Search

Introduction: Classification by intrinsic subtypes by gene expression profiles of early-stage breast cancer (EBC) provides information of prognostic value and constitutes a tool to help in making therapeutic decisions. Several authors have proposed surrogated classifications based on immunohistochemistry results (IHC) in order to facilitate a classification with identical prognostic and predictive value. However, there is evidence that suggests a lack of correlation between these classifications. The aim of this study was to evaluate the correlation between classification by intrinsic subtypes in patients with EBC ER+/ HER2neg, obtained by PAM50 and the surrogated classification proposed by St. Gallen 2013. Methods: Samples from 12 centers from the spanish region of Castilla y León were analyzed by PAM50 (nCounterTM / Nanostring) at the University Hospital of Salamanca. The results obtained were compared with the surrogate classification of St.Gallen'13 from local reports. Tumors of patients pre and post-menopausal tests T1-2, N0-N1mi, grade I-II that met criteria for inclusion of the regional evaluation program through ProsignaTM were included. Results: Between August'15 and December'17, 264 samples were analyzed. All patients were classified by IHC as lum-A or lum-B. In total 113 cases were reclassified by PAM50 (43%). The change of LumA by IHC to Lum-B by PAM50 was 18%, while Lum-B by IHC to Lum-A by PAM50 was 58% (n = 89). In those cases considered Lum-B by IHC based only in a value of Ki67>14% (n = 93), 54% was reclassified to Lum-A. Conversely, when low expression (negative or Conclusion: The surrogated classification by IHC of intrinsic subtypes in EBC ER+/HER2neg shows a low concordance with PAM50 analysis, and cannot be considered adequate. In particular, the presence of negative or Citation Format: Rodriguez CA, Guillen C, Garcia M, Sancho M, Gomez A, Ludena D, Cruz JJ. Discordance between surrogated intrinsic subtypes defined by immunohistochemistry compared with PAM50 in ER positive / HER2 negative early breast cancer. Analysis of value of the status of the progesterone receptor and Ki67 [abstract]. In: Proceedings of the 2018 San Antonio Breast Cancer Symposium; 2018 Dec 4-8; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2019;79(4 Suppl):Abstract nr P4-08-07.

4022 Background: Sequential treatment with nab-paclitaxel, gemcitabine followed by oxaliplatin, leucovorin and 5-fluorouracil ( nab-P/Gem-mFOLFOX) have shown a good safety profile and clinical activity in metastatic pancreatic ductal adenocarcinoma (mPDAC) in a previously published phase I SEQUENCE trial. Methods: We have compared nab-P/Gem-mFOLFOX to the standard nab-P/Gem in first-line treatment, in an open-label multi-institutional prospective randomised phase II trial in patients with untreated mPDAC from 14 Spanish hospitals. Patients were allocated 1:1 to nab-paclitaxel (125 mg/m2) plus gemcitabine (1000 mg/m2) on days 1, 8 and 15, followed by modified FOLFOX-6 (oxaliplatin [85 mg/m2], L-leucovorin [200 mg/m2] or racemic leucovorin [400 mg/m2], 5-fluorouracil bolus [400 mg/m2], and 5-fluorouracil 48-hour continuous infusion [2400 mg/m2]) on day 29 of a 6-week cycle or nab-paclitaxel (125 mg/m2) plus gemcitabine (1000 mg/m2) on days 1, 8 and 15 of a 4-week cycle. The primary endpoint was the 12-month overall survival rate (OS) in randomised patients. EudraCT number 2014-005350-19; ClinicalTrial.gov identifier NCT02504333. Results: Between July 27, 2017, and April 16, 2019, 182 patients were screened and 157 randomised: 78 to nab-P/Gem-mFOLFOX and 79 to nab-P/Gem. Patients receiving nab-P/Gem-mFOLFOX showed a significantly higher 12-month, and 24-month OS (95% CI): 55.3% (44.2-66.5%) versus 35.4% (24.9-46.0%) (p = 0.016), and 22.4% (13.0-31.8%) versus 7.6% (1.8-13.4%) (p = 0.012), respectively. The median OS (95% CI) reached 13.2 (10.1-16.2) months with nab-P/Gem-mFOLFOX and 9.7 (7.5-12.0) months with nab-P/Gem (HR = 0.676, 95% CI 0.483-0.947, p = 0.023). 39.7% patients in the nab-P/Gem-mFOLFOX group and 54.4% in nab-P/Gem group received subsequent anticancer treatments. Safety was comparable except for grade ≥3 neutropenia (46.1% versus 24.1%, p = 0.004) and grade ≥3 thrombocytopenia (23.7% versus 7.6%, p = 0.007) that were higher in the nab-P/Gem-mFOLFOX regimen. Two (2.6%) patients died due to adverse events in the nab-P/Gem-mFOLFOX arm. Conclusions: Nab-P/Gem-mFOLFOX showed significantly higher clinical activity than the standard nab-P/Gem treatment, with a manageable safety profile. This regimen represents a feasible and efficient new option for first-line treatment of mPDAC. Clinical trial information: NCT02504333.

