstatigkeit aufzeigt. In den Analysefokus wurde das Arrangement der Spharen Religion und Arbeit im Kontext von biografischen Krisen und Entwicklungen gestellt. Masgeblich war eine religionssoziologische Perspektive, die Veranderungen von Religiositat im Lebensverlauf und in ihrer Wechselwirkung mit der Biografie analysiert. Die Lebensfuhrung berufstatiger Musliminnen entwickelt sich in einem komplexen Zusammenspiel von Ungleichheiten, Verwirklichungschancen und Ressourcen. Sie ist ein Kristallisationspunkt verschiedenster, sie konstituierender Konfliktlagen und deren Losungen. Das Herkunftsmilieu und die Gesellschaft nehmen eine pragende, gleichermasen forderliche wie bremsende Rolle ein (8.1). Die fallspezifischen Aspekte wurden fallubergreifend gebundelt und daraus wurde eine Typologie der Lebensfuhrung im Kontext von Religion und Beruf entwickelt. Die Typen der Lebensfuhrung mit Spharenfusion, der Lebensfuhrung mit Spharenseparation sowie der Lebensfuhrung mit flexiblen Spharengrenzen werden als unterschiedliche Vereinbarkeitsmuster beschrieben (8.2.). Nach einer abschliesenden Diskussion zur Relevanz von religiosen Praktiken und Symbolen am Arbeitsplatz sowie landervergleichenden Aspekten folgt ein Ausblick auf weitere hypothetisch konstruierbare Typen (8.3).

Ausgangspunkt der theoretischen Uberlegungen zur Lebensfuhrung ist die begrundete These, dass es fur Musliminnen schwierig ist, Religiositat und Berufstatigkeit zu vereinbaren, diese Spannung jedoch gesellschaftlich bedingt ist. Der theoretische Zugriff auf Lebensfuhrung stellt den Kern des Kapitels dar. Erarbeitet wird eine doppelte Perspektive, die einen langsschnittlichen und einen querschnittlichen Blick auf das Leben kombiniert, d. h. die Autonomieentwicklung im biografischen Verlauf sowie Vereinbarkeitsfragen und Aushandlungen. Zudem werden spezifische Herausforderungen der Lebensfuhrung berufstatiger Musliminnen diskutiert.

Die in diesem Kapitel rekonstruierten Falle gehoren zu einem Typus, bei dem Religion und Arbeit punktuell und in bestimmter Hinsicht ineinandergreifen, wobei bestandige Grenzziehungen erforderlich sind. Bei diesem Typus ist eine deutliche Uberschneidung zwischen religioser und nichtreligioser Lebensfuhrung erkennbar. Beide Handlungs- und Wertspharen sind nicht dauerhaft miteinander verbunden, aber auch nicht strikt voneinander abgegrenzt; sie greifen aber zeitweilig und in bestimmten Aspekten ineinander. Die Genese dieses Typus spiegelt die Spezifika des untersuchten sozialen und medizinischen Berufsfelds sehr deutlich. Fur Typus 3 ist die Vereinbarkeit von Religion und Arbeit eine Herausforderung. Permanente Aushandlungen tragen dazu bei, dass letztlich die Vereinbarkeit gegenuber der Konflikthaftigkeit uberwiegt. Die Ausgewogenheit von Religion und Beruf stellt dieser Typus durch vielfaltige Formen des Ausbalancierens und der Kompromissbildung her. Das Ineinandergreifen von Religion und Arbeit kann nicht in ein fixes Arrangement uberfuhrt werden, sondern erfordert stets aufs Neue situative Aushandlungen und Kompromisse. Zugunsten einer gewissen Flexibilitat werden Ambivalenz und Mehrdeutigkeit ausgehalten.

A certain minimum plasma concentration of (Z)-endoxifen is presumably required for breast cancer patients to benefit from tamoxifen therapy. In this study, we searched for DNA variants that could aid in the prediction of risk for insufficient (Z)-endoxifen exposure. A metabolic ratio (MR) corresponding to the (Z)-endoxifen efficacy threshold level was adopted as a cutoff value for a genome-wide association study comprised of 287 breast cancer patients. Multivariate regression was used to preselect variables exhibiting an independent impact on the MR and develop models to predict below-threshold MR values. In total, 15 single-nucleotide polymorphisms (SNPs) were significantly associated with below-threshold MR values. The strongest association was with rs8138080 (WBP2NL). Two alternative models for MR prediction were developed. The predictive accuracy of Model 1, including rs7245, rs6950784, rs1320308, and the CYP2D6 genotype, was considerably higher than that of the CYP2D6 genotype alone (AUC 0.879 vs 0.758). Model 2, which was developed using the same three SNPs as for Model 1 plus rs8138080, appeared as an interesting alternative to the full CYP2D6 genotype testing. In conclusion, the four novel SNPs, tested alone or in combination with the CYP2D6 genotype, improved the prediction of impaired tamoxifen-to-endoxifen metabolism, potentially allowing for treatment optimization.

