244 results on '"Curly top"'
Search Results
2. A roadmap to Durable BCTV Resistance Using Long-Read Genome Assembly of Genetic Stock KDH13.
- Author
-
Galewski, Paul J. and Eujayl, Imad
- Subjects
- *
SUGAR beets , *GENOMES , *SINGLE nucleotide polymorphisms , *SUGAR crops , *VIRUS diseases , *BEETS - Abstract
Beet Curly Top (BCT) is a viral disease which negatively impacts crop productivity for sugar beet growers and the sugar beet industry in the western USA and dry regions worldwide. Current varieties exhibit little genetic resistance to the Beet Curly Top Virus (BCTV), suggesting there is a large potential for improvement. KDH13 (PI 663862) is a double-haploid line created from a population (C762-17/PI 560130) which segregates for resistance to BCTV and was identified as genetic stock for the improvement of sugar beet varieties. PacBio sequences were generated and assembled to better define the content and organization of variation within the KDH13 genome and to provide resources to identify specific variation underpinning durable genetic resistance. Using ab initio predicted proteins as anchors, the assembled KDH13 contigs were placed in a more contiguous order using the EL10.1 reference genome, which leveraged Bio-Nano optical maps and Hi-C proximity information for chromosome level scaffolding. In total, 4681 (75%) of the 6245 contigs were placed in the order and orientation of the EL10.1 genome. The anchored contigs represented 502,929,268 bp (87.7%), the KDH13 genome assembly. An F1 hybrid and parental lines KDH13 (resistant) and KDH19-17 (susceptible) were sequenced using Illumina technology in order to characterize the SNP, indel, and structural variation between parental lines and allow for a more detailed investigation into causal variation linked to important phenotypes. In total, 3,086,720 variants were detected, including 2,259,324 single-nucleotide polymorphisms, 191,448 insertions, 198,057 deletions, 268,090 complex substitutions, 90,004 multi allelic variants, and 79,797 structural variants. Of the total variation, 1,158,491 were informative in the F1 and were able to discriminate between the two parents. This information represents a high-density marker dataset distributed globally across the sugar beet genome and can be used to track genomic segments in populations where KDH13 is used as parental material to improve BCTV resistance. [ABSTRACT FROM AUTHOR]
- Published
- 2022
- Full Text
- View/download PDF
3. Source of Useful Traits
- Author
-
Biancardi, Enrico, Panella, Leonard W., Lewellen, Robert T., Biancardi, Enrico, Panella, Leonard W., and Lewellen, Robert T.
- Published
- 2012
- Full Text
- View/download PDF
4. Nightshade Curly Top Virus: A Possible New Virus of the Genus Topocuvirus Infecting Solanum nigrum in China
- Author
-
Pengjun Zhang, Xueting Zhong, Sun Kai, Yan Liang, Xiaoping Yu, and Xuenan Hu
- Subjects
Genetics ,0303 health sciences ,food.ingredient ,biology ,030306 microbiology ,viruses ,fungi ,Nucleic acid sequence ,food and beverages ,Nicotiana benthamiana ,Plant Science ,Solanum nigrum ,Topocuvirus ,biology.organism_classification ,DNA sequencing ,Deep sequencing ,Virus ,03 medical and health sciences ,food ,Curly top ,Agronomy and Crop Science ,030304 developmental biology - Abstract
Virus-like symptoms, including leaf deformation and curling, were observed on nightshade (Solanum nigrum) in Zhejiang Province, China. To identify possible pathogenic viruses or viroids, a symptomatic sample was subjected to deep sequencing of small interfering RNAs. Assembly of the resulting sequences led to identification of a novel geminivirus, provisionally designated nightshade curly top virus (NCTV). The complete genomic DNA sequence is 2,867 nucleotides and encodes seven open reading frames. NCTV shares 77.1% overall nucleotide sequence identity, 86.3% coat protein amino acid identity, and 78.9% replication-associated protein amino acid sequence identity with Tomato pseudo-curly top virus, a member of the genus Topocuvirus. PCR screening of nightshade field isolates indicated that NCTV is widely distributed in Zhejiang. Agrobacterium-mediated inoculation revealed that NCTV is highly infectious to Nicotiana benthamiana, S. nigrum, S. lycopersicum, and S. tuberosum. Based on pairwise comparisons and phylogenetic analyses, NCTV is proposed as a provisional member of the genus Topocuvirus.
- Published
- 2021
5. Arbuscular mycorrhizal symbiosis enhances virus accumulation and attenuates resistance-related gene expression in tomato plants infected with Beet curly top Iran virus
- Author
-
Saeede Ebrahimi, Davoud Koolivand, and Omid Eini
- Subjects
0106 biological sciences ,food.ingredient ,Inoculation ,fungi ,food and beverages ,Plant physiology ,Plant Science ,Horticulture ,Biology ,01 natural sciences ,Virus ,010602 entomology ,food ,Curly top ,Symbiosis ,Plant virus ,Becurtovirus ,Cultivar ,Agronomy and Crop Science ,010606 plant biology & botany - Abstract
Beet curly top Iran virus (BCTIV), a member of the genus Becurtovirus, is one of the causal agents for curly top disease in tomato plants. Arbuscular mycorrhizal (AM) fungi provide nutrients for host plants and are associated with their improved growth. However, the impact of AM on infection by plant viruses is not well understood. In this study, the interaction between Funneliformis mosseae and BCTIV in a susceptible tomato cultivar (Early Eurbana) was investigated. In a completely randomized design experiment, tomato seedlings were inoculated with F. mosseae, and after 4 weeks, they were inoculated with an infectious clone of BCTIV. Four treatments were included: untreated control plants (C), BCTIV-infected plants (V), mycorrhizal plants (M) and BCTIV-infected mycorrhizal plants (MV). Results of symptom evaluation based on a disease severity index showed a higher disease severity in MV plants compared to V plants. Supporting this result, a higher level of virus accumulation was observed in MV plants and this became more significant after long-term infection. The expression of three defense-related genes including HSP90, RLK and PRP1 was attenuated in MV plants compared to V plants, which may explain the enhanced symptom production and viral accumulation in these plants. A similar percentage of root colonization by F. mosseae in M and MV plants indicated that root colonization was not affected by BCTIV infection. These results show that mycorrhizal symbiosis increases the susceptibility of tomato plants to virus infection and favors BCTIV accumulation and symptom production.
- Published
- 2020
6. Prediction of Early Season Beet Leafhopper Populations in Southern New Mexico
- Author
-
Rebecca Creamer and Erik A. Lehnhoff
- Subjects
0106 biological sciences ,endocrine system ,Early season ,food.ingredient ,food and beverages ,Widespread Disease ,04 agricultural and veterinary sciences ,Plant Science ,Horticulture ,Biology ,biology.organism_classification ,Beet leafhopper ,01 natural sciences ,food ,Agronomy ,Curly top ,Becurtovirus ,Curtovirus ,Beet curly top virus ,040103 agronomy & agriculture ,0401 agriculture, forestry, and fisheries ,Sisymbrium irio ,010606 plant biology & botany - Abstract
Curly top is an important widespread disease in semiarid regions that can be caused by several Curtovirus and Becurtovirus species. The strains of beet curly top virus (BCTV) have been some of the most widely reported to be associated with curly top. The viruses causing curly top are phloem limited and transmitted by the beet leafhopper (BLH), Circulifer tenellus Baker (Hemiptera: Cicadellidae). The BLH can also transmit other important pathogens such as phytoplasmas. Both the virus and insect vector have a broad host range of crops and weeds, including the winter annual weed London rocket (Sisymbrium irio L.). Prior prediction of disease would allow growers a window of opportunity to make informed management choices. A prediction model of BLH abundance was developed for southern New Mexico based on fall precipitation, which corresponds with London rocket emergence, and BLH sticky trap catch data for 2001 to 2018. Regression analyses showed positive associations between BLH numbers and October + November rainfall (P < 0.001) for two areas within southern New Mexico. A third area, where good weed management was used, had lower BLH numbers, and the relationship with precipitation was not significant (P = 0.190). Cumulative-season BLH abundance was correlated with BLH abundance in late April (r = 0.43) and late May (r = 0.56), indicating that early season knowledge of BLH abundance is useful for planning later season management. Although models based on October + November precipitation are good predictors of BLH abundance through June, they may not predict year-long BLH abundance because other environmental and biological factors contribute to subsequent BLH success and movement.
- Published
- 2020
7. Molecular characterization of common bean curly stunt virus: a novel recombinant geminivirus in China
- Author
-
Xiaoyun Wu, Ruonan Zhang, Xiaoxia Wu, Xue Jiang, Xiaofei Cheng, and Xiaoyan Luan
- Subjects
China ,food.ingredient ,Virus ,Evolution, Molecular ,03 medical and health sciences ,food ,Genome Size ,Virology ,Turncurtovirus ,Curtovirus ,Amino Acid Sequence ,Genome size ,Peptide sequence ,Phylogeny ,030304 developmental biology ,Phaseolus ,0303 health sciences ,Whole Genome Sequencing ,Phylogenetic tree ,biology ,030306 microbiology ,food and beverages ,General Medicine ,biology.organism_classification ,Plant Leaves ,Geminiviridae ,Curly top ,Capsid Proteins ,Reassortant Viruses - Abstract
A new geminivirus was identified in common bean (Phaseolus vulgaris) showing severe stunt and leaf curling symptoms in Heilongjiang province of China, via sequencing and assembly of small RNAs. The genome of this geminivirus comprises 2,959 nucleotides (nt) and shares 21.77-54.97% nt sequence identity with other geminiviruses. The coat protein (CP) shares the highest amino acid (aa) sequence identity (23.5%) with that of sesame curly top virus (SeYMV; genus Turncurtovirus), whereas the C1 (Rep) shares the highest aa sequence identity (66.5%) with that of beet severe curly top virus (BSCTV; genus Curtovirus). This geminivirus neighbors the turncurtoviruses in phylogenetic trees based on the full genome sequence or the amino acid sequence of the Rep protein, but it forms a distinct clade in the phylogenetic tree based on the coat protein. Recombination analysis showed that parts of the C1 coding region of this geminivirus were recombined from a curtovirus or turncurtovirus. Based on these results, the name "common bean curly stunt virus" (CBCSV) is proposed for this virus.
- Published
- 2019
8. First Report of 'Candidatus Phytoplasma trifolii' Related Strain Associated with Yellowing and Witches'-Broom of Industrial Hemp (Cannabis sativa) in Arizona
- Author
-
Jiahuai Hu
- Subjects
biology ,Broom ,fungi ,food and beverages ,Plant Science ,16S ribosomal RNA ,biology.organism_classification ,Crop ,Horticulture ,Curly top ,Phytoplasma ,Beet curly top virus ,Shoot ,Agronomy and Crop Science ,Nested polymerase chain reaction - Abstract
In Arizona, industrial hemp (Cannabis sativa) is a newly cultivated crop for fiber, oil, cosmetic products, and health food. During July to September 2020, two fields of industrial hemp crops were identified in southern Arizona with 10 to 30% incidence of plants showing witches' broom. Disease incidence was assessed by counting symptomatic plants in 4 randomly selected rows of 25 plants in each field. Symptoms ranged from leaf mottling and yellowing on mildly affected plants to leaf curling and shortened internode length of stem on severely affected plants (Fig. 1). Shoots were randomly collected from eight symptomatic plants and three asymptomatic plants in the same area. Genomic DNA was extracted from 200 mg of each sample using DNeasy Plant Pro Kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. Phytoplasma was tested by a real-time PCR assay and TaqMan probe targeting the 23S ribosomal RNA gene that detects a wide range of known Phytoplasmas (Hodgetts et al., 2009). Beet curly top virus (BCTV) was targeted using BCTV-specific primers BCTV1 and BCTV2 following a method by Rondon (Rondon et al., 2016). BCTV was not detected in the plants, but Phytoplasmas were detected in all eight symptomatic plants, but not in the three control plants. The positive DNA samples were used to identify the phytoplasma by nested PCR using universal phytoplasma-specific primer pairs P1/P6 (Deng, S. et al. 1991) and R16F2n/R16R2 (Gundersen et al., 1996) targeting the 16S rRNA gene and the resulting 1.25 kb fragment in 4 positive samples was subjected to Sanger sequencing (Eton Bioscience, San Diego). All 4 sequences were identical and deposited in GenBank under accession MW981356. BLASTn results indicated 100% identity with that of several 'Candidatus Phytoplasma trifolii' strains on potato (KR072666, KF178706) in Washington and chile peppers (HQ436488) in New Mexico. It also shared 99.84% identity with the sequence of the reference strain of Candidatus Phytoplasma trifolii' (AY390261) that caused clover proliferation. The phytoplasma AZH1 was classified as a member of subgroup A within group16SrVI using iPhyClassifier, an interactive online tool for phytoplasma classification and taxonomic assignment (Zhao et al., 2013). Phylogenetic analysis revealed that the phytoplasma AZH1 clustered with other isolates of 'Candidatus Phytoplasma trifolii' (Fig. 2), including the strain NV1 associated with witches' broom on C. sativa in Nevada (Feng et al. 2019). This is the first report of 'Candidatus Phytoplasma trifolii' related strain associated with yellowing and witches' broom on hemp in Arizona. This finding is significant as the observation of symptoms at 30% incidence in one field suggested that the identified pathogen may pose a significant threat to the production of industrial hemp production in Arizona.