Background Immunohistochemistry (IHQ) is commonly used for the detection of mismatch repair proteins deficiency (MMRD). One very infrequent abnormal pattern of MMR protein expression is the loss of PMS2 and MSH6, with intact expression of MLH1 and MSH2. Case presentation We review the frequency of this MMRD IHC pattern among 108 colorectal (CRCs) and 35 endometrial cancers in our files with loss of expression of at least one protein, and present two CRCs showing loss of PMS2 and MSH6 protein expression (1.9% of CRCs). NGS analysis of these tumours identified PMS2 mutations (R134* germline mutation in one tumour and M1R and c.1239delA somatic mutation in the other) as the primary event and somatic MSH6 mutation (c.3261dupC) as the secondary event in both tumours. Conclusions This study suggests that Next Generation Sequencing (NGS) tumour analysis should be considered in the algorithm of Lynch syndrome screening to detect MMR gen somatic mutation in inconclusive cases.

In the Balearic Islands, as in other areas in southern Europe, there are a significant proportion of asymptomatic Leishmania infantum-infected blood donors. Theoretically, these donors may represent an important challenge for blood transfusion safety. However, despite an active search of multiply transfused patients, there have been, so far, no cases of transfusion-transmitted leishmaniasis (TTL) in our region. On the other hand, there is scarce evidence of the TTL in the literature. A review of asymptomatic Leishmania-infected blood donors' studies in endemic areas and TTL reports published in the English literature were performed, to ascertain the factors that determine the real risk of transfusion transmission of Leishmania.

Serodiscordance in Chagas disease (CD) remains a challenge since individuals with inconclusive results are clinically complicated to manage. This work, conducted outside the endemic area, aims to compare two different confirmatory techniques for the diagnosis of CD in individuals without a definitive diagnosis, to analyze the performance of the screening techniques in this group of patients, and to describe the serological follow-up of these subjects over time. Sera from 48 individuals with repeatedly discordant results by one recombinant enzyme immunoassay (r-ELISA) and one native ELISA (n-ELISA), were included in the study. Confirmatory procedures were performed through TESA-blot, using trypomastigote antigens of Trypanosoma cruzi, and in-house WB (IH-WB) using a lysate from T. cruzi epimastigotes. Of the 48 sera, TESA-blot confirmed 22 (45.8%) cases and IH-WB 17 (35.4%). Both techniques showed a substantial agreement (k = 0.604). Confirmation defined as the positivity of one of the ELISA and at least one of the confirmatory tests was reached in 24/48 (50%) cases. We found a great dispersion of r-ELISA index values, especially among individuals with confirmatory negative results, ranging from 0.03-6.2. Additionally, n-ELISA yielded a better performance than r-ELISA in this cohort of patients, showing a significantly greater agreement with the confirmatory methods. Our results indicate that either confirmatory test could be an efficient tool to solve inconclusive cases regardless of which form of the parasite's life cycle they use. Also, most individuals remain with discordant serology throughout the short-term follow-up period time of study. Finally, we consider that it is necessary to establish a reference test feasible and commercialized in all areas to solve the problem of inconclusive results.

3507 Background: FOLFOXIRI+BEV has demonstrated a survival benefit compared with FOLFIRI plus BEV (TRIBE Lancet Oncol 2015) in first-line mCRC. Nevertheless, due to its safety profile, this schedule is not recommended for all pts. In addition, we have showed that the detection of ≥3 bCTCs is a poor prognostic factor for survival (MACRO The Oncologist 2012). The VISNU-1 trial compares FOLFOX + BEV vs FOLFOXIRI + BEV in pts with mCRC and ≥3 bCTCs. Progression-free survival (PFS) is the primary endpoint. Secondary endpoints included overall response rate (ORR) and overall survival (OS). Methods: This is an open, multicentric, randomized phase III trial. Patients with mCRC younger than 70 years, ECOG 0-1 were randomized to FOLFOX+BEV (arm A) or FOLFOXIRI+BEV (arm B), stratified per KRAS mutation (mutated vs WT) and number of involved organs (1 vs >1). Results: 349 pts were included in the ITT population; 177 in group A and 172 in group B. Characteristics of the pts, molecular profiling and safety analysis have been previously presented at ASCO 2018 and showed that this schedule had an acceptable toxicity profile. Efficacy analysis in the ITT population is shown in the table. Conclusions: In this population with very bad prognosis, our study met its primary endpoint. Pts who received FOLFOXIRI + Bev benefit for a statistically significative PFS and ORR. OS showed a trend of benefit in the experimental arm. According to these results, FOLFOXIRI-Bev could be considered an adequate treatment option for pts with mCRC and ≥3 bCTCs. Clinical trial information: 2012-000846-37. [Table: see text]