A certain minimum plasma concentration of (Z)-endoxifen is presumably required for breast cancer patients to benefit from tamoxifen therapy. In this study, we searched for DNA variants that could aid in the prediction of risk for insufficient (Z)-endoxifen exposure. A metabolic ratio (MR) corresponding to the (Z)-endoxifen efficacy threshold level was adopted as a cutoff value for a genome-wide association study comprised of 287 breast cancer patients. Multivariate regression was used to preselect variables exhibiting an independent impact on the MR and develop models to predict below-threshold MR values. In total, 15 single-nucleotide polymorphisms (SNPs) were significantly associated with below-threshold MR values. The strongest association was with rs8138080 (WBP2NL). Two alternative models for MR prediction were developed. The predictive accuracy of Model 1, including rs7245, rs6950784, rs1320308, and the CYP2D6 genotype, was considerably higher than that of the CYP2D6 genotype alone (AUC 0.879 vs 0.758). Model 2, which was developed using the same three SNPs as for Model 1 plus rs8138080, appeared as an interesting alternative to the full CYP2D6 genotype testing. In conclusion, the four novel SNPs, tested alone or in combination with the CYP2D6 genotype, improved the prediction of impaired tamoxifen-to-endoxifen metabolism, potentially allowing for treatment optimization.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5′CTTCAGTTGTTTCCACCGGGTAG 3′ /Vir2 5′TTCCTGTGGTGCACTCCTGACC 3′ (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5′ ATCCCCGGGGAAACCTGGAGCGAAC3′ /2H1 5′CCCTGAAGCGCTCCTCCGAG 3′ (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

Tamoxifen is the most commonly used drug for treating those patients with breast cancer who are oestrogen receptor positive. The main active metabolite of tamoxifen is (Z)-endoxifen whose therapeutic efficacy depends on its plasma concentration. A therapeutically effective threshold level has indeed been defined for (Z)-endoxifen above which the breast cancer relapse rate is significantly reduced. Such steady-state concentrations are conditional on gene polymorphism, principally cytochrome P450 2D6 ( CYP2D6 ), that modulates the activity of the encoded enzymes that convert tamoxifen to its active metabolites. This drug’s metabolism however may become significantly altered when other medication is concomitantly taken, such as selective serotonin reuptake inhibitors, which inhibit CYP2D6. A recent study have demonstrated that the majority of tamoxifen treated women with breast cancer in Poland, may not in fact attain the therapeutic threshold levels of (Z)-endoxifen. In such cases, personalising optimal treatment should be based on direct monitoring of steady-state plasma concentrations of tamoxifen and its metabolites, which can thereby significantly improve therapeutic efficacy.

SummaryA novel group of bacterial [NiFe]-hydrogenases is responsible for high-affinity H2 uptake from the troposphere, and is therefore thought to play an important role in the global H2 cycle. Here we present the first crystal structure at 2.85-Å resolution of such an actinobacterial-type hydrogenase (AH), which was isolated from the dihydrogen oxidizing bacterium, Ralstonia eutropha. The enzyme has a dimeric structure carrying two active [NiFe] sites that are interconnected by six [4Fe4S] clusters over a range of approximately 90 Å. Unlike most other [NiFe]-hydrogenases, the [4Fe4S] cluster proximal to the [NiFe] site is coordinated by three cysteines and one aspartate. Mutagenesis experiments revealed that this aspartate residue is related to the apparent O2 insensitivity of the AH. Our data provide first structural insight into specialized hydrogenases that are supposed to consume atmospheric H2 under challenging conditions, i.e. at high O2 concentration and wide temperature and pH ranges.

A high-speed photo detector IC for application in Blu-ray/DVD/CD drives is presented. Bandwidths for the highest gain of 254 MHz and 221 MHz for 405 nm (Blu-ray) and 635 nm (DVD) wavelengths, respectively, were achieved by applying novel design methodologies. The combination of this outstanding speed performance with its low power dissipation of 192 mW at 5V supply and the low noise power of −72 dBm at 300 MHz makes it the best in literature reported optical transceiver IC for Blu-ray and Blu-ray/DVD/CD multi drives. Beside the excellent performance results, the usage of the novel design methodologies gave us an increased design efficiency with 25% compared to earlier similar design processes.