- Published
- 2021
9. New World Cactaceae Plants Harbor Diverse Geminiviruses
- Author
-
Gerardo R. Argüello-Astorga, Arvind Varsani, Michael C. Lund, Simona Kraberger, Pierre Lefeuvre, Joshua Schreck, Denis Filloux, Anthony Khalifeh, Simone G. Ribeiro, Raul Puente-Martinez, Jesús Aarón Avalos-Calleros, Andrew M. Salywon, Safaa G. Kumari, Philippe Roumagnac, Kehinde A. Oyeniran, Kara Schmidlin, Rafaela S. Fontenele, Lucas C. Majure, Amulya Bhaskara, Wendy C. Hodgson, Martin F. Wojciechowski, Matias Köhler, Darren P. Martin, Kendal Smith, Koenraad Van Doorslaer, Christian Vernière, Ilaria N. Cobb, Arizona State University [Tempe] (ASU), The Biodesign Center for Fundamental and Applied Microbiomics, Center for Evolution and Medicine, School of Life Sciences, Desert Botanical Garden, Florida Museum of Natural History [Gainesville], University of Florida [Gainesville] (UF), University of British Columbia [Vancouver], University of Texas at Dallas [Richardson] (UT Dallas), School of Behavioral and Brain Sciences, Instituto Potosino de Investigacion Cientifica y Tecnologica (IPICYT), Consejo Nacional de Ciencia y Tecnología [Mexico] (CONACYT), Universidade Federal do Rio Grande do Sul [Porto Alegre] (UFRGS), Laboratório de Estudos em Vegetação Campestre (LEVCamp), Programa de Pós-Graduação em Botânica, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil, School of Animal and Comparative Biomedical Sciences, University of Arizona, Arizona Cancer Center, International Center for Agricultural Research in the Dry Areas (ICARDA), Consultative Group on International Agricultural Research [CGIAR] (CGIAR), University of Cape Town, Institute of Infectious Diseases and Moleculare MedicineComputational Biolohy Group, Plant Health Institute of Montpellier (UMR PHIM), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de Montpellier (UM)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE)-Institut Agro - Montpellier SupAgro, Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro), Département Systèmes Biologiques (Cirad-BIOS), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad), Peuplements végétaux et bioagresseurs en milieu tropical (UMR PVBMT), Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de La Réunion (UR)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Embrapa Recursos Genéticos e Biotecnologia [Brasília], Structural Biology Research Unit, Department of Clinical Laboratory Sciences, The molecular work was supported by a start-up grant awarded to A.V. from Arizona State University, USA., RAFAELA S. FONTENELE, ARIZONA STATE UNIVERSITY, USA, ANDREW M. SALYWON, DESERT BOTANICAL GARDEN, USA, LUCAS C. MAJURE, UNIVERSITY OF FLORIDA, USA, ILARIA N. COBB, ARIZONA STATE UNIVERSITY, USA, AMULYA BHASKARA, ARIZONA STATE UNIVERSITY, USA, JESÚS A. AVALOS-CALLEROS, INSTITUTO POTOSINO DE INVESTIGACIÓN CIENTÍFICA Y TECNOLÓGICA, MEXICO, GERARDO R. ARGÜELLO-ASTORGA, INSTITUTO POTOSINO DE INVESTIGACIÓN CIENTÍFICA Y TECNOLÓGICA, MEXICO, KARA SCHMIDLIN, ARIZONA STATE UNIVERSITY, USA, ANTHONY KHALIFEH, ARIZONA STATE UNIVERSITY, USA, KENDAL SMITH, ARIZONA STATE UNIVERSITY, USA, JOSHUA SCHRECK, ARIZONA STATE UNIVERSITY, USA, MICHAEL C. LUND, ARIZONA STATE UNIVERSITY, USA, MATIAS KÖHLER, UFRGS, MARTIN F. WOJCIECHOWSKI, ARIZONA STATE UNIVERSITY, USA, WENDY C. HODGSON, DESERT BOTANICAL GARDEN, USA, RAUL PUENTE-MARTINEZ, DESERT BOTANICAL GARDEN, USA, KOENRAAD VAN DOORSLAER, UNIVERSITY OF ARIZONA, USA, SAFAA KUMARI, INTERNATIONAL CENTER FOR AGRICULTURAL RESEARCH IN THE DRY AREAS (ICARDA), LEBANON, KEHINDE A. OYENIRAN, UNIVERSITY OF CAPE TOWN, SOUTH AFRICA, CHRISTIAN VERNIÈRE, CIRAD, FRANCE, DENIS FILLOUX, CIRAD, FRANCE, PHILIPPE ROUMAGNAC, CIRAD, FRANCE, PIERRE LEFEUVRE, CIRAD, FRANCE, SIMONE DA GRACA RIBEIRO, Cenargen, SIMONA P. KRABERGER, ARIZONA STATE UNIVERSITY, USA, DARREN P. MARTIN, UNIVERSITY OF CAPE TOWN, SOUTH AFRICA, ARVIND VARSANI, ARIZONA STATE UNIVERSITY, USA., University of Britsh Columbia [Vancouver], Centre de Coopération Internationale en Recherche Agronomique pour le Développement (Cirad)-Institut de Recherche pour le Développement (IRD)-Université de Montpellier (UM)-Institut national d’études supérieures agronomiques de Montpellier (Montpellier SupAgro), Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut national d'enseignement supérieur pour l'agriculture, l'alimentation et l'environnement (Institut Agro)-Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement (INRAE), Department of Human Biology, and Faculty of Health Sciences
- Subjects
0106 biological sciences ,0301 basic medicine ,Cactaceae ,Phylogénie ,[SDV]Life Sciences [q-bio] ,01 natural sciences ,Genome ,Curtovirus ,2. Zero hunger ,Diversity ,biology ,Phylogenetic tree ,Opuntia ,QR1-502 ,Infectious Diseases ,Geminiviridae ,Curly top ,Cactus ,Becurtovirus ,food.ingredient ,Pathologie végétale ,Genome, Viral ,Microbiology ,Article ,diversity ,Hemiptera ,03 medical and health sciences ,food ,Virology ,Animals ,Virus classification ,Géminivirus ,Plant Diseases ,H20 - Maladies des plantes ,Virus des végétaux ,biology.organism_classification ,Recombination ,recombination ,Recombinaison ,030104 developmental biology ,Evolutionary biology ,010606 plant biology & botany - Abstract
International audience; The family Cactaceae comprises a diverse group of typically succulent plants that are native to the American continent but have been introduced to nearly all other continents, predominantly for ornamental purposes. Despite their economic, cultural, and ecological importance, very little research has been conducted on the viral community that infects them. We previously identified a highly divergent geminivirus that is the first known to infect cacti. Recent research efforts in non-cultivated and asymptomatic plants have shown that the diversity of this viral family has been under-sampled. As a consequence, little is known about the effects and interactions of geminiviruses in many plants, such as cacti. With the objective to expand knowledge on the diversity of geminiviruses infecting cacti, we used previously acquired high-throughput sequencing results to search for viral sequences using BLASTx against a viral RefSeq protein database. We identified two additional sequences with similarity to geminiviruses, for which we designed abutting primers and recovered full-length genomes. From 42 cacti and five scale insects, we derived 42 complete genome sequences of a novel geminivirus species that we have tentatively named Opuntia virus 2 (OpV2) and 32 genomes of an Opuntia-infecting becurtovirus (which is a new strain of the spinach curly top Arizona virus species). Interspecies recombination analysis of the OpV2 group revealed several recombinant regions, in some cases spanning half of the genome. Phylogenetic analysis demonstrated that OpV2 is a novel geminivirus more closely related to viruses of the genus Curtovirus, which was further supported by the detection of three recombination events between curtoviruses and OpV2. Both OpV2 and Opuntia becurtoviruses were identified in mixed infections, which also included the previously characterized Opuntia virus 1. Viral quantification of the co-infected cactus plants compared with single infections did not show any clear trend in viral dynamics that might be associated with the mixed infections. Using experimental Rhizobium-mediated inoculations, we found that the initial accumulation of OpV2 is facilitated by co-infection with OpV1. This study shows that the diversity of geminiviruses that infect cacti is under-sampled and that cacti harbor diverse geminiviruses. The detection of the Opuntia becurtoviruses suggests spill-over events between viruses of cultivated species and native vegetation. The threat this poses to cacti needs to be further investigated.
- Published
- 2021
10. Genome-based identification of beet curly top Iran virus infecting sugar beet in Turkey and investigation of its pathogenicity by agroinfection
- Author
-
Zafer Seçgin, Cansu Can, Çiğdem Gökçek Saraç, Vahid Tahan, Rıza Kaya, Ilkay Sevgen, Musa Kavas, and Kubilay Yıldırım
- Subjects
Veterinary medicine ,food.ingredient ,Turkey ,Virulence ,biology ,Agrobacterium ,fungi ,food and beverages ,Iran ,biology.organism_classification ,Genome ,Virus ,Geminiviridae ,food ,Curly top ,Virology ,Becurtovirus ,Curtovirus ,Sugar beet ,Beta vulgaris ,Sugars ,Phylogeny ,Virus classification ,Plant Diseases - Abstract
Beet curly top disease (BCTD) is a yield-limiting viral infection of sugar beet (Beta vulgaris) throughout the arid and semi-arid regions of the world. Two virus species, belonging to two different genera of the family Geminiviridae (Curtovirus and Becurtovirus) had been described as the disease’s causative agents on sugar beet. Despite the detection of the BCTD in some sugar beet fields of Turkey sixty years ago, the genome based characterization of BCTD-associated viruses have not been studied previously. In this study, 628 sugar beet plants exhibiting BCTD symptoms were collected from fourteen cities in central Anatolia, the major sugar beet production areas in Turkey. PCR assays of these samples using the respective Curtovirus and Becurtovirus genus-specific primers indicated that the Turkish sugar beet samples' viral sequences belong only to the genus Becurtovirus. The results of sequencing and phylogenetic analysis of the partial genome of the virus obtained from fourteen cities confirmed that BCTD-associated virus in Turkish sugar beet fields is beet curly top Iran virus (BCTIV-Becurtovirus) species. The whole genome of the collected viruses from fourteen cities were amplified by the rolling circle amplification (RCA) and the five most phylogenetically diverse viruses obtained from Afyon, Ankara, Adapazari, Yozgat and Aksaray were sequenced. The results of whole genome sequence analysis indicated >98% sequence identities with that of a BCTIV variants reported from Urmia province (bordering Turkey) of Iran. A virus genome from Yozgat city had a genomic sequence identity of >97% with those of BCTIV isolated from cowpea, tomato, pepper and sugar beet in the northern part of Iran. These results suggested that the spread of BCTIV through the region could create a significant threat to the production of sugar beet as well as other agricultural crops. A tandem dimer of a BCTIV-Turkish variant isolated from Ankara city was cloned into Agrobacterium plasmid to be used for agro-infection studies. Agroinoculation of this construct on sugar beet leaves generated severe BCTD symptoms (84%) which were also confirmed by RCA and qPCR analysis. These results constituted the first genome based characterization of BCTIV Turkish variants and the first report of BCTIV spreading out of Iran.
- Published
- 2022
11. Beet curly top virus transmission, epidemiology, and management
- Author
-
Rebecca Creamer
- Subjects
Range (biology) ,fungi ,food and beverages ,Biology ,Beet leafhopper ,biology.organism_classification ,law.invention ,Crop ,Leafhopper ,Transmission (mechanics) ,Agronomy ,Curly top ,law ,Beet curly top virus ,Weed - Abstract
Beet curly top viruses (BCTVs) are transmitted by leafhopper to a wide range of host plants, including many crop and weed hosts, and cause significant annual losses to irrigated agriculture in the western United States. The strains of BCTV, which show host-plant specificity, have changed over time, with new strains arising as recombinants. The beet leafhopper overwinters on weed hosts and moves from those hosts as they dry in the spring, feeding on crop plants, even nonpreferred hosts such as chili peppers and tomatoes, in their search for summer hosts. In New Mexico, the leafhoppers overwinter on mustard weeds such as London rocket and oversummer on weed hosts such as kochia, and cause significant losses to chili pepper and tomato crops. Management of curly top virus in New Mexico on these hosts is most effective when leafhopper numbers and disease can be predicted in advance and effective cultural controls can be implemented.