In the Balearic Islands, as in other areas of the Mediterranean basin, there is a significant proportion of asymptomatic Leishmania (L.) infantum-infected blood donors, who may represent an important threat to transfusion safety. The Balearic Islands blood bank, located in an area endemic for L. infantum, carried out a study of donors and patients to investigate the impact of this infectious disease on blood safety in the region.Twenty asymptomatic Leishmania-infected blood donors were followed-up between 2008 and 2011 to investigate the evolution of Leishmania infection in asymptomatic carriers. Their blood was periodically tested for anti-Leishmania antibodies by western blot and for Leishmania DNA by quantitative polymerase chain reaction (qPCR). Additionally, the prevalence of L. infantum infection was investigated in a group of 68 multiply transfused patients to ascertain the risk of transfusion-transmitted leishmaniasis (TTL) in the region, taking into account regular blood component production practices such as pre-storage leucodepletion and pathogen reduction technology.All 20 donors remained asymptomatic over the study period (2008-2011). Most donors had repeatedly positive qPCR results, either persistently or intermittently, but showed no symptoms of Leishmaniasis. Levels of parasitaemia were remarkably low in asymptomatic donors, with values ≤1 parasite/mL. Despite multiple transfusions received over 15 years, no transfused patient studied was infected with L. infantum.L. infantum-infected donors can remain asymptomatic for at least 3 years. In our region, no cases of TTL were detected, despite an active search in multiply transfused patients. This seems to be related to two independent variables: (i) a low concentration of the parasite in the peripheral blood of asymptomatic carriers and (ii) the application of methods with proven efficacy against TTL, such as leucodepletion and pathogen reduction technology.

Summary Context Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. Objective The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. Results A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Conclusions Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

PurposeType I pseudohypoparathyroidism (PHP-I) can be subclassified into Ia and Ib, depending on the presence or absence of Albright's hereditary osteodystrophy's phenotype, diminished α-subunit of the stimulatory G protein (Gsα) activity and multihormonal resistance. Whereas PHP-Ia is mainly associated with heterozygous inactivating mutations in Gsα-coding exons ofGNAS, PHP-Ib is caused by imprinting defects ofGNAS. To date, just one patient with PHP and complete paternal uniparental disomy (UPD) has been described.We sought to identify the underlining molecular defect in twenty patients with parathyroid hormone resistance, hypocalcemia and hyperphosphatemia, and abnormal methylation pattern at GNAS locus.MethodsMicrosatellite typing and comparative genome hybridization were performed for proband and parents.ResultsWe describe four patients with partial paternal UPD of chromosome 20 involving pat20qUPD in one case, from 20q13.13-qter in two cases, and pat20p heterodisomy plus interstitial 20q isodisomy in one patient.ConclusionsThese observations demonstrate that mitotic recombination of chromosome 20 can also give rise to UPD and PHP, a situation similar to other imprinting disorders, such as Beckwith–Wiedemann syndrome or neonatal diabetes.

655 Background: Adyuvant chemotherapy is a unified therapeutic principle in colon cancer (CC). However, many prognostic factors are arising to determine who really benefits from adyuvant chemotherapy in order to avoid overtreatment. Primary tumor location of CC is emerging as an important prognostic factor owing to distinct biological features. However, there is hardly any evidence showing the benefit of treatment according to primary tumor location. Methods: We retrospectively included patients with stage II and III CC that underwent surgical resection between 2009 and 2014 HURyC. We performed a multivariable Cox model analysis to estimate the benefit of chemotherapy according to tumor location in terms of DFS and OS. The model was further adjusted by including the following confounders: ECOG-PS, number of removed nodes ( < 12 or ≥ 12), use of adyuvant chemotherapy and age. A covariate was considered a confounder factor if the difference between the adjusted and unadjusted coefficient of chemotherapy varied > 10%. Stata 13.1 was used to analyze the data. Results: 564 patients were identified (267 left sided and 297 right sided). The median follow-up of the entire cohort was 49 months. Globally, chemotherapy did not improve DFS neither in right sided or left sided CC (HR: 0.81, p: 0.58; HR 1.31, p: 0.4, respectively). As for OS, it was improved when adding chemotherapy in both sides (right sided CC HR 0.51, p: 0.061 and left sided CC HR 0.42, p: 0.009). By stages, chemotherapy did not improve DFS or OS according to tumor localization in stage II. In right sided stage III, there was a trend to improve both DFS and OS (HR: 0.54, p: 0.14; HR: 0.39, p: 0.1, respectively). In left sided stage III, there was a trend to improve DFS (HR: 0.66, p: 0.36) and there was an improvement in OS (HR: 0.23, p < 0.001). Conclusions: The multivariable analysis showed benefit of chemotherapy in both right and left sided CC in terms of OS, exhibiting more benefit those patients with left sided CC.