Pseudoexfoliation syndrome (PEXS) is an age-related elastosis, strongly associated with the development of secondary glaucoma. It is clearly suggested that PEXS has a genetic component, but this has not been extensively studied. Here, a genome-wide association study (GWAS) using a DNA-pooling approach was conducted to explore the potential association of genetic variants with PEXS in a Polish population, including 103 PEXS patients without glaucoma and 106 perfectly (age- and gender-) matched controls. Individual sample TaqMan genotyping was used to validate GWAS-selected single-nucleotide polymorphism (SNP) associations. Multivariate binary logistic regression analysis was applied to develop a prediction model for PEXS. In total, 15 SNPs representing independent PEXS susceptibility loci were selected for further validation in individual samples. For 14 of these variants, significant differences in the allele and genotype frequencies between cases and controls were identified, of which 12 remained significant after Benjamini-Hochberg adjustment. The minor allele of five SNPs was associated with an increased risk of PEXS development, while for nine SNPs, it showed a protective effect. Beyond the known LOXL1 variant rs2165241, nine other SNPs were located within gene regions, including in OR11L1, CD80, TNIK, CADM2, SORBS2, RNF180, FGF14, FMN1, and RBFOX1 genes. None of these associations with PEXS has previously been reported. Selected SNPs were found to explain nearly 69% of the total risk of PEXS development. The overall risk prediction accuracy for PEXS, expressed by the area under the ROC curve (AUC) value, increased by 0.218, from 0.672 for LOXL1 rs2165241 alone to 0.89 when seven additional SNPs were included in the proposed 8-SNP prediction model. In conclusion, several new susceptibility loci for PEXS without glaucoma suggested that neuronal development and actin remodeling are potentially involved in either PEXS onset or inhibition or delay of its conversion to glaucoma.

B12-dependent proteins are involved in methyl transfer reactions ranging from the biosynthesis of methionine in humans to the formation of acetyl-CoA in anaerobic bacteria. During their catalytic cycle, they undergo large conformational changes to interact with various proteins. Recently, the crystal structure of the B12-containing corrinoid iron–sulfur protein (CoFeSP) in complex with its reductive activator (RACo) was determined, providing a first glimpse of how energy is transduced in the ATP-dependent reductive activation of corrinoid-containing methyltransferases. The thermodynamically uphill electron transfer from RACo to CoFeSP is accompanied by large movements of the cofactor-binding domains of CoFeSP. To refine the structure-based mechanism, we analyzed the conformational change of the B12-binding domain of CoFeSP by pulsed electron–electron double resonance and Förster resonance energy transfer spectroscopy. We show that the site-specific labels on the flexible B12-binding domain and the small subunit of CoFeSP move within 11 Å in the RACo:CoFeSP complex, consistent with the recent crystal structures. By analyzing the transient kinetics of formation and dissociation of the RACo:CoFeSP complex, we determined values of 0.75 μM–1 s–1 and 0.33 s–1 for rate constants kon and koff, respectively. Our results indicate that the large movement observed in crystals also occurs in solution and that neither the formation of the protein encounter complex nor the large movement of the B12-binding domain is rate-limiting for the ATP-dependent reductive activation of CoFeSP by RACo.

One of the main questions regarding nonalcoholic fatty liver disease is the molecular background of the transition from simple steatosis (SS) to the inflammatory and fibrogenic condition of steatohepatitis (NASH). We examined the gene expression changes during progression from histologically normal liver to SS and NASH in models of obesity caused by hyperphagia or a high-fat diet. Microarray-based analysis revealed that the expression of 1445 and 264 probe sets was changed exclusively in SS and NASH samples, respectively, and 1577 probe sets were commonly altered in SS and NASH samples. Functional annotations indicated that transcriptome alterations that were common for NASH and SS, as well as exclusive for NASH, involved extracellular matrix (ECM)-related processes, although they differed in the type of matrix structure change. The expression of 80 genes was significantly changed in all three comparisons: SS versus control, NASH versus control and NASH versus SS. Of these genes, epithelial membrane protein 1, IKBKB interacting protein and decorin were progressively up-regulated in both SS and NASH compared to normal tissue. The molecular context of interactions of encoded 80 proteins revealed that they are highly interconnected and significantly enriched for processes involving metabolism by cytochrome P450. Validation of 10 selected mRNAs encoding genes related to ECM and cytochrome P450 with quantitative RT-PCR analysis showed consistent changes in their expression during NASH development. The expression profile of these genes has the potential to distinguish NASH from SS and normal tissue and may possibly be beneficial in the clinical diagnosis of NASH.