- Published
- 2020
12. Effect of Foliar Application with Salicylic Acid (Potasal), Mineral Phosphorus Levels and Inoculation Tomato Plant with Soluble Phosphorus Bacteria on Growth, Productivity and Reducing Disease Infect with Tomato Curly Top Virus (TCTV)
- Author
-
M. El-Sawy, R. Knany, and H. El-Koumy
- Subjects
Horticulture ,chemistry.chemical_compound ,biology ,Productivity (ecology) ,Curly top ,chemistry ,Inoculation ,Phosphorus ,chemistry.chemical_element ,biology.organism_classification ,Bacteria ,Salicylic acid ,Virus - Published
- 2018
13. Evidence of curtovirus competition and synergy in co-infected plant hosts
- Author
-
Jorge Achata Böttger, Li-Fang Chen, Rebecca Creamer, Robert Gilbertson, and Stephen A. Peinado
- Subjects
0106 biological sciences ,0301 basic medicine ,biology ,Host (biology) ,media_common.quotation_subject ,fungi ,food and beverages ,Plant Science ,biology.organism_classification ,01 natural sciences ,Microbiology ,Virology ,Virus ,Competition (biology) ,03 medical and health sciences ,Titer ,030104 developmental biology ,Infectious Diseases ,Curly top ,Curtovirus ,Beet curly top virus ,Geminiviridae ,010606 plant biology & botany ,media_common - Abstract
Curtoviruses, members of the Geminiviridae, have wide host ranges, including weeds and crops and are often found in mixed infections of different strains. While other members of the Geminiviridae have been demonstrated to interact through competition and synergism in mixed infections in plants, either type of interaction has not been reported in curtoviruses. This research used qPCR to study the interactions between Beet curly top virus, pepper curly top strain, isolate BV3 (BCTV-PeCT-BV3) and Beet curly top virus, beet severe curly top strain (BCTV-Svr) in three plant hosts. A significant decrease in virus titer in both BCTV-PeCTV and BCTV-Svr in co-infected sugar beets was observed when compared to beets infected with either virus, indicating competition. Chile pepper showed a significant increase in BCTV-PeCT titer in co-infected plants, compared to singly infected plants, indicating synergism. BCTV-PeCT caused severe symptoms and yielded high virus titer in chile, compared to the lack of symptoms and extremely low titer of BCTV-Svr in that plant host. These results indicate that curtovirus symptoms and infection can be host specific and such host may influence mixed infections of virus. Curtoviruses can interact through both competition and synergism and the response may be dependent on the type of host plant. Key words: Beet curly top virus, interspecific competition, host specificity, mixed infections
- Published
- 2018
14. Registration of FC1740 and FC1741 Multigerm, Rhizomania‐Resistant Sugar Beet Germplasm with Resistance to Multiple Diseases
- Author
-
Imad A. Eujayl, William M. Wintermantel, Lee Panella, Ann L. Fenwick, Carl A. Strausbaugh, Robert T. Lewellen, Piergiorgio Stevanato, and Kelley L. Richardson
- Subjects
0106 biological sciences ,0301 basic medicine ,education.field_of_study ,biology ,fungi ,Population ,food and beverages ,biology.organism_classification ,Cercospora beticola ,01 natural sciences ,Aphanomyces cochlioides ,Rhizoctonia solani ,03 medical and health sciences ,Horticulture ,030104 developmental biology ,Curly top ,Beet curly top virus ,Genetics ,Beet necrotic yellow vein virus ,Sugar beet ,education ,Agronomy and Crop Science ,010606 plant biology & botany - Abstract
FC1740 (Reg No. GP-293, PI 681717) and FC1741 (Reg No. GP-294, PI 681718) sugar beet germplasm (Beta vulgaris L.) were developed by the USDA-ARS at Fort Collins, CO, Salinas, CA, and Kimberly, ID, in cooperation with the Beet Sugar Development Foundation, Denver, CO. These germplasm are diploid, multigerm sugar beet populations in normal cytoplasm, segregating for self-sterility (Sf:SsSs), genetic male sterility (A:aa), and hypocotyl color (R:rr). FC1740 and FC1741 have excellent resistance to rhizomania (Beet necrotic yellow vein virus). FC1740 was selected as homozygous resistant to markers linked to both Rz1 and Rz2 genes for rhizomania resistance. FC1741 was selected as homozygous to the marker linked to the Rz2 gene for resistance. Both germplasm also have resistance to beet curly top (Beet curly top virus) and Fusarium yellows (Fusarium oxysporum Schlechtend.:Fr. f. sp. betae (D. Stewart) W. C. Snyder & H. N. Hans. and other Fusarium spp.), as well as moderate resistance to Aphanomyces root rot (Aphanomyces cochlioides Drechs.). Neither line exhibited resistance to Cercospora leaf spot (Cercospora beticola Sacc.), Rhizoctonia crown and root rot (Rhizoctonia solani Kuhn.) or sugar beet root aphid (Pemphigus spp.). These germplasm provide sources from which to select disease-resistant, multigerm pollinator parents with either or both of the Rz1 and Rz2 sources of rhizomania resistance. Because they are from the same population, they also are useful as controls of known genetic background in comparing entries screened for rhizomania resistance conditioned by Rz1 or Rz2.
- Published
- 2018
15. First Report of Curly Top of Coriandrum sativum Caused by Beet curly top virus in the Columbia Basin of Washington State
- Author
-
Kylie D Swisher Grimm, Lindsey J. du Toit, Rodney Cooper, Carrie H. Wohleb, Kenneth E. Frost, and James M. Crosslin
- Subjects
biology ,fungi ,food and beverages ,Plant Science ,Beet leafhopper ,biology.organism_classification ,Horticulture ,Sativum ,Curly top ,Phytoplasma ,Beet curly top virus ,Curtovirus ,Leaf curl ,Sugar beet ,Agronomy and Crop Science - Abstract
Two fields of coriander (Coriandrum sativum L.) seed crops of proprietary cultivars were observed in the Columbia Basin of Washington in July 2020 with 40 and 90% incidence of plants showing stunting and leaf and stem discoloration, sometimes with mild leaf curl. Foliar discoloration ranged from yellow to red and purple. Sweep-netting along the field edges collected one beet leafhopper (Circulifer tenellus Baker; BLH), the known vector of Beet curly top virus (BCTV), Beet leafhopper transmitted virescence agent (BLTVA) phytoplasma, and Spiroplasma citri, all of which affect Solanaceae and Apiaceae crops in Washington (Crosslin et al. 2006; Johnson and Martin 1998; Lee et al. 2006). Nucleic acids extracted from leaves and petioles of 12 coriander plants (8 from Field 1 and 4 from Field 2) using the Dellaporta method, and from the BLH using the CTAB method (Crosslin et al. 2006) were subjected to PCR assays to detect the BLH-transmitted pathogens which cause yellow and purple discoloration in potato (Solanum tuberosum L.) and carrot (Daucus carota subsp. sativus (Hoffm.) Arc.) in this region. BLTVA was targeted using a species-specific nested PCR assay with primers P1 and P7, followed by primers FU5 and BLTVA-int (Crosslin et al. 2006); S. citri was targeted using primers P89-F and P89-R (Yokomi et al. 2008); and BCTV was targeted using curtovirus primers BCTV2-F and BCTV2-R (Strausbaugh et al. 2008). BLTVA and S. citri were not detected in the plants, but curtovirus was detected in 10 of the 12 plants. All three pathogens were detected from the single BLH. A 519 bp region of the curtovirus capsid protein gene was amplified from seven plants (5 from Field 1 and 2 from Field 2) and the BLH, and cloned into TOP10 Escherichia coli cells using the pCR-2.1 TOPO vector (Invitrogen, Carlsbad, CA). Three clones were sequenced from each sample. For each of six plant samples and the BLH, the three clones were identical and consensus sequences were generated (GenBank Accessions MW234419 to MW234425). For the seventh plant, two clones were identical in sequence (MW234426) and the third contained 12 single nucleotide polymorphisms (MW234427). All sequences were subjected to an NCBI BLASTn analysis and showed 98.3 to 99.8% identity with BCTV sequences. Additional PCR assays with primers BMCTV-C1 2213F and BMCTV-C1 2609R (Strausbaugh et al. 2008), targeting the C1 gene of the Worland strain of BCTV, detected BCTV-Worland-like strains in all plants and the BLH, confirming that BCTV was present and indicating that the strain-specific primer pair was more sensitive than the universal curtovirus primers. Yield losses in the two fields were approximately 60%, with reduced seed size but not seed quality. BCTV infections in coriander crops have been observed in the Columbia Basin in 2002, 2005, 2008, and 2013, with yield losses ranging from 10 to 100% per field, though official reports were not made following the diagnoses (Crosslin, du Toit, and Frost, unpublished data). BCTV has caused millions of dollars of losses in the U.S. in crops such as sugar beet (Beta vulgaris subsp. vulgaris L.), tomato (S. lycopersicum L.), and pepper (S. annuum L.) (Johnson and Martin 1998). This is the first publication of BCTV affecting seed production of the specialty crop C. sativum. The observation of 90% incidence of symptoms in one field suggests that resistant cultivars and/or insect pest management practices are needed to prevent significant impacts of BCTV on coriander seed production in this semi-arid region.
- Published
- 2021
16. Sequences within the Spinach curly top virus virion sense promoter are necessary for vascular-specific expression of virion sense genes
- Author
-
Rao, Kavitha and Sunter, Garry
- Subjects
- *
BEET curly top virus , *SPINACH , *VIRION , *VIRAL genes , *NICOTIANA benthamiana , *GENETIC transcription , *RNA , *MESOPHYLL tissue , *VIRUSES - Abstract
Abstract: Sequences necessary for activity of the Spinach curly top virus virion sense promoter have been identified within an 84 bp region upstream of two transcription start sites located at nt 252 and 292. RNAs initiating at these sites are expressed at equivalent levels in SCTV-infected Arabidopsis and from promoter-reporter constructs. The promoter is capable of directing expression of all three virion sense genes, although not to the same degree. While CP and V3 expression are similar, expression of V2 is elevated. The promoter is active in transient leaf infusion assays in the absence of C2. In Nicotiana benthamiana plants the promoter is active in vascular tissue and under no conditions did we detect promoter activity in the mesophyll. This is in contrast to begomoviruses where the virion sense promoter is dependent on AL2, a positional homolog of C2, and the promoter is functional in both vascular and mesophyll tissue. [Copyright &y& Elsevier]
- Published
- 2012
- Full Text
- View/download PDF
17. Seed Treatments for the Control of Insects and Diseases in Sugarbeet.
- Author
-
Strausbaugh, Carl A., Eujayl, Imad A., and Foote, Paul
- Subjects
- *
SEED treatment , *NEONICOTINOIDS , *CLOTHIANIDIN , *LEAFMINERS , *BEAN aphid , *SUGAR beets , *PLANT diseases , *BLOCK designs , *CURLY top disease - Abstract
Insect feeding and vectoring of viruses cause serious problems in sugarbeet (Betiz vulgaris L.) production worldwide. In order to ameliorate insects and diseases on sugarbeet, two seed treatments, Poncho Beta (60 g a.i. [active ingredient] clothianidin + 8 g a.i. beta-cyfluthrin/100,000 seeds) and Cruiser Tef (60 g a.i. thiamethoxam + 8 g a.i. tefluthrin/100,000 seeds) were investigated in a series of five field trials from 2006 to 2009. The two seed treatments and an untreated check were tested on commercial sugarbeet cultivars in a randomized complete block design with eight replications. Insect incidence and curly top symptoms were evaluated. Both Poncho Beta and Cruiser Tef provided significant reduction in curly top symptoms and incidence of leafminers (Pegomya spp.), black bean aphid (Aphis fabae Scopoli), and sugarbeet root aphid (Pemphigus betae Doane). In the two trials conducted under curly top pressure, Poncho Beta and Cruiser Tef had more root yield than the untreated check by 3.4 to 15.1 t/ha. In the three trials without curly top pressure, Poncho Beta and Cruiser Tef resulted in root yield increases of 3.1 to 6.7 t/ha over that of the untreated check. Neonicotinoid seed treatments play an important role in early season disease and insect management in sugarbeet production, but should be viewed as a supplement to host plant resistance rather than a substitute for it. [ABSTRACT FROM AUTHOR]
- Published
- 2010
- Full Text
- View/download PDF
18. Beet curly top virus Strains Associated with Sugar Beet in Idaho, Oregon, and a Western U.S. Collection
- Author
-
Carl A. Strausbaugh, William M. Wintermantel, and Imad A. Eujayl
- Subjects
0106 biological sciences ,0301 basic medicine ,Veterinary medicine ,Colorado ,Idaho ,Genome, Viral ,Plant Science ,01 natural sciences ,California ,law.invention ,Oregon ,03 medical and health sciences ,Disease severity ,law ,Botany ,Polymerase chain reaction ,Host resistance ,biology ,Strain (biology) ,fungi ,food and beverages ,biology.organism_classification ,Beet leafhopper ,Geminiviridae ,030104 developmental biology ,Curly top ,Beet curly top virus ,Sugar beet ,Beta vulgaris ,Sugars ,Agronomy and Crop Science ,010606 plant biology & botany - Abstract
Curly top of sugar beet is a serious, yield-limiting disease in semiarid production areas caused by Beet curly top virus (BCTV) and transmitted by the beet leafhopper. One of the primary means of control for BCTV in sugar beet is host resistance but effectiveness of resistance can vary among BCTV strains. Strain prevalence among BCTV populations was last investigated in Idaho and Oregon during a 2006-to-2007 collection but changes in disease severity suggested a need for reevaluation. Therefore, 406 leaf samples symptomatic for curly top were collected from sugar beet plants in commercial sugar beet fields in Idaho and Oregon from 2012 to 2015. DNA was isolated and BCTV strain composition was investigated based on polymerase chain reaction assays with strain-specific primers for the Severe (Svr) and California/Logan (CA/Logan) strains and primers that amplified a group of Worland (Wor)-like strains. The BCTV strain distribution averaged 2% Svr, 30% CA/Logan, and 87% Wor-like (16% had mixed infections), which differed from the previously published 2006-to-2007 collection (87% Svr, 7% CA/Logan, and 60% Wor-like; 59% mixed infections) based on a contingency test (P < 0.0001). Whole-genome sequencing (GenBank accessions KT276895 to KT276920 and KX867015 to KX867057) with overlapping primers found that the Wor-like strains included Wor, Colorado and a previously undescribed strain designated Kimberly1. Results confirm a shift from Svr being one of the dominant BCTV strains in commercial sugar beet fields in 2006 to 2007 to becoming undetectable at times during recent years.