Background: Germline mutation screening of BRCA1 and BRCA2 genes is performed in suspected familial breast cancer cases, but a causative mutation is found in only 30% of patients. The development of additional methods to identify good candidates for BRCA1 and BRCA2 analysis would therefore increase the efficacy of diagnostic mutation screening. With this in mind, we developed a study to determine molecular signatures of BRCA1—or BRCA2—mutated breast cancers. Materials and Methods: Array-cgh (comparative genomic hybridization) and transcriptomic analysis were performed on a series of 103 familial breast cancers. The series included 7 breast cancers with a BRCA1 mutation and 5 breast cancers with a BRCA2 mutation. The remaining 91 cases were obtained from 73 families selected on the basis of at least 3 affected first-degree relatives or at least 2 affected first-degree relatives with breast cancer at an average age of 45 years. Array-cgh analyses were performed on a 4407 BAC-array (CIT-V8) manufactured by IntegraGen. Transcriptomic analyses were performed using an Affymetrix Human Genome U133 Plus 2.0 chip. Results: Using supervised clustering analyses we identified two transcriptomic signatures: one for BRCA1-mutated breast cancers consisting of 600 probe sets and another for BRCA2-mutated breast cancers also consisting of 600 probes sets. We also defined cgh-array signatures, based on the presence of specific genomic rearrangements, one for BRCA1-mutated breast cancers and one for BRCA2-mutated breast cancers. Conclusions: This study identified molecular signatures of breast cancers with BRCA1 or BRCA2 germline mutations. Genes present in these signatures could be exploited to find new markers for such breast cancers. We also identified specific genomic rearrangements in these breast cancers, which could be screened for in a diagnostic setting using fluorescence in situ hybridization, thus improving patient selection for BRCA1 and BRCA2 molecular genetic analysis.

In the Balearic Islands, as in other areas in southern Europe, there are a significant proportion of asymptomatic Leishmania infantum-infected blood donors. Theoretically, these donors may represent an important challenge for blood transfusion safety. However, despite an active search of multiply transfused patients, there have been, so far, no cases of transfusion-transmitted leishmaniasis (TTL) in our region. On the other hand, there is scarce evidence of the TTL in the literature. A review of asymptomatic Leishmania-infected blood donors' studies in endemic areas and TTL reports published in the English literature were performed, to ascertain the factors that determine the real risk of transfusion transmission of Leishmania.

Background The oral multikinase inhibitor regorafenib improves overall survival (OS) in patients with metastatic colorectal cancer (CRC) for which all standard treatments have failed. This study investigated regorafenib plus modified FOLFOX (mFOLFOX6) as first-line treatment of metastatic CRC. Methods In this single-arm, open-label, multicentre, phase II study, patients received mFOLFOX6 on days 1 and 15, and regorafenib 160 mg orally once daily on days 4-10 and 18-24 of each 28-day cycle. The primary end-point was centrally assessed objective response rate (ORR). Secondary end-points included disease control rate (DCR), OS, progression-free survival (PFS) and safety. Results Median overall treatment duration with any study drug was 9.9 months (range 0.6-19.6); median treatment duration with regorafenib was 7.7 months (range 0.1-19.5); six patients remained on regorafenib for more than 1 year. Fifty-three patients received at least one dose of regorafenib. ORR was 43.9% (all partial responses); DCR was 85.4%; median OS was not reached; median PFS was 8.5 months. Treatment-emergent adverse events were experienced by all patients but were manageable with dose modifications. Conclusion Regorafenib + mFOLFOX6 as first-line treatment in patients with metastatic CRC did not improve ORR over historical controls. Regorafenib plus mFOLFOX6 did not appear to be associated with a markedly worse tolerability profile versus mFOLFOX6 alone. ClinicalTrials.gov identifier: NCT01289821.