Although mitochondrial dysfunction is implicated in the pathogenesis of obesity, the molecular mechanisms underlying obesity-related metabolic abnormalities are not well established. We performed mitochondrial quantitative proteomic and whole transcriptome analysis followed by functional annotations within liver and skeletal muscles, using fasted and non-fasted 16- and 48-week-old high-fat diet (HFD)-fed and normal diet-fed (control group) wild-type C56BL/6J mice, and hyperphagic ob/ob and db/db obese mice. Our study identified 1,675 and 704 mitochondria-associated proteins with at least two peptides in liver and muscle, respectively. Of these, 221 liver and 44 muscle proteins were differentially expressed (adjusted p values ≤ 0.05) between control and all obese mice, while overnight fasting altered expression of 107 liver and 35 muscle proteins. In the liver, we distinguished a network of 27 proteins exhibiting opposite direction of expression changes in HFD-fed and hyperphagic mice when compared to control. The network centered on cytochromes P450 3a11 (Cyp3a11) and 4a14 (Cyp4a14), and fructose-bisphosphate aldolase B (Aldob) proteins which bridged proteins cluster involved in Metabolism of xenobiotics with proteins engaged in Fatty acid metabolism and PPAR signaling pathways. Functional annotations revealed that most of the hepatic molecular alterations, which characterized both obesity and fasting, related to different aspects of energy metabolism (such as Fatty acid metabolism, Peroxisome, and PPAR signaling); however, only a limited number of functional annotations could be selected from skeletal muscle data sets. Thus, our comprehensive molecular overview revealed that both obesity and fasting states induce more pronounced mitochondrial proteome changes in the liver than in the muscles. Electronic supplementary material The online version of this article (doi:10.1007/s10142-013-0342-3) contains supplementary material, which is available to authorized users.

Movement, cell division, protein biosynthesis, electron transfer against an electrochemical gradient, and many more processes depend on energy conversions coupled to the hydrolysis of ATP. The reduction of metal sites with low reduction potentials (E 0′ 4 S 4 ] cluster of acetyl-CoA synthase. Methylation of CoFeSP only occurs in the low-potential Co(I) state, which can be sporadically oxidized to the inactive Co(II) state, making its reductive reactivation necessary. Here we show that an open-reading frame proximal to the structural genes of CoFeSP encodes an ATP-dependent reductive activator of CoFeSP. Our biochemical and structural analysis uncovers a unique type of reductive activator distinct from the electron-transferring ATPases found to reduce the MoFe-nitrogenase and 2-hydroxyacyl-CoA dehydratases. The CoFeSP activator contains an ASKHA domain (acetate and sugar kinases, Hsp70, and actin) harboring the ATP-binding site, which is also present in the activator of 2-hydroxyacyl-CoA dehydratases and a ferredoxin-like [2Fe-2S] cluster domain acting as electron donor. Complex formation between CoFeSP and its activator depends on the oxidation state of CoFeSP, which provides evidence for a unique strategy to achieve unidirectional electron transfer between two redox proteins.

Kinase domains are the type of protein domain most commonly found in genes associated with tumorigenesis. Because of this, the human kinome (the protein kinase component of the genome) represents a promising source of cancer biomarkers and potential targets for novel anti-cancer therapies. Alterations in the human colon kinome during the progression from normal colon (NC) through adenoma (AD) to adenocarcinoma (AC) were investigated using integrated transcriptomic and proteomic datasets. Two hundred thirty kinase genes and 42 kinase proteins showed differential expression patterns (fold change ≥ 1.5) in at least one tissue pair-wise comparison (AD vs. NC, AC vs. NC, and/or AC vs. AD). Kinases that exhibited similar trends in expression at both the mRNA and protein levels were further analyzed in individual samples of NC (n = 20), AD (n = 39), and AC (n = 24) by quantitative reverse transcriptase PCR. Individual samples of NC and tumor tissue were distinguishable based on the mRNA levels of a set of 20 kinases. Altered expression of several of these kinases, including chaperone activity of bc1 complex-like (CABC1) kinase, bromodomain adjacent to zinc finger domain protein 1B (BAZ1B) kinase, calcium/calmodulin-dependent protein kinase type II subunit delta (CAMK2D), serine/threonine-protein kinase 24 (STK24), vaccinia-related kinase 3 (VRK3), and TAO kinase 3 (TAOK3), has not been previously reported in tumor tissue. These findings may have diagnostic potential and may lead to the development of novel targeted therapeutic interventions for colorectal cancer. Electronic supplementary material The online version of this article (doi:10.1007/s00109-011-0831-6) contains supplementary material, which is available to authorized users.

Mounting evidence indicates that MS analysis of the human blood peptidome allows to distinguish between cancer and non-cancer samples, giving promise for a new MS-based diagnostic tool. However, several aspects of already published work have been criticized and demand for more methodical approach has been formulated. Motivated by this we undertook a systematic study of the plasma and serum peptidome using an integrated ESI-LC-MS-based platform, equipped with new data analysis tools for relative and absolute peptide quantitation. We used a high resolution LC-ESI-MS to analyze well-separated MS signals corresponding to peptides, and measured the variability of >1000 peptide signal amplitudes across a set of plasma and serum samples from healthy individuals. By spiking serum samples with known amounts of isotopically labeled versions of a selected set of peptides we measured the variability of their absolute concentration in this sample set and demonstrated a strong influence of clotting time on the concentration of these peptides in serum. Finally, we used this new LC-ESI-MS analytical platform for the differential analysis of healthy versus colon cancer serum samples and found that it was possible to distinguish the two groups with 89.8% sensitivity and 94.6% specificity.