- Published
- 2017
19. Systemic Insecticides and Plant Age Affect Beet Curly Top Virus Transmission to Selected Host Plants
- Author
-
Heping Wang, P. de A. Gurusinghe, and Bryce W. Falk
- Subjects
biology ,fungi ,food and beverages ,Plant Science ,biology.organism_classification ,Beet leafhopper ,Crop ,Horticulture ,chemistry.chemical_compound ,Curly top ,chemistry ,Imidacloprid ,Beet curly top virus ,Botany ,Sugar beet ,Agronomy and Crop Science ,Dimethoate ,Circulifer - Abstract
Greenhouse and field studies were conducted to assess the effects of systemic insecticides and plant age on beet curly top virus (BCTV) transmission to sugar beet, tomato, pepper, melon, and cowpea. Sugar beets were the most susceptible to BCTV infection. For all BCTV-susceptible plants tested, younger plants showed greater susceptibility to infection than did older plants, even when inoculations were delayed by only 1 week. Systemic insecticides applied to test plants resulted in increased beet leafhopper (Circulifer tenellus) mortality and decreased the percent BCTV transmission. Soil treatment with imidacloprid (250 g a.i./ha) gave significantly better reductions in BCTV transmission than did dimethoate foliar sprays (280 g a.i./ha). These data suggest that the use of specific systemic insecticides only when crop plants are most susceptible to BCTV infection could be an effective alternative component of the curly top disease control program.
- Published
- 2019
20. Complementary-sense gene regulation in beet curly top virus-SpCT
- Author
-
Jennifer Guerrero and Garry Sunter
- Subjects
Gene Expression Regulation, Viral ,Biology ,medicine.disease_cause ,Article ,03 medical and health sciences ,Viral Proteins ,Start codon ,Virology ,Curtovirus ,Sense (molecular biology) ,medicine ,Promoter Regions, Genetic ,Gene ,030304 developmental biology ,Genetics ,Regulation of gene expression ,0303 health sciences ,Mutation ,Binding Sites ,030306 microbiology ,food and beverages ,General Medicine ,biology.organism_classification ,Geminiviridae ,Curly top ,Begomovirus ,Beet curly top virus - Abstract
A 278-bp region upstream of the beet curly top virus-SpCT (BCTV-SpCT) C2/C3 genes is necessary for promoter activity and exhibits significant sequence similarity to AL2/3 promoter sequences in tomato golden mosaic virus (TGMV). Maximal expression of the downstream C2/3 genes in BCTV-SpCT requires the presence of the C1 protein, which is supported by observations that mutation of the initiator codon for C1 results in decreased C2/C3 expression. This is similar to TGMV and cabbage leaf curl virus, where AL1 is required for maximal AL2/3 expression. Together, these data suggest a common strategy for complementary-sense gene regulation amongst curtoviruses and begomoviruses.
- Published
- 2019
21. Sugar Beet Performance with Curly Top Is Related to Virus Accumulation and Age at Infection
- Author
-
Stephen Kaffka and William M. Wintermantel
- Subjects
biology ,Homoptera ,fungi ,food and beverages ,Plant Science ,biology.organism_classification ,Horticulture ,Curly top ,Disease management (agriculture) ,Botany ,Beet curly top virus ,Curtovirus ,Sugar beet ,Geminiviridae ,Cultivar ,Agronomy and Crop Science - Abstract
Resistance to curly top disease caused by Beet curly top virus (BCTV) and related curtoviruses has been important to sustainable sugar beet (Beta vulgaris) production in the western United States for most of the last century. Recent advances in sugar beet genetics have led to the development of high-yielding cultivars, but these cultivars have little resistance to curly top disease. These cultivars are highly effective when disease management practices or environmental factors minimize curly top incidence, but can result in significant losses in years with early infection or abundant curly top. A greenhouse assay has been developed to rapidly test cultivars for a broad array of factors affecting performance in the presence of curly top. Previous studies have shown that sugar beet plants were more susceptible and losses more severe when seedlings were infected by BCTV, but less severe when plants were larger at the time of infection. To evaluate more precisely the relationship between age at infection, disease severity, virus accumulation, and yield loss in modern cultivars that were not bred for curly top resistance, individual sugar beet plants varying in degree of resistance and susceptibility to curly top were inoculated by viruliferous beet leafhoppers (Circulifer tenellus) when plants had two, four, or six true leaves, and maintained in a greenhouse for 6 weeks. When plants were inoculated at the two-leaf stage, all cultivars became severely stunted, with high disease ratings and similar rates of symptom development, regardless of resistance or susceptibility of the cultivar. Plants inoculated at four-and six-leaf stages exhibited increasing separation between resistant and susceptible phenotypes, with highly resistant cultivars performing well with low disease ratings and increased plant weights relative to susceptible cultivars. High-yielding cultivars performed only slightly better than the susceptible control cultivar. Results from greenhouse trials matched those from field trials conducted under heavy curly top pressure. Importantly, low virus concentration was directly correlated with lower disease ratings and higher plant weight, while elevated virus concentrations corresponded to higher disease ratings and lower weights. This demonstrates that a rapid greenhouse assay involving multiple traits can provide a rapid and effective means of selecting cultivars with improved curly top control, and could lead to more rapid incorporation of resistance into high-yielding sugar beet.
- Published
- 2019
22. Relationship of Beet Curly Top Foliar Ratings to Sugar Beet Yield
- Author
-
John J. Gallian, Carl A. Strausbaugh, Clinton C. Shock, Anne M. Gillen, Stacey Camp, and Eric P. Eldredge
- Subjects
biology ,fungi ,food and beverages ,Plant Science ,Plant disease resistance ,Beet leafhopper ,biology.organism_classification ,Agronomy ,Curly top ,Curtovirus ,Sugar beet ,Cultivar ,Sugar ,Agronomy and Crop Science ,Circulifer - Abstract
Strausbaugh, C. A., Gillen, A. M., Camp, S., Shock, C. C., Eldredge, E. P., and Gallian, J. J. 2007. Relationship of beet curly top foliar ratings to sugar beet yield. Plant Dis. 91:1459-1463. Sugar beet (Beta vulgaris) varieties were evaluated for disease resistance to curly top to establish if disease ratings made in inoculated nurseries correlated with disease ratings and yield in sugar beet crops exposed to natural disease outbreaks. Cultivars were planted both in inoculated curly top nurseries in Kimberly, ID, and in commercial cultivar trials in irrigated fields near Ontario, OR and Nampa, ID. Plants were evaluated for curly top using a rating scale of 0 (no symptoms) to 9 (dead). Moderate disease pressure in the Ontario (mean rating = 3.8) and Nampa (mean rating = 4.1) fields resulted in significant differences for disease rating, root yield, sugar content, and estimated recoverable sugar among cultivars. Disease ratings from both commercial fields were positively correlated (r = 0.91 and 0.82, P < 0.0001) with ratings from the inoculated nurseries. In commercial fields, root yield was negatively related to disease rating (r 2 = 0.47 and 0.39, P ≤ 0.0004). For each unit increase in disease rating (increasing susceptibility), root yield decreased 5.76 to 6.93 t/ha. Thus, curly top nurseries reliably predict curly top resistant cultivars for commercial cultivation. Additional keywords: BCTV, beet leafhopper, BMCTV, BSCTV, Circulifer tenellus, Curtovirus, geminivirus
- Published
- 2019
23. Immunodetection of Two Curtoviruses Infecting Sugar Beet
- Author
-
Carl A. Strausbaugh, Jenny S. Durrin, Olga V. Nikolaeva, and Alexander V. Karasev
- Subjects
Germplasm ,biology ,fungi ,food and beverages ,Nicotiana benthamiana ,Plant Science ,biology.organism_classification ,Virology ,law.invention ,Capsid ,Curly top ,law ,Plant virus ,Botany ,Curtovirus ,Sugar beet ,Agronomy and Crop Science ,Polymerase chain reaction - Abstract
Durrin, J. S., Nikolaeva, O. V., Strausbaugh, C. A., and Karasev, A. V. 2010. Immunodetection of two curtoviruses infecting sugar beet. Plant Dis. 94:972-976. Beet leafhopper-transmitted curly top virus is a serious problem in many different crops in the semiarid western United States, including sugar beet, tomatoes, and beans. Curly top is caused by a genetically diverse complex of phloem-limited curtoviruses. Due to the phloem restriction of curtoviruses and the lack of a convenient laboratory host–vector system for curly top virus propagation and purification, no commercial immunodetection tests are available for curtoviruses. Routine diagnostics for curly top rely either on visual symptoms or on polymerase chain reaction (PCR) tests. Lack of an enzyme-linked immunosorbent assay (ELISA) system is one of the factors hampering development and screening of the curly top resistant germplasm in, for instance, sugar beet and bean breeding programs. To fill in this gap, we developed an ELISAbased detection system for curtoviruses which utilizes virus-specific antibodies generated against bacterially expressed capsid protein (CP) of Beet mild curly top virus. Bacterially expressed CP was affinity purified and used as an antigen for antibody production in two animal species. Specificity of the resulting antisera was tested in Western blots and various tripleantibody sandwich (TAS)-ELISA formats with sugar beet, bean, and Nicotiana benthamiana leaf tissue. We demonstrate reliable detection of two curtoviruses in different crops in TAS-ELISA format, suitable for large-scale screening of germplasm in breeding programs.