The study was partially funded by the “Accion Transversal del Cancer”, approved on the Spanish Ministry Council on the 11th October 2007, by the Instituto de Salud Carlos III-FEDER (PI08/1770, PI08/0533, PI08/1359, PS09/00773, PS09/01286,PS09/01903, PS09/02078, PS09/01662, PI11/01403, PI11/01889,PI11/00226, PI11/01810, PI11/02213, PI12/00488, PI12/00265,PI12/01270, PI12/00715, PI12/00150), Castaño-Vinyals, G., Aragonés, N., Pérez-Gómez, B., Martín, V., Llorca, J., Moreno, V., Altzibar, J.M., Ardanaz, E., de Sanjosé, S., Jiménez-Moleón, J.J., Tardón, A., Alguacil, J., Peiró, R., Marcos-Gragera, R., Navarro, C., Pollán, M., Kogevinas, M., Alonso, M.T., Amiano, P., Arias, C., Azpiri, M., Benavente, Y., Boldo, E., Bueno, A., Bustamante, M., Caballero, F.J., Campo, E., Cantón, R., Capelo, R., Carmona, C., Casabonne, D., Chirlaque, M.D., Cirac, J., Clofent, J., Colado, E., Costas, L., Crous, M., Del Campo, R., Santos, M.D., Dierssen-Sotos, T., Ederra, M., Espinosa, A., Cabrera, M.F., Somoano, A.F., Villa, T.F., García-Esquinas, E.G., Martín, P.G., Gómez-Acebo, I., Puga, C.G., Gràcia, E., Eslava, M.G., Guinó, E., Huerta, J.M., Lope, V., López-Abente, G., Lopez-Otín, C., Argüelles, B.M., Salas, S.M., Pozo, B.M., de la Torre, A.J., Moreno, E., Iribas, C.M., Olea, N., Gelis, G.O., Paré, L., Porta, M., Puig, M., Del Fresno, M.R., Robles, C., Suarez, M.M., Romero, B., Castillo, A.I., Serra, M.S., Trejo, D.S., Santaballa, A., Santibáñez, M., Sierra, Á., Souto, A., Villanueva, C.M., Carrasco, E., Sabaté, Y., Persavento, C., García, M., Carrasco, G., Expósito, A., Andreu, M., Bessa, X., Piracés, M., Lorente, J.A., Tusquets, I., Collet, I., Bory, F., Pera, M., Abella, E., Garcia, F., Salar, A., Piñol, M., Fernandez-Llamazares, J., Martín, M.V., Garsot, E., Servio, L.I., Arzoz-Fabregas, M., Suarez, L., Ruiz, J.M., Castells, A., Serradesanferm, A., Bosch, A., Muñoz, M., Fontanillas, M., Alcaraz, A., Mengual, L., Duran, E., Izard, C., López, C., Benítez, J.M., Massanes, A.B., Ferrer, O.G., Almeda, J., Sarret, S., Rodriguez, M.A., Valmaseda, A.B., Liceran, M., Petitbó, D., Nolla, J.I., Pérez, S., Martínez, S., Vilaseca, J.M., Sebastián, L., Quesada, P., Sequera, G., Barca, E.G., Domingo-Domenech, E., Oliveira, A., Alonso, E., de la Banda, E., Sabater, Y., Vergara, M., Exposito, A., Alonso, T., Padrol, I., Klaustermeier, J., Florencia, Y., Camon, V., Esteban, A., Aymerich, M., Lopez-Otin, C., Muñoz, A., Torralba, Y., Dot, D., Mercadal, S., Sarra, J., Medina, P., Atienza, C., Biondo, S., de Oca, J., Ferran, L., Rodriguez-Moranta, F., Soriano, A., Guardiola, J., Urruticoechea, A., Galan, M., Banda, J.M., Zumel, Á., Saez, A., Garrido, J.A., Lacasaña, M., Ariza, J.L., García, T., García, M.Á., Hidalgo, M.Á., Asuero, M., Bayo, J., Vázquez, V.C., Franco, F., Gurucelain, J.L., Frías, M.J., Van de Haar, R., Viñas, J., Jiménez, H., Aguayo, M., Pereira, A., Gutiérrez, S.P., Rada, R., Candón, J., Domínguez, J., Ramos, M., Pedraza, G., Braulio, J., Salas, J., Labrero, D., Muñoz, D., Barrero, F., Delgado, S., Galisteo, L., Camacho, A., Elena, H., Caballero, J., Muñoz, M.J., Arredondo, F., Linares, R., Tejada, A., Tinto, H., Alés, J.D., Coronado, M.V., Bernal, M.L., Ortiz, J.L., Ocaña, M.N., Cavanillas, A.B., Miguel, Mejías, E.J., Abril, O.M., Requena, R.O., Morata, J.L., Echezarreta, E.G., López, L.M., Martínez, M.M., Sedano, P.P., de la Pedraja Pavón, A., López-Rojo, C., Mendiola, J., Pellicer, E., Caparrós, J.M., Oltra, E.G., Martínez, J.M., Molina, A., Villanueva, V., Miranda, M.J., Abril, C., Martinez, J., Salas, D., Ruiz, J.L., Ponce, M., Noos, P., Cervera, J., Del Val, A., Segura, A., Jiménez, N., Bellmunt, E., Aznar, I., Ramos, D., Montón, T., Solera, M.C., Mora, E.M., Estañ, N., Camarasa, N., Solanas, J.V., Ripoll, J., Cantero, J., Díaz, C.A., García, A.S., Avellón, S.M., Neumann, M., González, M.J., Suárez, M.M., Fernández, G., Fresno, M.R., Gómez, A., Garín, U., de Gros, A., Tamayo, E., Rua, M., Lasarte, C.S., Jauregi, M., Recio, J., Fernández, M., Múgica, M., Ciria, J.P., Guimón, E., Adúriz, C., Lacasta, A., Francisco, J.S., Alvarez, I., Enriquez-Navascués, J.M., Ruiz, I., Michelena, M., Alberro, J.A., Almansa, A.M., Goñi, L.M., Elizagaray, M.I., Técnico, M.O., Pérez, R.B., De Miguel Medina, M.C., Repáraz Romero, M., de Azúa Ciria, A.Y., Díaz, M.M., Lizárraga, M.S., Jiménez, Y.L., López, C.E., Legaz, S.O., Lezaun, R.A., Hurtado, H.O., De Miguel Velasco, M., Rubio, P.A., Cunchillos, F.D., de Liaño Arguelles, Á.D., Peñuela, J.M., Dorronsoro, M.L., Celaya, F.B., García, D.R., de la Higuera Carnicer, B.G., Tricas, J.M., Rivera, E.M., García, F.V., Noain, J.J., Erdozain, E.A., Ulibarrena, C.I., Lopeandía, J.G., Caden, M.A., Moraza, F.A., Domench, J.J., Arteaga, A.A., Navarro, K.A., Del Burgo Tajadura, M.A., Irastorza, F.C., Urrisarri, M.J., Zubicoa, B.F., Lorente, P.G., Sevilla, P.H., Echamendi, M.L., Díaz, Á.M., Salaverri, J.M., Gorricho, F.J., Del Valle, M.P., de Prado Marcilla, J., Garcésducar, M., Herce, P.A., Barasoain, J.E., Campos, I.A., Vergara, E.A., Beraza, B.C., Blasco, L.F., Díaz, L.G., Larrañeta, J.G., Ruiz, N.G., García, J.G., Orduna, M.S., Larena, D.I., Fernández, M.P., de Ciriza Pejenaute, F.J., Escuin, R., Puertas, I.R., Samper, I.A., Sesma, M.E., López, M.J., Apestegui, C.Z., Linares, C., Cervantes, M., Ferreras, E., García-Pérez, J., Fernández-Navarro, P., Pastor, R., Ramis, R., González, Á., Ruiz, T., Muñoz, V., Delgado, R., Lanza, M., Marín, M., Posada, M., Cosmen, J., Villanueva, A., Castaño, A., Jiménez, J.A., Rin, A., Díaz, G., Herreros, M., Pedraza, V., López, P., de la Fuente, M., de Castro, M.F., Sobrino, J., Calvo, R., Carrascal, I., Bernal, R., Mateo, A., García-Olmo, D., Zarazaga, A., Gombau, M.Á., Díaz, J., Gómez, T., Sánchez, T., de la Quintana, P., Ordás, J., Cuevas, P., Sánchez-Pastor, M., de la Peña, J.J., Tabernero, Á., Cámara, N., Hardisson, D., Suárez, A., Burgos, E., Alves, J., Miguel, M., Feliú, J., Belda, C., Zamora, P., Sánchez, A., Hernández, A., Beato, T., Arroba, A., Ballesteros, A., Canora, S., García, C., Romero, M., José, T.S., Espinel, M., Mañas, A., Sánchez, M., Ramón, H., Morillo, J.L., Cuchí, M., García, M.J., Ramos, J.M., Rojo, R., Sanjuanbenito, A., Villanueva, A.G., Gras, M., Cabañas, J.L., Collado, V., Arano, I., Capela, I., Mojarrieta, C., Peñas, B., Rodríguez, M., Ramos, A., Sancho, S., Hervás, A., Moreno, P., Sánchez, C., DoloresRubio, Montoya, L., Sancho, P., Rodríguez, L., Durán, E., Morel, S., Burgos, J., García, R., Del Cañizo, C.G., Díaz, A., González, F., Cristóbal, E., Barahona, C., Vázquez, S., Esteban, V., Pedrera, M., Martínez, J., Carrato, A., Ponce, C.G., Santos-Olmo, A., Barrientos, R.R., López, G., Fernández, A., García, A.B., Noriega, A., Campo, M., Varona, E., López, F., Montero, M., Gómez, M.T., Bartibas, P., Sanz, R., Montes, T., Salinero, M.Á., Herrero, M., Igea, M., Calvo, C., Pérez-Pellón, C., Maestre, M., Agora, M.A., Martín, M.G., Velázquez, D., Fernández, B., Castro, M., Ayuso, E., Masa, R., Antelo, C., García, S., Herrero, S., Delgado, A., Vilardell, L., Puig-Vives, M., Osca-Gelis, G., Buxo, M., Izquierdo, A., Carmona-Garcia, M.C., Romanos, R.R., Galindo, C.T., Bargalló, P.M., Sanchez, E.R., Saez, M., Roncero, J.M., Gallardo, D., Coll, R., Blanco, I., Ruano, L.M., Castaño, E.A., Rusiñol, J.M., Perez, R.J., Pujol, I.M., Tuero, G.C., de Barrio Lera, J.P., Carral, J.M., Pérez, C.A., Puente, M.E., Balbuena, S.P., Presa, J.M., Ramírez, J.A., Martínez, A.Á., de Francisco, T.G., Elosua, T.G., Teso, E.P., Fueyo, J.F., Guadarrama, O.A., Turienzo Frade Mdel, A., De la Hoz Riesco, M., Fernández, J.J., Fernández, V.S., Fernández, R.C., Santamaría, M.V., Simón, J.A., Ganso, A.M., Pacho, A.V., Alegre, S.V., Plaza, F.J., Cuenllas, B.Á., Franco, E.H., Martín, M.H., Ariño, M.T., Tascón, C.D., Palomo, J.A., Castañón López Mdel, C., Lorenzo, M.P., González, I.A., Rivero, F.G., Román, C.H., Fernández, E.Á., Bayón, T.R., Fernández, A.G., Municio, F., de Celis, M.G., Ingelmo, L.Á., Herrero, J.G., Carbajo, M.J., Esteras, T.R., Baz, B.V., Baticón, C.H., Baza, E.Á., Urdiales, A.U., Gil, J.I., López, M.A., Ule, E.C., Diez, C.B., Marín, A.I., Bernabeu, M.Á., de Abajo Olea, S., Rojo, C.V., Fernández, M.Á., González, F.G., Martínez, L.G., Del Huertotrancón Moratiel, M., Ramos, N.C., Fidalgo, S.P., Coque, P.R., González, Á.G., Díez, A.B.