In this paper, a novel approach for robust automatic optimization of analog circuits with bipolar transistors is presented. It includes additional formal parameters into the device model cards, which sweep the model parameters smoothly between the different device types. In this way, not only the sizing, but also the choice of the device type is committed to the optimization tool, thus improving the efficiency of the design process significantly.

A cobalamin (Cbl) cofactor in corrinoid iron-sulfur protein (CoFeSP) is the primary methyl group donor and acceptor in biological carbon oxide conversion along the reductive acetyl-CoA pathway. Changes of the axial coordination of the cobalt ion within the corrin macrocycle upon redox transitions in aqua-, methyl-, and cyano-Cbl bound to CoFeSP or in solution were studied using X-ray absorption spectroscopy (XAS) at the Co K-edge in combination with density functional theory (DFT) calculations, supported by metal content and cobalt redox level quantification with further spectroscopic methods. Calculation of the highly variable pre-edge X-ray absorption features due to core-to-valence (ctv) electronic transitions, XANES shape analysis, and cobalt-ligand bond lengths determination from EXAFS has yielded models for the molecular and electronic structures of the cobalt sites. This suggested the absence of a ligand at cobalt in CoFeSP in α-position where the dimethylbenzimidazole (dmb) base of the cofactor is bound in Cbl in solution. As main species, (dmb)CoIII(OH2), (dmb)CoII(OH2), and (dmb)CoIII(CH3) sites for solution Cbl and CoIII(OH2), CoII(OH2), and CoIII(CH3) sites in CoFeSP-Cbl were identified. Our data support binding of a serine residue from the reductive-activator protein (RACo) of CoFeSP to the cobalt ion in the CoFeSP-RACo protein complex that stabilizes Co(II). The absence of an α-ligand at cobalt not only tunes the redox potential of the cobalamin cofactor into the physiological range, but is also important for CoFeSP reactivation.

Barrett's esophagus represents a well-defined precursor lesion of esophageal adenocarcinoma, although only a subset of patients with these lesions advances to invasive cancer. Currently, reliable markers predicting neoplastic progression in Barrett's esophagus are lacking. The only clinically useful risk factor is the presence of dysplasia in Barrett's epithelium, but its use as a prognostic marker of disease progression has several significant limitations. Thus, identification of biomarkers of potential prognostic value in dysplasia development in Barrett's esophagus is highly important. The aim of the study was to determine if expression levels of selected genes support histologic diagnosis of dysplastic changes in Barrett's esophagus. Upon rigorous sampling and independent histopathologic examination of endoscopic specimens by two experienced gastrointestinal pathologists, 56 patients with Barrett's esophagus (16 negative for dysplasia, 15 with indefinite, 21 with low-grade, and 4 with high-grade dysplasia) were selected for molecular analysis. The relative mRNA levels of ten selected genes were estimated by quantitative real-time polymerase chain reaction (PCR) analysis. Although expression of nine genes showed trends toward down- or upregulation during progression from Barrett's esophagus without dysplasia to Barrett's esophagus with high-grade dysplasia, only a decrease in S100A2 mRNA levels was statistically significant (P

The heterogeneous nuclear ribonucleoprotein K (hnRNP K) protein is an RNA-binding protein involved in many processes that compose gene expression. K protein is upregulated in the malignant processes and has been shown to modulate the expression of genes involved in mitogenic responses and tumorigenesis. To explore the possibility that there are alternative isoforms of K protein expressed in colon cancer, we amplified and sequenced K protein mRNA that was isolated from colorectal cancers as well as from normal tissues surrounding the tumours. Sequencing revealed a single G-to-A base substitution at position 274 that was found in tumours and surrounding mucosa, but not in individuals that had no colorectal tumour. This substitution most likely reflects an RNA editing event because it was not found in the corresponding genomic DNAs. Sequencing of RNA from normal colonic mucosa of patients with prior resection of colorectal cancer revealed only the wild-type K protein transcript, indicating that G274A isoform is tumour related. To our knowledge, this is the first example of an RNA editing event in cancer and its surrounding tissue, a finding that may offer a new diagnostic and treatment marker.