- Published
- 2019
24. First Report of a New Curtovirus Species, Spinach severe curly top virus, in Commercial Spinach Plants (Spinacia oleracea) from South-Central Arizona
- Author
-
Judith K. Brown and C. Hernandez
- Subjects
Plant Science ,Biology ,biology.organism_classification ,Beet leafhopper ,Genetic analysis ,Virology ,Complete sequence ,Curly top ,Plant virus ,Curtovirus ,Botany ,Primer walking ,Spinach ,Agronomy and Crop Science - Abstract
During April 2009, a commercial spinach field (1 km2 [250 acres]) in south-central Arizona developed geminivirus-like disease symptoms (4). Approximately 40 to 50% of the spinach plants exhibited extreme leaf distortion, foliar interveinal chlorosis, shortened internodes, and ~80% yield reduction. The beet leafhopper, Circulifer tenellus, the only known insect vector of curtoviruses in the United States, was observed on spinach plants. Total DNA was isolated (1) from three plant samples exhibiting the same symptom phenotype and used to PCR-amplify a 446-bp fragment of a suspected curtovirus, using primers F 5′-CTACCATCAGTAATGATGGG-3′and R 5′ CATATTTGCCACCTCCAGTGTC-3′ designed around the coat protein gene (Cp) for several known curtoviruses. DNA sequencing and BLAST analysis of the cloned fragments (n = 3 with 100% identity) revealed BLAST matches at 81 to 83% with the Cp for three isolates of Beet curly top Iran virus (BCTIV) (EU273816–18). To amplify the full-length curtovirus genome, total DNA from one of the three positive samples was used as the template in rolling circle amplification (RCA) employing the non-sequence specific TempliPhi 100 Amplification System (GE Healthcare) that amplifies circular DNA templates. The RCA products were linearized with PstI, yielding a ~3-Kbp fragment that was cloned into pGEM3zf+ (Promega, Madison, WI). To obtain the complete sequence, one plasmid (09-10-8) containing a full-length insert was selected and prepared for sequencing with the Template Generation System II Kit (Finnzymes, Espoo, Finland). The resultant 28 sequences were assembled into a contig using SeqMan software (DNASTAR, Madison, WI). Also, RCA clones (09.10-2, -3, and -4) from the same sample were subjected to DNA sequencing with universal M13F and M13R primers followed by primer walking (>300 bp overlap). The four 3,066-bp genomes shared 99 to 100% nt identity. An alignment (ClustalV; MegAlign, DNASTAR) with sequences of all curtovirus species available in GenBank indicated that the Arizona spinach isolates shared the highest nt sequence identity (59%) with Horseradish curly top virus (HrCTV). The next closest relatives were Beet mild curly top virus, Beet severe curly top virus, and Spinach curly top virus, at 50%. The genome consists of six open reading frames and lacks the AC3 gene, an arrangement most similar to HrCTV (3). The ICTV approved working cut-off for Curtovirus species demarcation at References: (1) J. J. Doyle and J. L. Doyle. Focus 12:13, 1990. (2) C. M. Fauquet et al. Arch. Virol. 153:783, 2008. (3) K. A. Klute et al. J. Gen. Virol. 77:1369, 1996. (4) C. Nischwitz and M. W. Olsen. Online publication. doi:10.1094/PHP-2010-0216-01-BR. Plant Health Progress. 2010.
- Published
- 2019
25. First Report of Beet mild curly top virus in Dry Bean in Zacatecas, Mexico
- Author
-
Gerardo R. Argüello-Astorga, Rodolfo Velásquez-Valle, J. A. Mauricio-Castillo, J. Mena-Covarrubias, L. R. Reveles-Torres, and Miguel Ángel Salas-Luévano
- Subjects
biology ,food and beverages ,Plant Science ,Beet leafhopper ,biology.organism_classification ,Restriction fragment ,Curly top ,Plant virus ,Curtovirus ,Botany ,biology.protein ,Geminiviridae ,Phaseolus ,Restriction fragment length polymorphism ,Agronomy and Crop Science - Abstract
In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.
- Published
- 2019
26. First Report of Curly Top Disease of Basil Caused by Beet severe curly top virus in California
- Author
-
S. Cabrera, Eric T. Natwick, Li-Fang Chen, and Robert L. Gilbertson
- Subjects
food.ingredient ,biology ,fungi ,Basilicum ,food and beverages ,Plant Science ,Ocimum ,biology.organism_classification ,Beet leafhopper ,food ,Curly top ,Plant virus ,Botany ,Curtovirus ,Primer (molecular biology) ,Agronomy and Crop Science ,Circulifer - Abstract
In August 2012, symptoms of stunted growth and leaf epinasty, crumpling, and yellowing, were observed in basil plants (Ocimum basilicum) grown in a shadehouse in Calipatria in the Imperial Valley of California. Populations of the beet leafhopper (Circulifer tenellus) carrying curtoviruses (genus Curtovirus, family Geminiviridae) were detected in the Imperial Valley in May 2012. Together, this suggested a curtovirus etiology for this virus-like disease of basil. Total DNA extracts were prepared from leaves of nine representative symptomatic plants (BA1 through 9) and used in the PCR with the general curtovirus primer pair, BGv377 and BGc1509 (1,2). This primer pair directed the amplification of the expected ~1.1 kb DNA fragments from extracts prepared from all nine plants, and not from equivalent extracts from symptomless plants. The sequences of 1.1 kb fragments amplified from four plants (BA1 through 4) were determined, and BLAST analyses revealed 99% nucleotide sequence identities among these sequences, and 98% identities with the homologous region (V2/CP) of Beet severe curly top virus-Cfh (BSCTV-Cfh; GenBank Accession No. U02311). A second primer pair (BGv981 5′-AACGGTCAGGCTATGCCGTCTAC-3′ and BGc479 5′-GAAAGACCTCGCCTTCTTCTAGGG-3′) was designed to amplify the remainder of the viral genome. The expected size ~2.4 kb fragments were amplified from the extracts of the BA1 through 9 plants, and the fragments from the BA1 and 2 plants were cloned into the pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. Using the sequences of the overlapping PCR-amplified fragments, the complete viral genome sequences of the BA1 and BA2 isolates were determined. The BA1 and BA2 sequences were 2,934 bp and were 99% identical to each other and to the sequence of BSCTV-Cfh (3). To confirm the infectivity of BSCTV in basil, the BSCTV-Cfh infectious clone, which originated from California, was used for agroinoculation and leafhopper transmission experiments in basil plants (cvs. Sweet aroma and Genovese). Basil plants agroinoculated with the BSCTV-Cfh clone developed stunted growth and leaf crumpling and curling symptoms, similar to symptoms observed in the symptomatic plants from the Imperial Valley. The presence of viral DNA in symptomatic plants was confirmed by PCR with the BGv377/BGc1509 primer pair. Basil plants inoculated with an empty vector control did not develop symptoms, nor was curtovirus DNA amplified from these plants by PCR. Beet leafhoppers were given a 48-h acquisition access period on BSCTV-Cfh-infected sugarbeet plants, followed by a 48-h inoculation access period on healthy basil plants. These plants developed curly top symptoms approximately 21 days after inoculation, indicating that BSCTV was transmitted to basil by the beet leafhopper. Together, these results establish that the cause of the disease symptoms in basil in the Imperial Valley of California was BSCTV. This is the first report of curly top disease in basil, which is the second member of the mint family (Lamiaceae) known to be infected by a curtovirus. The stunted growth induced in basil by BSCTV has the potential to cause yield and economic loss, particularly in open field or screenhouse production when beet leafhopper populations are high. References: (1) L-F. Chen et al. Plant Dis. 94:99, 2010. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (3) D. C. Stenger. Mol. Plant-Micro. Interact. 7:154, 1994.
- Published
- 2019
27. Length of Efficacy for Control of Curly Top in Sugar Beet With Seed and Foliar Insecticides
- Author
-
Erik J. Wenninger, Carl A. Strausbaugh, and Imad A. Eujayl
- Subjects
0106 biological sciences ,biology ,Neonicotinoid ,Sowing ,Clothianidin ,Plant Science ,biology.organism_classification ,01 natural sciences ,010602 entomology ,chemistry.chemical_compound ,chemistry ,Curly top ,Agronomy ,Seed treatment ,Beet curly top virus ,Sugar beet ,Esfenvalerate ,Agronomy and Crop Science ,010606 plant biology & botany - Abstract
Curly top in sugar beet caused by Beet curly top virus (BCTV) is an important yield-limiting disease that can be reduced via neonicotinoid and pyrethroid insecticides. The length of efficacy of these insecticides is poorly understood; therefore, field experiments were conducted with the seed treatment Poncho Beta (clothianidin at 60 g a.i. + beta-cyfluthrin at 8 g a.i. per 100,000 seed) and foliar treatment Asana (esfenvalerate at 55.48 g a.i./ha). A series of four experiments at different locations in the same field were conducted in 2014 and repeated in a neighboring field in 2015, with four treatments (untreated check, Poncho Beta, Asana, and Poncho Beta + Asana) which were arranged in a randomized complete block design with eight replications. To evaluate efficacy, viruliferous (contain BCTV strains) beet leafhoppers were released 8, 9, 10, or 11weeks after planting for each experiment, which corresponded to 1, 2, 3, and 4 weeks after Asana application. Over both years, in 30 of 32 observation dates for treatments with Poncho Beta and 14 of 16 observation dates for Asana, visual curly top ratings decreased an average of 41 and 24%, respectively, with insecticide treatments compared with the untreated check. Over both years, in eight of eight experiments for treatments with Poncho Beta and six of eight experiments for Asana, root yields increased an average of 39 and 32%, respectively, with treatment compared with the untreated check. Over both years, the Poncho Beta treatments increased estimated recoverable sucrose (ERS) yield by 75% compared with the untreated check for weeks 8 and 9. By week 10, only the Poncho Beta + Asana treatment led to increases in ERS in both years, while the influence of increasing host resistance may have made other treatments more difficult to separate. When considering curly top symptoms, root yield, and ERS among all weeks and years, there was a tendency for the insecticides in the Poncho Beta + Asana treatment to complement each other to improve efficacy.
- Published
- 2019
28. First Report of Beet curly top virus Infecting Industrial Hemp (Cannabis sativa) in Arizona
- Author
-
Jiahuai Hu, Laura Dickey, and Robert Masson
- Subjects
Chlorosis ,Broom ,fungi ,food and beverages ,Plant Science ,Biology ,biology.organism_classification ,Crop ,Leafhopper ,Horticulture ,Curly top ,Beet curly top virus ,Sugar beet ,Agronomy and Crop Science ,Circulifer - Abstract
Industrial hemp (Cannabis sativa) is an emerging crop in Arizona, with many uses, including fiber, cosmetic products, and health food. In 2020, severe curly top disease outbreaks were observed in several hemp fields in Yuma and Graham Counties, Arizona, where disease incidence and severity were considerably high, up to 100% crop loss occurring in some fields. A wide range of symptoms have been observed at different infection stages and plant growth stages at the time of infection. Early stage symptoms manifest as light green-to-yellowing of new growth, similar to sulfur or micronutrient deficiency, usually combined with older leaves with dark green "blotchy" mosaic mottling overlaying light green chlorosis. Mosaic mottling of older leaves continues into mid-growth stage, and is coupled with more severe yellowing and witch's broom (stunted leaves and shortened internode length of stem) of apical meristematic tissue. Curling and twisting of new leaves has also been observed. Symptoms often appear to be isolated to individual branches, with other branches showing no visual symptoms, often outgrowing and covering affected branches until harvest. Late stage symptoms include severe leaf curling with or without twisting, continued stunting, and necrosis of yellow leaves, resulting in significant yield reduction. Severely affected plants dwarfed by the virus experienced high mortality rates later into the season, most likely attributed to reduced ability to overcome abiotic stress conditions. These symptoms indicated the likelihood of curly top caused by Beet curly top virus (BCTV), which has been recently reported in Colorado (Giladi et al., 2020). Shoots were collected from thirty-eight symptomatic and nine asymptomatic hemp plants from July to August, 2020. Leaves were also collected as positive control from four chili pepper plants with or without curly top symptoms in Cochise County. Genomic DNA was extracted using DNeasy Plant Pro Kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. BCTV-specific primers BCTV1 and BCTV2 were used to detect BCTV following a method by Rondon (Rondon et al., 2016). A 500 bp DNA fragment, indicative of BCTV, was amplified from all symptomatic hemp and chili pepper samples, but not from asymptomatic samples. Sequence analysis of this 500 bp DNA fragment revealed 98.99 % identity with GenBank accession MK803280, which is Beet curly top virus isolate from hemp identified in Western Colorado (Giladi et al., 2020). The full-length genomes of BCTV isolates from hemp and chili peppers were generated with additional primers 328F/945R (620bp), 455F/ 945R (490bp), OutR/ 2213F (1,190bp), 2609R/ 1278R (1,340bp), BCTV2/ 2609R (1,890bp) (Rondon et al., 2016, Strausbaugh et al., 2008). The complete nucleotide sequence (MW182244) from hemp was 2,929 bp and had 99.35% sequence identity with GenBank accession KX867055, which was a Worland strain of Beet curly top virus isolated from an Idaho sugar beet plant (Strausbaugh et al., 2017). Our hemp BCTV genome sequences shared 96.08% identity with the hemp strain of BCTV from Colorado (MK803280) and 99.50% identity with the BCTV isolate (MW188519) from chili pepper identified in this study. BCTV was reported on outdoor hemp in Western Colorado, in 2020 (Giladi et al., 2020). This is the first report of BCTV in Arizona causing curly top of industrial hemp in the field. In Arizona, BCTV is widespread on many agronomic crops including chili peppers and spread primarily by the phloem-feeding beet leafhoppers: Circulifer tenellus (Hemiptera: Cicadellidae) (Bennett, 1967). Due to the wide distribution of beet leafhoppers and abundant range of host plants for the virus, BCTV may become one of the most yield-limiting factors affecting the emerging industrial hemp production systems in Arizona.