Introduction Familial history of melanoma is a well-known risk factor for the disease, and 7% melanoma patients were reported to have a family history of melanoma. Data relating to the frequency and clinical and pathological characteristics of both familial and non-familial melanoma in Spain have been published, but these only include patients from specific areas of Spain and do not represent the data for the whole of Spain. Patients and methods An observational study conducted by the Spanish Group of Melanoma (GEM) analyzed the family history of patients diagnosed with melanoma between 2011 and 2013 in the dermatology and oncology departments. Results In all, 1047 patients were analyzed, and 69 (6.6%) fulfilled criteria for classical familial melanoma (two or more first-degree relatives diagnosed with melanoma). Taking into account other risk factors for familial melanoma, such as multiple melanoma, pancreatic cancer in the family or second-degree relatives with melanoma, the number of patients fulfilling the criteria increased to 165 (15.8%). Using a univariate analysis, we determined that a Breslow index of less than 1 mm, negative mitosis, multiple melanoma, and a history of sunburns in childhood were more frequent in familial melanoma patients, but a multivariate analysis revealed no differences in any pathological or clinical factor between the two groups. Conclusions Similar to that observed in other countries, familial melanoma accounts for 6.6% of melanoma diagnoses in Spain. Although no differences in the multivariate analysis were found, some better prognosis factors, such as Breslow index, seem more frequent in familial melanoma, which reflect a better early detection marker and/or a different biological behavior.