Pneumatisch betriebene extrakorporale mechanische Kreislaufsunterstutzungssysteme (Ventricular Assist Device—VAD) fur Sauglinge und Kleinkinder wurden 1992 in die klinische Praxis eingefuhrt. Die anfanglichen Ergebnisse gerade bei sehr jungen Patienten waren verbesserungsbedurftig. Seit dieser Zeit sind die Systeme gerade in Bezug auf Kanulen, Konnektoren und Heparinbeschichtung des Pumpeninnenraums weiterentwickelt worden. Zusatzliche Verbesserungen wurden auch im Bereich der Durchfuhrung und Uberwachung der Antikoagulation erarbeitet, sowie im Rahmen der Patientenselektion, die nun eine den Umstanden entsprechend fruhe Indikationsstellung zur Implantation favorisiert, um dem Auftreten eines irreversiblen Multiorganversagens vorzubeugen. Zwischen 1990 und Ende 2004 wurden 62 Berlin Heart Excor-Systeme bei unter 18-jahrigen Patienten in unserem Haus implantiert. Die Patienten wurden nach dem Zeitraum der Behandlung in zwei Gruppen geteilt: Zeitraum I—Implantation zwischen 1990 und 1998 (n=34) und Zeitraum II—Implantation zwischen 1999 und 2004 (n=28). Die Behandlungsergebnisse in den beiden Zeitraumen wurden verglichen. Die praoperativen Daten der Patienten der beiden Zeitraume zeigten keine signifikanten Unterschiede. Die Unterstutzungsdauer war in Gruppe II langer (17,9±27,7 vs. 53,2±83,9 Tage, p=0,001). In Gruppe I benotigten mehr Patienten ein biventrikulares Unterstutzungssystem, wahrend in Gruppe II mehr Patienten mit einem linksventrikularen System behandelt werden konnten (p=0,05). Ein primarer Thoraxverschluss konnte in Gruppe II in signifikant hoherem Mase durchgefuhrt werden (0 vs. 89%, p=0,012). Erst in dieser Gruppe wurde eine Extubation der Kinder wahrend der mechanischen Unterstutzung moglich (0 vs. 55%, p=0,16). In Gruppe I konnten 35% der Kinder nach Entwohnung vom System oder Herztransplantation nach Hause entlassen werden, in Gruppe II 68% (p=0,029). In Gruppe I uberlebte keines der Kinder unter einem Jahr, in Gruppe II war die Uberlebensrate dieser Kinder vergleichbar mit alteren Kinder (p=0,024). Die Entlassungsrate war signifikant besser in Gruppe II bei Patienten mit Kardiomyopathie (43 vs. 76%, p=0,045) und postoperativem Herzversagen (0 vs. 57%, p=0,01). Besonders bei Kindern unter einem Jahr Alter konnten uber Verbesserungen am Kanulendesign, Antikoagulationsdurchfuhrung und -uberwachung signifikante Verbesserungen bei Uberlebensrate und Moglichkeit zur Entlassung nach Hause erreicht werden. Das Berlin Heart Excor-VAD ist ein zuverlassiges System, um Kindern mit kardiogenem Schock bis zur Herztransplantation oder Erhohlung der eigenen Herzfunktion zu unterstuzen.

In the last years new high-power resonant applications of piezoceramic devices such as motors and transformers became more and more important. Therefore, there is a need for a better understanding of the nonlinear behavior of piezoceramic material under driving conditions which cause large dynamical stress. The main problem for such measurements is the self-heating of the samples caused by increasing electric driving fields and the increasing vibration velocity. This paper presents a new measurement method where the specimen are excited under constant voltage conditions in such a way that the frequency is changed step by step in the range of the serial resonance frequency. The excitation can be intermitted between two frequency steps to reduce the temperature rise of the specimen. The vibration velocity, the resonator current, the phase shift between the voltage and the current and the temperature can be recorded simultaneously. Results of transverse length vibrators made of different hard PZT materials will be presented.

Acetaminophen (APAP) nephrotoxicity has been observed both in humans and research animals. Recent studies suggest a contributory role for glutathione (GSH)-derived conjugates of APAP in the development of nephrotoxicity. Inhibitors of either gamma-glutamyl transpeptidase (gamma-GT) or the probenecid-sensitive organic anion transporter ameliorate APAP-induced nephrotoxicity but not hepatotoxicity in mice and inhibition of gamma-GT similarly protected rats from APAP nephrotoxicity. Protection against APAP nephrotoxicity by disruption of these GSH conjugate transport and metabolism pathways suggests that GSH conjugates are involved. APAP-induced renal injury may involve the acetaminophen-glutathione (APAP-GSH) conjugate or a metabolite derived from APAP-GSH. Acetaminophen-cysteine (APAP-CYS) is a likely candidate for involvement in APAP nephrotoxicity because it is both a product of the gamma-GT pathway and a probable substrate for the organic anion transporter. The present experiments demonstrated that APAP-CYS treatment alone depleted renal but not hepatic glutathione (GSH) in a dose-responsive manner. This depletion of renal GSH may predispose the kidney to APAP nephrotoxicity by diminishing GSH-mediated detoxification mechanisms. Indeed, pretreatment of male CD-1 mice with APAP-CYS before challenge with a threshold toxic dose of APAP resulted in significant enhancement of APAP-induced nephrotoxicity. This was evidenced by histopathology and plasma blood urea nitrogen (BUN) levels at 24 h after APAP challenge. APAP alone was minimally nephrotoxic and APAP-CYS alone produced no detectable injury. By contrast, APAP-CYS pretreatment did not alter the liver injury induced by APAP challenge. These data are consistent with there being a selective, contributory role for APAP-GSH-derived metabolites in APAP-induced renal injury that may involve renal-selective GSH depletion.