- Published
- 2021
29. Evaluation of sugar beet lines for resistance to beet curly top viruses
- Author
-
Abazar Rajabi, Masoud Shams-Bakhsh, Seyed Bagher Mahmoudi, and Razieh Montazeri
- Subjects
0106 biological sciences ,0301 basic medicine ,viruses ,Plant Science ,Horticulture ,Biology ,01 natural sciences ,Virus ,law.invention ,03 medical and health sciences ,law ,Plant virus ,Genetics ,Polymerase chain reaction ,Inoculation ,fungi ,food and beverages ,biology.organism_classification ,Virology ,Disease damage ,030104 developmental biology ,Curly top ,Beet curly top Iran virus ,Sugar beet ,Agronomy and Crop Science ,010606 plant biology & botany - Abstract
Curly top disease caused by beet curly top viruses (BCTVs) has been a problem in sugar beet fields for a long time. In recent years, climate change has increased the spread of virus vectors and disease damage in infected regions. To find a natural resistance source to curly top viruses in Iran (Beet curly top virus-C, BCTV-C and Beet curly top Iran virus, BCTIV), the reaction of 50 sugar beet lines to the above-mentioned viruses was evaluated in a completely randomized design experiment in 2014. Sugar beet lines were agroinoculated at the 4–6 leaf stage by virus infectious clones under greenhouse condition and then the symptom severity and virus presence was monitored by enzyme-linked immunosorbent assay and polymerase chain reaction methods 8 weeks after inoculation. Five out of 50 lines were found to be resistant to both viruses. Given that both viruses were detected in most sugar beet cultivation areas in Iran, these lines could be suggested for cultivation in Iran. In addition, some lines displayed completely different reactions to the viruses indicating different effects of the viruses on sugar beet lines.
- Published
- 2016
30. First report of sesame curly top virus infecting vegetables and ornamental plants in Iran
- Author
-
Vahid Hasanvand and Jahangir Heydarnejad
- Subjects
Horticulture ,Curly top ,Ornamental plant ,Plant Science ,Biology ,Virus - Published
- 2020
31. Identification of a new turncurtovirus in the leafhopper Circulifer haematoceps and the host plant species Sesamum indicum
- Author
-
Mehdi Kamali, Vahid Hasanvand, Hossain Massumi, Anders Kvarnheden, Arvind Varsani, and Jahangir Heydarnejad
- Subjects
0106 biological sciences ,0301 basic medicine ,food.ingredient ,Genes, Viral ,Genome, Viral ,01 natural sciences ,Sesamum ,Hemiptera ,03 medical and health sciences ,food ,Genus ,Virology ,Turncurtovirus ,Botany ,Brassica rapa ,Genetics ,Animals ,Geminiviridae ,Molecular Biology ,Phylogeny ,biology ,Mosaic virus ,General Medicine ,Genomics ,biology.organism_classification ,Leafhopper ,030104 developmental biology ,Curly top ,010606 plant biology & botany - Abstract
Turncurtoviruses (family: Geminiviridae; genus: Turncurtovirus) appear to have a high degree of genetic variation in Iran. Leafhoppers of the species Circulifer haematoceps (Mulsant and Rey, 1855) (family: Cicadellidae) were collected in 2014 from three geographical regions in south-eastern Iran (Orzoeyeh, Jiroft and Sirjan; Kerman province) and screened for the presence of turncurtoviruses using a combination of PCR and rolling circle amplification (RCA) methods. Eleven genomes of turncurtovirus were recovered and sequenced. Leafhoppers were sampled off sesame (S. indicum L.) and turnip (Brassica rapa sub sp. rapa). Thus, we identified three symptomatic sesame plants (yellowing, boat-shaped leaf curling, vein swelling on the lower leaf surfaces) from sesame farms in Jiroft. In these samples, we identified the same turncurtovirus as in the leafhoppers and have named it sesame curly top virus (SeCTV). Collectively, these SeCTV share > 98% genome-wide pairwise identity and ~ 87.3% to a recently identified turncurtovirus (sesame yellow mosaic virus; SeYMV) from sesame in Pakistan (GenBank accession MF344550). The SeCTV and SeYMV sequences share
- Published
- 2018
32. CURLY TOP VIRUS IN CALIFORNIA: REVIEW, CURRENT MANAGEMENT PRACTICES AND FUTURE DIRECTIONS
- Author
-
C. J. Rivara
- Subjects
Curly top ,Current management ,Plant virus ,Advertising ,Horticulture ,Biology ,Virology ,Virus - Published
- 2015
33. First Report of 'Candidatus Phytoplasma trifolii' Related Strain Associated with Yellowing and Witches'-Broom of Industrial Hemp (Cannabis sativa) in Arizona.
- Author
-
Hu J
- Abstract
In Arizona, industrial hemp (Cannabis sativa) is a newly cultivated crop for fiber, oil, cosmetic products, and health food. During July to September 2020, two fields of industrial hemp crops were identified in southern Arizona with 10 to 30% incidence of plants showing witches' broom. Disease incidence was assessed by counting symptomatic plants in 4 randomly selected rows of 25 plants in each field. Symptoms ranged from leaf mottling and yellowing on mildly affected plants to leaf curling and shortened internode length of stem on severely affected plants (Fig. 1). Shoots were randomly collected from eight symptomatic plants and three asymptomatic plants in the same area. Genomic DNA was extracted from 200 mg of each sample using DNeasy Plant Pro Kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. Phytoplasma was tested by a real-time PCR assay and TaqMan probe targeting the 23S ribosomal RNA gene that detects a wide range of known Phytoplasmas (Hodgetts et al., 2009). Beet curly top virus (BCTV) was targeted using BCTV-specific primers BCTV1 and BCTV2 following a method by Rondon (Rondon et al., 2016). BCTV was not detected in the plants, but Phytoplasmas were detected in all eight symptomatic plants, but not in the three control plants. The positive DNA samples were used to identify the phytoplasma by nested PCR using universal phytoplasma-specific primer pairs P1/P6 (Deng, S. et al. 1991) and R16F2n/R16R2 (Gundersen et al., 1996) targeting the 16S rRNA gene and the resulting 1.25 kb fragment in 4 positive samples was subjected to Sanger sequencing (Eton Bioscience, San Diego). All 4 sequences were identical and deposited in GenBank under accession MW981356. BLASTn results indicated 100% identity with that of several 'Candidatus Phytoplasma trifolii' strains on potato (KR072666, KF178706) in Washington and chile peppers (HQ436488) in New Mexico. It also shared 99.84% identity with the sequence of the reference strain of Candidatus Phytoplasma trifolii' (AY390261) that caused clover proliferation. The phytoplasma AZH1 was classified as a member of subgroup A within group16SrVI using iPhyClassifier, an interactive online tool for phytoplasma classification and taxonomic assignment (Zhao et al., 2013). Phylogenetic analysis revealed that the phytoplasma AZH1 clustered with other isolates of 'Candidatus Phytoplasma trifolii' (Fig. 2), including the strain NV1 associated with witches' broom on C. sativa in Nevada (Feng et al. 2019). This is the first report of 'Candidatus Phytoplasma trifolii' related strain associated with yellowing and witches' broom on hemp in Arizona. This finding is significant as the observation of symptoms at 30% incidence in one field suggested that the identified pathogen may pose a significant threat to the production of industrial hemp production in Arizona.
- Published
- 2021
- Full Text
- View/download PDF
34. A novel geminivirus identified in tomato and cleome plants sampled in Brazil
- Author
-
Cristiano Lacorte, A. L. Lacerda, Simone G. Ribeiro, Arvind Varsani, Natalia S. Lamas, and Rafaela S. Fontenele
- Subjects
0301 basic medicine ,Cancer Research ,Nicotiana benthamiana ,DNA sequencing ,Virus ,03 medical and health sciences ,Solanum lycopersicum ,Virology ,Cleome ,Phylogeny ,Plant Diseases ,biology ,fungi ,Begomovirus ,food and beverages ,Sequence Analysis, DNA ,biology.organism_classification ,Plant Leaves ,030104 developmental biology ,Infectious Diseases ,Geminiviridae ,Curly top ,Novel virus ,Solanum ,Brazil - Abstract
Viruses in the family Geminiviridae have single-stranded DNA genomes encapsulated in geminate icosahedral particles. High throughput sequencing (HTS) for metagenomic approaches are being extensively used for the identification of known and novel viruses. Using a HTS approach, we identified a novel geminivirus in a tomato ( Solanum lycopersicum ) sample and a Cleome sp. sample collected in the midwest region of Brazil. The genomes from the two samples share 99.96% identity and ∼61–63% to genomes in the genus Capulavirus . The novel virus has been tentatively named tomato associated geminivirus 1 (TaGV1). No visual symptoms were observed in the field tomato plant or in the inoculated Nicotiana benthamiana where the virus established a systemic infection. The replication associated protein of TaGV1 is most similar to that encoded by capulaviruses (sharing 62–70% identity), whereas the CP is most similar to that of tomato pseudo curly top virus (sharing ∼31% identity). In the TaGV1 positive Cleome sp. sample, begomovirus DNA A and B components were also detected sharing 96% and 90% sequence identity to cleome leaf crumple virus DNA A and B components, respectively. Using a HTS approach, we identified TaGV1 in tomato and Cleome sp. samples and this is the first report of a geminivirus that is non-begomovirus in Brazil.
- Published
- 2017
35. Genome Sequences of Beet curly top Iran virus, Oat dwarf virus, Turnip curly top virus, and Wheat dwarf virus Identified in Leafhoppers
- Author
-
Mehdi Kamali, Najmeh Pouramini, Arvind Varsani, Kata Farkas, Jahangir Heydarnejad, Hossain Masumi, and Simona Kraberger
- Subjects
0301 basic medicine ,Turnip curly top virus ,biology ,viruses ,030106 microbiology ,fungi ,food and beverages ,biology.organism_classification ,Genome ,DNA sequencing ,Oat dwarf virus ,03 medical and health sciences ,030104 developmental biology ,Curly top ,Plant virus ,Botany ,Viruses ,Genetics ,Beet curly top Iran virus ,Wheat dwarf virus ,Molecular Biology - Abstract
Implementation of a vector-enabled metagenomics approach resulted in the identification of various geminiviruses. We identified the genome sequences of Beet curly top Iran virus , Turnip curly top viruses , Oat dwarf viruses , the first from Iran, and Wheat dwarf virus from leafhoppers feeding on beet, parsley, pumpkin, and turnip plants.
- Published
- 2017
36. Control of Curly Top in Sugar Beet with Seed and Foliar Insecticides
- Author
-
Carl A. Strausbaugh, Imad A. Eujayl, and Erik J. Wenninger
- Subjects
Sucrose ,biology ,Neonicotinoid ,Clothianidin ,Sowing ,Plant Science ,Beet leafhopper ,biology.organism_classification ,chemistry.chemical_compound ,Agronomy ,chemistry ,Curly top ,Beet curly top virus ,Sugar beet ,Agronomy and Crop Science - Abstract
Strausbaugh, C. A., Wenninger, E. J., and Eujayl, I. A. 2014. Control of curly top in sugar beet with seed and foliar insecticides. Plant Dis. 98:10751080. Curly top in sugar beet is a serious problem that is caused by Beet curly top virus and other closely related species and transmitted by the beet leafhopper. In order to find a means of reducing curly top in sugar beet, 15 combinations of insecticide seed (Poncho, Poncho Beta, and Poncho Votivo) and foliar (Asana, Cyazypyr, Lorsban, Mustang, Scorpion, and Sivanto) treatments were evaluated versus an untreated check during the 2012 and 2013 growing seasons. An epiphytotic was created by releasing viruliferous beet leafhoppers 58 to 59 days after planting. The foliar sprays were applied 6 to 7 days before and again 6 to 8 days after leafhopper release. Seed treatments (active ingredient: clothianidin) were able to reduce symptoms by 26 to 42% and increase recoverable sucrose by 16 to 21%. The pyrethroids Asana and Mustang also performed well by reducing symptoms 22 to 56% and increasing yields 13 to 20%. The neonicotinoid seed treatments should be an effective way of supplementing host resistance for early-season (at least 59 days after planting) curly top control in sugar beet. The pyrethroid foliar applications could be used to extend curly top control during the midseason period and provide resistance management.