Background Ductal adenocarcinoma of the pancreas is the fourth leading cause of cancer mortality in the US. The disease is mostly unresectable at the time of diagnosis, making chemotherapy the backbone of therapy. TTFields are a non-invasive, regional antimitotic treatment modality, which has been approved for the treatment of recurrent and newly diagnosed glioblastoma by the FDA. TTFields act by delivering intermediate frequency alternating electric fields to the tumor, and act predominantly by disrupting the formation of the mitotic spindle during metaphase and by dielectrophoretic dislocation of intracellular constituents during cytokinesis. In vitro, TTFields led to reduction in the proliferative potential of pancreatic cancer cell lines with or without chemotherapies, and to a subsequent reduction in their clonogenic potential. In vivo, TTFields led to a significant reduction in tumor volumes. PANOVA was the first trial testing TTFields (150kHz) in pancreatic cancer patients. Results from the first arm of the study, testing TTFields in combination with gemcitabine, have demonstrated superiority in efficacy compared to historical controls, with median PFS of 8.3 months and median OS of 14.9 months (Rivera F. et al, J Clin Oncol 34, 2016 (suppl 4S; abstr 269)). Methods Twenty advanced pancreatic cancer patients were enrolled in the second arm of PANOVA and treated with TTFields in combination with gemcitabine concomitant to nab-paclitaxel. All patients had unresectable tumors, an ECOG performance score of 0-1 and no prior therapy. The primary endpoint was the incidence and severity of treatment emergent adverse events. Results The median age was 68.2 (range – 58-81) and most patients (65%) had an ECOG score of 1. Twelve patients (60%) had distant metastases. The Median number of gem/nab-paclitaxel cycles was 5.0, and median number of TTFields cycles was 7.5. Ten patients (50%) had serious AEs during the study period. Eleven patients (55%) had treatment-related skin toxicity, of which 5 had grade 3 toxicity. No TTFields-related serious AEs were reported. The median PFS was 12.7 months (95% CI 5.4, NA). PFS rate at 6 months was 65%. Of the evaluable tumors, 40% had partial response and another 47% stable disease. The median OS was not reached, and the 1-year survival rate was 72%. Conclusions TTFields concomitant to gemcitabine and nab-paclitaxel are tolerable and safe for advanced pancreatic cancer patients, with promising clinical outcome which doubled published historical data. A phase III trial is planned, testing the efficacy of TTFields combined with gemcitabine and nab-paclitaxel in locally-advanced pancreatic cancer patients. Citation Format: Manuel Benavides, Carmen Guillen, Fernando Rivera, Javier Gallego, Jose Lopez-Martin, Marc Küng. PANOVA: A phase II study of TTFields (150kHz) concomitant with standard chemotherapy for front line therapy of advanced pancreatic adenocarcinoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr CT130. doi:10.1158/1538-7445.AM2017-CT130