In Sachsen-Anhalt sind Impfungen bei Kindern bis zum vollendeten 7. Lebensjahr an das Gesundheitsamt namentlich zu melden. Ziel der Meldepflicht ist die Verbesserung und Stabilisierung der altersgerechten Durchimpfung. Bei der Umsetzung der Meldepflicht gibt es Schwierigkeiten, die mit einem Modellprojekt in den Gesundheitsamtern Magdeburg und Halle analysiert und behoben werden sollen. Entscheidend fur die Umsetzung der Meldepflicht sind das Einverstandnis der Eltern, die Bereitschaft der impfenden Arzte und das Vorliegen der personellen und technischen Moglichkeiten im Gesundheitsamt. Eine Befragung niedergelassener Kinder- und Hausarzte ergab, dass Vorbehalte gegen die Meldepflicht bezuglich des Datenschutzes und der rechtlichen Absicherung weit verbreitet sind. Die Hausarzte glauben auserdem, dass die Eltern mit einer namentlichen Meldung nicht einverstanden sind. Dass dies nicht der Fall ist, ergab eine Befragung junger Mutter. Entscheidend fur die Zustimmung junger Mutter zur Meldepflicht ist, dass der impfende Arzt ebenfalls eine positive Haltung einnimmt. Um die Impfmeldepflicht umzusetzen, ist es daher zwingend notwendig, die diesbezuglichen Bedenken der Arzte auszuraumen und den unmittelbaren Nutzen der Meldungen in der taglichen Praxis erlebbar zu machen. Dies stellt hohe Anforderungen an das Gesundheitsamt, das ein Impfregister fuhren, die Kommunikation mit den Arzten aufrecht-erhalten und die Eltern an fehlende Impfungen ihrer Kinder erinnern sollte.

Helicobacter pylori is a gram-negative bacterial organism that persistently colonizes the human gastric mucosa. Most H. pylori-infected humans tolerate the presence of this organism relatively well and never develop symptomatic gastroduodenal pathology. However, H. pylori infection is a risk factor for the development of peptic ulcer disease and distal gastric adenocarcinoma (8, 11, 27). Within the gastric mucosa, H. pylori lives within the mucus layer and may also attach to gastric epithelial cells. At least five different putative H. pylori adhesins (designated BabA, SabA, AlpA, AlpB, and HopZ) have been identified (16-19). Of these, the BabA adhesin has been investigated in the most detail thus far. The H. pylori BabA adhesin mediates binding of H. pylori to the fucosylated Lewis b histo-blood group antigen present on the surface of gastric epithelial cells (5, 16). In an animal model, Lewis b-dependent attachment of H. pylori to gastric epithelial cells is accompanied by increased severity of inflammation, development of parietal cell autoantibodies, and parietal cell loss (12, 15). There is a high level of genetic diversity among H. pylori isolates from different humans (4). Consistent with this observation, there is variation among H. pylori isolates in the capacity to bind to Lewis b (7, 16, 23, 28). One study reported that 63 (66%) of 95 H. pylori isolates bound to Lewis b (16). The molecular basis for variation among strains in Lewis b-binding capacity has not yet been investigated in any detail. In the present study, we sought to investigate diversity among H. pylori strains in expression of the BabA protein. We report here the development of methodology for detecting expression of the BabA protein and demonstrate that only about half of the H. pylori strains tested produce a detectable BabA protein. Among H. pylori strains that produce a detectable BabA protein, there is considerable variation in binding to Lewis b in vitro.

The involvement of the canalicular multidrug resistance protein 2 (Mrp2) in the hepatobiliary excretion of acetaminophen (APAP)-glutathione (GSH) conjugate and its derivatives was investigated using transport-deficient (TR- rats. Although no differences in the biliary concentration of APAP itself were detected between normal Wistar and TR- rats, significant differences in the biliary disposition of several conjugated metabolites of APAP were detected. APAP-GSH was virtually absent in bile from TR- rats. Also, biliary concentrations of APAP-mercapturate (NAC; N-acetylated l-cysteine) and APAP-GLU were significantly reduced in TR- rats. No differences in the biliary concentration of APAP-cysteinylglycine/cysteine (CG/CYS) were detected between normal and mutant rats. The cumulative amounts of APAP-CG/CYS and APAP-NAC excreted in urine of mutant rats were decreased, whereas APAP-GLU was markedly increased. Analysis of liver samples revealed that APAP-GSH and APAP-NAC accumulate in mutant rat livers. Our results support the direct involvement of Mrp2 in the hepatobiliary excretion of several conjugated metabolites of APAP, including APAP-GSH and APAP-NAC, and provide relevant information on processes that may be involved with both their hepatic basolateral transport and renal elimination.