- Published
- 2014
37. BEET CURLY TOP (Beet Curly Top Virus) DISEASE
- Author
-
Rıza Kaya
- Subjects
Fen ,Agronomy ,Curly top ,biology ,Science ,Plant virus ,Beet curly top virus ,Plant pathology ,General Materials Science ,Şeker pancarı,Şeker pancarı tepe kıvırcıklığı virüsü,BCTV,Vektör,Circulifer sp ,Sugar beet,Beet curly top virus,BCTV,Vector,Circulifer sp ,biology.organism_classification - Abstract
Şeker pancarı tepe kıvırcıklığı hastalığının etmeni, Beet curly top virus (BCTV) dür. Curtovirus cinsi içerisinde yer alan BCTV, ikiz partikülleri olan tek sarmal DNA (ssDNA) genomuna sahip olup, Homoptera takımı Cicadellidae familyasında yer alan Circulifer tenellus (Baker) ve C. haematoceps (Mulsant and Rey) türleri ile persistent olarak taşınmaktadır. Şeker pancarı tepe kıvırcıklığı virüsü (BCTV), 1888 yılında ABD’da ortaya çıkmış ve günümüze kadar başta şeker pancarı olmak üzere diğer birçok ürünü etkilemeye devam etmiştir. Hastalığa karşı dayanıklı çeşitlerin, sadece virüsün etkisini azaltmaya yardımcı olması ve vektörlerinin kimyasal yöntemlerle kontrol altına alınmasının zor olmasından dolayı, hastalığın mücadele başarısı sınırlı kalmaktadır. Virüs, zaman zaman şeker pancarında büyük verim kaybına yol açarak, şeker pancarı tarımından vazgeçilmesine neden olabilmektedir., he agent of beet curly top disease is Beet curly top virus (BCTV). BCTV, involved in the genus of Curtovirus, has a single-stranded DNA (ssDNA) genome with twine particles. It is persistently transmitted by Circulifer tenellius (Baker) and C. haematoceps (Mulsant and Rey) which belong to the family Cicadellidae and the order Homoptera. Beet curly top disease (BCTV) first occurred in USA in 1888 and continued to affect especially sugar beet and the other crops up to date. Since the resistant cultivars to the disease can only help to reduce the impact of the virus and it is difficult to control its vectors by means of chemical methods, the efforts to combat the curly top disease of sugar beet is limited. The virus can cause a significant crop yield reduction from time to time and discontinuing sugar beet cultivation.
- Published
- 2013
38. In silico analysis of microRNA binding to the genome of Beet curly top Iran virus in tomato
- Author
-
Davoud Koolivand, Omid Eini, and Fahimeh Amirnia
- Subjects
0301 basic medicine ,Genetics ,In silico ,viruses ,fungi ,food and beverages ,Biology ,Genome ,03 medical and health sciences ,030104 developmental biology ,Viral replication ,Curly top ,Plant virus ,Gene silencing ,ORFS ,Agronomy and Crop Science ,Gene - Abstract
Beet curly top Iran virus (BCTIV) is a new member of geminiviruses causing leaf curl disease in a wide range of crops. These DNA viruses can both induce and be themselves targeted by gene silencing machinery. In animals, miRNAs were found to limit viral establishment by direct interference with viral replication or by targeting viral transcripts. However, such mechanisms have not been yet reported for plant viruses. In this work, we investigated the possible binding of tomato encoded miRNA/miRNA* sequences to the viral genome and/or transcripts of BCTIV. In silico analysis showed that several miRNA/miRNA* species including mir319, mir1919 and mir159 can potentially target both the genome and transcribed ORFs of the BCTIV. In addition, the identified miRNAs* also were predicted to bind host genes from various metabolic pathways. This may suggest a novel role for plant miRNA/miRNA* in host-virus interactions and defence response.
- Published
- 2016
- Full Text
- View/download PDF
39. Management of Severe Curly Top in Sugar Beet with Insecticides
- Author
-
Carl A. Strausbaugh, Imad A. Eujayl, and Erik J. Wenninger
- Subjects
biology ,business.industry ,fungi ,Pest control ,food and beverages ,Sowing ,Plant Science ,Beet leafhopper ,biology.organism_classification ,chemistry.chemical_compound ,Agronomy ,Curly top ,chemistry ,Imidacloprid ,Seed treatment ,Curtovirus ,Sugar beet ,business ,Agronomy and Crop Science - Abstract
Strausbaugh, C. A., Wenninger, E. J., and Eujayl, I. A. 2012. Management of severe curly top in sugar beet with insecticides. Plant Dis. 96:11591164. Curly top, caused by Curtovirus spp., is a widespread disease problem vectored by the beet leafhopper in semiarid sugar beet production areas. The insecticide seed treatment Poncho Beta has proven to be effective in controlling curly top in sugar beet but was only evaluated under light to moderate disease pressure. Thus, the insecticide seed treatments Poncho Beta, NipsIt INSIDE, and Cruiser Force were evaluated under severe curly top pressure (six viruliferous beet leafhoppers per plant) in field studies during the 2010 and 2011 growing seasons on two commercial sugar beet cultivars. In addition, the foliar insecticides Movento, Provado, and Scorpion were also evaluated. The seed treatments and Scorpion reduced curly top symptoms by 33 to 41% (P < 0.0001) and increased root yield by 55 to 95% (P < 0.0001), sucrose content by 6.5 to 7.2% (P = 0.0013 to
- Published
- 2012
40. Turnip curly top virus, a highly divergent geminivirus infecting turnip in Iran
- Author
-
Jahangir Heydarnejad, Rob W. Briddon, Arvind Varsani, Darren P. Martin, Fakhrosadat Khosrowfar, and Hossain Massumi
- Subjects
Cancer Research ,food.ingredient ,viruses ,Molecular Sequence Data ,Genome, Viral ,Biology ,Evolution, Molecular ,Open Reading Frames ,Viral Proteins ,food ,Virology ,Plant virus ,Curtovirus ,Peptide sequence ,Gene ,Phylogeny ,Plant Diseases ,Genetics ,Base Sequence ,Brassica napus ,food and beverages ,Open reading frame ,Geminiviridae ,Infectious Diseases ,Curly top ,Becurtovirus ,Leaf curl - Abstract
From 2006 onwards turnip crops in Fars province, Iran, have been noted with unusual leaf curling and vein swelling symptoms which are characteristic of the leafhopper-transmitted viruses of the genus Curtovirus (family Geminiviridae). Rolling circle amplification was used to clone viruses from five turnip isolates exhibiting leaf curl symptoms. Analysis of the sequences showed them to have >93% sequence identity and to be distinct from all other geminiviruses previously characterised. Analysis of the sequence of this virus, for which we propose the name Turnip curly top virus (TCTV), showed it to have a genome arrangement in the complementary-sense similar to that of curtoviruses (consisting of four overlapping genes) but only two open reading frames in the virion-sense (the curtoviruses encode three). The complementary-sense genes are homologous to those of curtoviruses but show little sequence identity to their curtovirus homologs, with the exception of the product of the C4 open reading frame (ORF) which shows approximately 70.6% amino acid sequence identity to the C4 of the North American curtoviruses, Pepper curly top virus and Beet mild curly top virus. For curtoviruses the C4 protein is a symptom determinant, which likely explains the similarity of TCTV symptoms to those of curtoviruses. In the virion-sense the predicted product of the V2 ORF of TCTV shows no significant similarity with any proteins in the databases whereas the product of the V1 ORF (encoding the coat protein [CP] of geminiviruses) shows low levels of sequence identity to the CPs of curtoviruses. These findings show TCTV to be a highly divergent geminivirus with similarities to viruses of the genus curtovirus. The significance of these findings, particularly the taxonomic implications are discussed.
- Published
- 2010
41. Seed Treatments for the Control of Insects and Diseases
- Author
-
Paul Foote, Imad A. Eujayl, and Carl A. Strausbaugh
- Subjects
biology ,Tefluthrin ,food and beverages ,Clothianidin ,biology.organism_classification ,Pemphigus betae ,Aphis ,chemistry.chemical_compound ,chemistry ,Curly top ,Agronomy ,Seed treatment ,Black bean aphid ,Thiamethoxam - Abstract
Insect feeding and vectoring of viruses cause serious problems in sugarbeet (Beta vulgaris L.) production worldwide. In order to ameliorate insects and diseases on sugarbeet, two seed treatments, Poncho Beta (60 g a.i. [active ingredient] clothianidin + 8 g a.i. beta-cyfluthrin/100,000 seeds) and Cruiser Tef (60 g a.i. thiamethoxam + 8 g a.i. tefluthrin/100,000 seeds) were investigated in a series of five field trials from 2006 to 2009. The two seed treatments and an untreated check were tested on commercial sugarbeet cultivars in a randomized complete block design with eight replications. Insect incidence and curly top symptoms were evaluated. Both Poncho Beta and Cruiser Tef provided significant reduction in curly top symptoms and incidence of leafminers (Pegomya spp.), black bean aphid (Aphis fabae Scopoli), and sugarbeet root aphid (Pemphigus betae Doane). In the two trials conducted under curly top pressure, Poncho Beta and Cruiser Tef had more root yield than the untreated check by 3.4 to 15.1 t/ha. In the three trials without curly top pressure, Poncho Beta and Cruiser Tef resulted in root yield increases of 3.1 to 6.7 t/ha over that of the untreated check. Neonicotinoid seed treatments play an important role in early season disease and insect management in sugarbeet production, but should be viewed as a supplement to host plant resistance rather than a substitute for it.
- Published
- 2010
42. Incidence and Severity of Crown Gall Disease of Cherry, Apple and Apricot Plants Caused by Agrobacterium tumefaciens in Nagar Valley of Gilgit-Baltistan, Pakistan
- Author
-
Azhar Hussain, Imran, Khalil Ahmed, and Hussain Ali
- Subjects
Nutrition and Dietetics ,food.ingredient ,biology ,Agrobacterium ,fungi ,Crown (botany) ,Public Health, Environmental and Occupational Health ,food and beverages ,Agrobacterium tumefaciens ,biology.organism_classification ,medicine.disease_cause ,Horticulture ,food ,Curly top ,Infestation ,Botany ,medicine ,Gall ,Agar ,Orchard ,Food Science - Abstract
The crown gall is a world wide tumor forming disease of the plants and are a major problem for plant nursery industries. This disease is caused by pathogenic species of soil borne bacteria Agrobacterium and cause great economic loss in fruit plants. From July to November in 2008 an extensive survey was conducted in five villages (Chalt, Skindarabad, Gulmit, Askurdas and Nagarkhas) of the Nagar valley of Gilgit- Baltistan randomly by walking in a zigzag pattern and examined the plants for typical curly top symptoms to determine the incidence and severity of crown gall on cherry, apple and apricot plants. A total of 6100 cherry, 6900 apple and 8000 apricot plants were inspected and the mean incidence of crown gall on cherry plants was found to be 5360 (87.87%), apple plants 6069 (87.96%) and in apricot plants 00 (00.00%). In cherry plants, the severity of the disease observed varied from 33.80-40% in mild, 20-34.49% in moderate and 27.85-40% in severe. While in the apple plants it varied from 36.81-42.5% in mild, 29.14-34.49% in moderate and 27-30.31% in severity. There was no infestation of crown gall in apricot plants. A total of 35 samples (15 soil samples; 1 from each orchard of each village and 20 tumor samples; 2 from each orchard of cherry and apple infected plants) from each inspected village were cultured on modified selective medium (3- Ketolactose agar). The growth of Agrobacterium tumefaciens was identified on the basis of colon y characteristics and biochemical tests based on Bergey's Manual of determinative Bacteriology. A 100 % infestation of A. tumefaciens was observed from both the plant and soil samples except for the soil sample cultures from the apricot orchard. All the 30 A. tumefaciens strains isolated from the soil specimens and infected cherry and apple plant tumors were tested against six different antibiotics by disc diffusion method. All the strains were resistant against Lincomycin, Amoxycillin, Ampincillin and Cloxacillin while Cephradine, Tetracycline and Dioxycycline, showed intermediate sensitivity.
- Published
- 2010
43. Registration of Sugarbeet Doubled Haploid Line KDH13 with Resistance to Beet Curly Top
- Author
-
Chunsheng Lu, Carl A. Strausbaugh, and Imad A. Eujayl
- Subjects
0106 biological sciences ,0301 basic medicine ,Genetics ,Bolting ,biology ,fungi ,food and beverages ,biology.organism_classification ,Beet leafhopper ,01 natural sciences ,03 medical and health sciences ,030104 developmental biology ,Curly top ,Beet curly top virus ,Doubled haploidy ,Sugar beet ,Ploidy ,Agronomy and Crop Science ,010606 plant biology & botany ,Circulifer - Abstract
KDH13 is a sugar beet (Beta vulgaris L. ssp vulgaris) doubled haploid line (PI 663862) released as a genetic stock by USDA-ARS in cooperation with the Beet Sugar Development Foundation, Denver, CO. KDH13 is resistant to beet curly top (BCT) caused by Beet curly top virus which is transmitted by the beet leafhopper (Circulifer tenellus Baker). KDH13 was extracted from the BCT resistant C762-17 (PI 560130) parental line that segregates for BCT resistance and genetic male sterility. Intensive phenotypic screening was used for selecting plants from C762-17 that showed no symptoms under fully controlled infection conditions in the greenhouse. Seed from a single plant was used as a donor of floral buds for isolation of unfertilized ovaries to regenerate KDH13 via gynogenesis, and was confirmed a diploid by flow cytometry. The whole genome for this line was sequenced via next generation sequencing and its assembly was designated BvvSeq-1. The assembly was used to identify a large set of single nucleotide polymorphic markers (SNP) aligned to a BCT susceptible line (KWS2320) genome assembly. Homozygosity of KHD13 was confirmed using SNPs. It is a monogerm, self- fertile, and requires at least 90 days of vernalization for bolting. KDH13 outperformed BCT resistant commercial checks in greenhouse and field screening experiments. This line was used in crosses with susceptible parents and proved to be suitable as a donor parent for curly top resistance genes.