Background: Although Helicobacter pylori is a significant etiologic factor of peptic ulcer disease, it remains unknown why ulcers develop only in the minority of infected individuals. Aim: The aim of this cross-sectional study was to evaluate the association between the presence of duodenal ulcer in H. pylori-infected patients and different risk factors. Methods: A total of 122 H. pylori-infected patients were enrolled; 79 had duodenal ulcer and 43 gastritis. Univariate analysis was conducted using either Fisher’s exact test or exact Cochrane-Armitage trend test. In multivariate analysis the logistic model was used. Results: Univariate analysis indicated six factors (male sex, smoking, antral H. pylori density, cagA presence in antrum, and vacA s1a presence in antrum and corpus). Four factors (sex, smoking-alcohol index, H. pylori density index, and cagA index) were found to be significant in multivariate analysis. The best model predicting duodenal ulcer included male sex, smoking, presence of H. pylori on histopathology in antrum and cagA presence in corpus. Conclusion: Although several risk factors were significantly associated with duodenal ulcer, we failed in the identification of either a single risk factor or a set of factors that can unequivocally differentiate patients with ulcer from those with gastritis.

Mice pretreated with the peroxisome proliferator clofibrate (CFB) are highly resistant to acetaminophen (APAP)-induced hepatotoxicity. The objective of the present study was to investigate whether the increase in hepatic catalase activity following CFB pretreatment plays a role in this hepatoprotection. An irreversible inhibitor, 3-amino-1,2,4-triazole (3-AT), was used to modulate catalase activity. Hepatic catalase activity in mice pretreated with CFB (500 mg/kg, i.p., for 10 days) was significantly inhibited by 3-AT (100 or 500 mg/kg, i.p.). In addition, the lower dose of 3-AT (100 mg/kg) had minimal effect on biliary and urinary excretion of APAP metabolites generated from a nontoxic dose, suggesting that APAP metabolism was not modulated by this dose of 3-AT. The mortality rate of corn-oil-pretreated mice challenged with APAP (800 mg/kg, p.o.) was significantly increased by 3-AT (100 mg/kg, i.p.) given 1 h before APAP. As expected, CFB pretreatment conferred full protection against APAP-induced hepatotoxicity. The same 3-AT treatment, however, did not abolish hepatoprotection in CFB-pretreated mice, despite the marked inhibition of hepatic catalase activity. In conclusion, these results indicate that elevated catalase activity in mice exposed to CFB does not appear to mediate the hepatoprotection, suggesting that other cellular defense mechanisms are involved.

Helicobacter pylori causes numerous alterations in gastric epithelial cells through processes that are dependent on activity of the cag type IV secretion system (T4SS). Filamentous structures termed “pili” have been visualized at the interface between H. pylori and gastric epithelial cells, and previous studies suggested that pilus formation is dependent on the presence of the cag pathogenicity island (PAI). Thus far, there has been relatively little effort to identify specific genes that are required for pilus formation, and the role of pili in T4SS function is unclear. In this study, we selected 7 genes in the cag PAI that are known to be required for T4SS function and investigated whether these genes were required for pilus formation. cagT , cagX , cagV , cagM , and cag3 mutants were defective in both T4SS function and pilus formation; complemented mutants regained T4SS function and the capacity for pilus formation. cagY and cagC mutants were defective in T4SS function but retained the capacity for pilus formation. These results define a set of cag PAI genes that are required for both pilus biogenesis and T4SS function and reveal that these processes can be uncoupled in specific mutant strains.

Thermodynamically unfavourable electron transfers are enabled by coupling to an energy-supplying reaction. How the energy is transduced from the exergonic to the endergonic process is largely unknown. Here we provide the structural basis for an energy transduction process in the reductive activation of B12-dependent methyltransferases. The transfer of one electron from an activating enzyme to the cobalamin cofactor is energetically uphill and relies on coupling to an ATPase reaction. Our results demonstrate that the key to coupling is, besides the oxidation state-dependent complex formation, the conformational gating of the electron transfer. Complex formation induces a substitution of the ligand at the electron-accepting Co ion. Addition of ATP initiates electron transfer by provoking conformational changes that destabilize the complex. We show how remodelling of the electron-accepting Co2+ promotes ATP-dependent electron transfer; an efficient strategy not seen in other electron-transferring ATPases. Some biological reactions can require thermodynamically unfavourable electron transfer processes, the occurrence of which are not yet fully understood. Here, the authors provide the structural basis of energy transduction during the reductive activation of B12-dependent methyltransferases.