- Published
- 2018
44. Characterization of Curtoviruses Associated with Curly Top Disease of Tomato in California and Monitoring for These Viruses in Beet Leafhoppers
- Author
-
Kelly Brannigan, Robert L. Gilbertson, Rod J. Clark, and Li-Fang Chen
- Subjects
Disease reservoir ,biology ,food and beverages ,Plant Science ,biology.organism_classification ,Beet leafhopper ,Horticulture ,Curly top ,Vector (epidemiology) ,Plant virus ,Botany ,Curtovirus ,Agronomy and Crop Science ,Solanaceae ,Circulifer - Abstract
Curly top disease is caused by a complex of curtoviruses (family Geminiviridae), and it continues to plague tomato production in California. To better understand the etiology of curly top of tomatoes in California, polymerase chain reaction (PCR)-based methods were developed and used to characterize the curtoviruses involved, and to monitor for these viruses in the beet leafhopper vector, Circulifer tenellus. From 2002 to 2008, 86 processing and fresh market tomato fields in the Central Valley of California were surveyed for the incidence of curly top symptoms. Representative samples with curly top symptoms were collected from the surveyed fields, as well as from another 24 fields. The incidence of curly top symptoms in most fields ranged from trace (20%) incidences. PCR with general and species-specific primers was used to establish that the predominant species associated with tomato curly top disease were Beet mild curly top virus (BMCTV) and, to a lesser extent, Beet severe curly top virus (BSCTV). The incidence, relative amount, and species of curly top virus in leafhoppers, collected at monthly intervals by the California Department of Food and Agriculture (CDFA) personnel during 2003 to 2008, was also determined. The predominant species detected were BMCTV and BSCTV. The highest incidences of curly top in tomato fields were associated with high populations of leafhoppers (e.g., in 2003 when populations were two times greater than average) having high incidences and levels of curly top virus early in the growing seasons (e.g., March to May 2003 and 2008). Detection of curly top virus in leafhoppers early in the growing season was consistent with acquisition of virus from reservoir hosts in the foothills. However, continued detection of curly top virus in leafhoppers throughout the growing season and development of curly top in late-planted fresh market tomatoes were consistent with the presence of inoculum sources (e.g., weeds or crop plants) in the agricultural areas of the Central Valley. Geographical locations or “hotspots” having higher proportions of curly top virus–positive leafhoppers were identified, which may reveal areas having high concentrations of curly top virus reservoir hosts. The application of these molecular tools has provided new insight into curly top of tomato in California, and may lead to improved curly top management.
- Published
- 2010
45. Evaluation of Beta corolliflora for Resistance to Curly Top in Idaho
- Author
-
Carl A. Strausbaugh, Kelly V. Tindall, and Anne M. Gillen
- Subjects
Crop ,biology ,Curly top ,Agronomy ,Inoculation ,Plant virus ,fungi ,Curtovirus ,food and beverages ,Plant disease resistance ,Beet leafhopper ,biology.organism_classification ,Circulifer - Abstract
Curly top of sugarbeet is caused by Beet severe curly top virus (BSCTV) or closely related curtovirus species which are vectored by the beet leafhopper (Circulifer tenellus). Beta corolliflora, shown in 1969 to impart a very high level of curly top resistance to sugarbeet into the BC 2 generation, is a wild relative of cultivated sugarbeet that has not been utilized in breeding programs. The nature of curly top resistance from B. corolliflora seems to be reduced symptoms and resistance to viral accumulation. Field screening of 14 B. corolliflora accessions for resistance to curly top followed by PCR detection of BSCTV did not identify any accessions with phenotypic symptoms of curly top and 9 accessions did not have detectable virus. Clip cage inoculations followed by PCR detection of BSCTV and of related species, Beet mild curly top and Beet curly top viruses, were difficult to interpret due to small sample size but indicated that accessions BETA 408, BETA 414, BETA 528, BETA 690, and BETA 805, from Genebank Gatersleben, Foundation Liebniz Institute of Plant Genetics and Crop Plant Research, Gatersleben, Germany had no visible curly top symptoms or evidence of virus accumulation. Results of a preference test showed that beet leafhoppers did not
- Published
- 2008
46. Influence of Curly Top and Poncho Beta on Storability of Sugarbeet
- Author
-
Carl A. Strausbaugh, E. Rearick, and Stacey Camp
- Subjects
chemistry.chemical_compound ,Sucrose ,Curly top ,chemistry ,Agronomy ,Plant virus ,Seed treatment ,Postharvest ,food and beverages ,Clothianidin ,Cultivar ,Biology ,Plant disease resistance - Abstract
Sucrose losses during postharvest storage of sugarbeet (Beta vulgaris L.) maybe exacerbated by field diseases. This study investigated the influence of curly top (causal agent Beet severe curly top virus and related viruses) on storability of sugarbeet roots during the 2005 and 2006 growing sea sons. Three sugarbeet cultivars varying for resistance to curly top were evaluated both with and without the insec ticide seed treatment Poncho Beta (60 g a.i. clothianidin + 8 g a.i. beta-cyfluthrin/100,000 seed). At harvest, 8-beet samples from each cultivar were collected and placed inside an outdoor pile. Samples were removed at 40-day intervals beginning on 31 october in 2005 and 1 in 2006. Sucrose concentration, frozen and discolored root area, and root weight were evaluated. By mid-September plants from Poncho Beta treated seed had curly top ratings that were 37 and 31% lower ( P < 0.01) than plants from the untreated seed in 2005 and 2006, respectively. After 124 and 131 days in storage, roots from Poncho Beta treated seed had 8.5 and 5% more sucrose than roots from untreated seed in 2005 and 2006, respectively. Resistant cultivars and insecticide seed treatments not only limit losses to curly top in the field, but also in long term storage.
- Published
- 2008
47. Curly Top of Cultivated Plants and Weeds and Report of a Unique Curtovirus from Iran
- Author
-
Jahangir Heydarnejad, E. Hosseini Abhari, H. R. Bolok Yazdi, and Hossain Massumi
- Subjects
Veterinary medicine ,food.ingredient ,biology ,Physiology ,fungi ,food and beverages ,Plant Science ,biology.organism_classification ,food ,Curly top ,Plant virus ,Becurtovirus ,parasitic diseases ,Curtovirus ,Botany ,Beet curly top virus ,Genetics ,Sugar beet ,Geminiviridae ,Weed ,Agronomy and Crop Science - Abstract
The incidence of curly top disease on cultivated plants and weeds was investigated in Kerman Province (southeastern Iran) from October 2003 to November 2004. A total of 1186 samples were collected in fields of sugar beet and other crops as well as within commercial plastic houses. Curtovirus infection of four field crops, three vegetables and 11 weeds was verified by indirect enzyme-linked immunosorbent assay (ELISA) using a polyclonal antibody. An undescribed curtovirus, tentatively designated Iranian beet curly top virus (IBCTV), was isolated from three symptomatic beet samples collected randomly in widely separated regions of south-eastern, southern and central Iran and used for molecular studies. A 672 bp segment of the coat protein (CP) gene of each isolate was amplified by PCR and sequenced. The results showed that the three isolates shared 98.5-98.7% nucleotide homology with each other but only 72.1-76.5% with other members of the genus Curtovirus. IBCTV was also detected by PCR using specific primers in other samples of sugar beet, tomato, spinach, turnip and several weed species collected in different parts of Iran. These results indicated that IBCTV is the dominant curtovirus in Iran.
- Published
- 2007
48. Influence of Host Resistance and Insecticide Seed Treatments on Curly Top in Sugar Beets
- Author
-
John J. Gallian, J. R. Stander, Stacey Camp, Carl A. Strausbaugh, and Anne M. Gillen
- Subjects
biology ,Clothianidin ,Plant Science ,biology.organism_classification ,chemistry.chemical_compound ,Horticulture ,chemistry ,Curly top ,Imidacloprid ,Seed treatment ,Curtovirus ,Botany ,Beet curly top virus ,Sugar beet ,Cultivar ,Agronomy and Crop Science - Abstract
Strausbaugh, C. A., Gillen, A. M., Gallian, J. J., Camp, S., and Stander, J. R. 2006. Influence of host resistance and insecticide seed treatments on curly top in sugar beets. Plant Dis. 90:15391544. Curly top on sugar beets (Beta vulgaris) caused by Beet severe curly top virus or closely related species is a considerable problem in arid growing regions of the western United States. Two insecticide seed treatments, Poncho Beta (60 g a.i. clothianidin + 8 g a.i. beta-cyfluthrin/100,000 seed) and Gaucho (45 g a.i. imidacloprid/100,000 seed), and four sugar beet hybrids varying in curly top resistance were evaluated for their influence on the control of curly top in comparison with untreated checks. Plots were established at two locations in southern Idaho in 2005 and evaluated for curly top. Moderate to severe curly top due to natural inoculum and leafhopper infestations occurred at both locations. Untreated, the four hybrids performed as expected with the fewest curly top symptoms on PM21 and the most on Monohikari. Both insecticide treatments lowered curly top ratings compared with the untreated check, but Poncho Beta reduced symptoms more than Gaucho as the season progressed. Poncho Beta led to increased yield and estimated recoverable sugar across all hybrids at harvest, particularly on the more susceptible hybrids. When considering the yield parameters for only the most resistant hybrids individually, Poncho Beta did not always outperform Gaucho. Poncho Beta provided a level of control that would justify its application as a supplement to host resistance under Idaho conditions. Additional keywords: Curtovirus, geminivirus
- Published
- 2006
49. Spinach curly top virus: A Newly Described Curtovirus Species from Southwest Texas with Incongruent Gene Phylogenies
- Author
-
Garry Sunter, Surendranath Baliji, Drake C. Stenger, Roy French, and Mark C. Black
- Subjects
Genetics ,biology ,food and beverages ,Plant Science ,biology.organism_classification ,Genome ,Virology ,Complete sequence ,Curly top ,Tandem repeat ,Curtovirus ,Geminiviridae ,Agronomy and Crop Science ,Gene ,Southern blot - Abstract
A curtovirus associated with a disease of spinach was isolated in southwest Texas during 1996. Disease symptoms included severe stunting and chlorosis, with younger leaves curled, distorted, and dwarfed. Viral DNA was purified and an infectious clone obtained. Agroinoculation using a construct bearing full-length tandem repeats of the cloned viral genome resulted in systemic infection of species in six of seven plant families tested, indicating that the virus has a wide host range. Symptoms produced in spinach agroinoculated with cloned viral DNA were similar to those observed in the field. Viral single-stranded and double-stranded DNA forms typical of curtovirus infection were detected in host plants by Southern blot hybridization. The complete sequence of the infectious clone comprised 2,925 nucleotides, with seven open reading frames encoding proteins homologous to those of other curtoviruses. Complete genome comparisons revealed that the spinach curtovirus shared 64.2 to 83.9% nucleotide sequence identity relative to four previously characterized curtovirus species: Beet curly top virus, Beet severe curly top virus, Beet mild curly top virus, and Horseradish curly top virus. Phylogenetic analysis of individual open reading frames indicated that the evolutionary history of the three virion-sense genes was different from that of the four complementary-sense genes, suggesting that recombination among curtoviruses may have occurred. Collectively, these results indicate that the spinach curtovirus characterized here represents a newly described species of the genus Curtovirus, for which we propose the name Spinach curly top virus.
- Published
- 2004
50. Pseudosymptom Analysis Induced by Geminivirus L4 Gene in Transgenic Arabidopsis
- Author
-
Jongbum Park, Sukchan Lee, and Kyu-Bae Lee
- Subjects
Genetics ,Open reading frame ,Curly top ,Transgene ,Arabidopsis ,fungi ,Beet curly top virus ,Gene expression ,food and beverages ,Genetically modified crops ,Biology ,biology.organism_classification ,Gene - Abstract
The factors for symptom development caused by Beat curly top virus(BCTV) have been analyzed by using a molecular genetic approach based on expressing BCTV encoded proteins in transgenic plants. BCTV open reading frame (ORF) L4 expression in transgenic Arabidopsis resulted in abnormal plant development and the production of callus inflorescence stems and bumpy trichomes, confiming that this gene alone is a primary symptom determinant. The L4 gene expression by northern hybridization in transgenic plants and a range of phenotypes were analyzed.
- Published
- 2003
Catalog
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.