e15790 Background: TTFields are a non-invasive, regional antimitotic treatment modality, which has been approved for the treatment of glioblastoma by the FDA. TTFields predominantly act by disrupting the formation of the mitotic spindle during metaphase. TTFields were effective in multiple preclinical models of pancreatic cancer. PANOVA was the first trial testing TTFields in pancreatic cancer patients. Results from the first arm of the study, testing TTFields in combination with gemcitabine, have demonstrated superiority in efficacy compared to historical controls (Rivera F. et al, J Clin Oncol 34, 2016 (suppl 4S; abstr 269). Methods: Twenty advanced pancreatic cancer patients were enrolled in the second arm of PANOVA and treated with TTFields in combination with gemcitabine concomitant to nab-paclitaxel. All patients had unresectable tumors, an ECOG performance score of 0-1 and no prior therapy. The primary endpoint was the incidence and severity of adverse events. Results: The median age was 68.2 (range – 58-81) and most patients (65%) had an ECOG score of 1. Twelve patients (60%) had distant metastases. Ten patients (50%) had serious AEs during the study period. Eleven patients (55%) had treatment-related skin toxicity, of which 5 had grade 3 toxicity. No TTFields-related serious AEs were reported. The median PFS was 12.7 months (95% CI 5.4, NA): 9.3 months in patients with metastatic disease, and not reached in locally-advanced patients. PFS rate at 6 months was 65%: 50% in metastatic disease and 87.5% in locally advanced patients. Of the evaluable tumors, 40% had partial response and another 47% stable disease. The median OS was not reached, and the 1-year survival rate was 72% (62.5% in metastatic disease and 87.5% in locally advanced disease). Conclusions: TTFields concomitant to gemcitabine and nab-paclitaxel are safe for advanced pancreatic cancer patients, with promising clinical outcome which doubled historical data. A phase III trial is planned, testing the efficacy of TTFields combined with gemcitabine and nab-paclitaxel in locally-advanced pancreatic cancer patients. Clinical trial information: NCT01971281.

790 Background: The role of adjuvant chemotherapy (AC) after chemoradiotherapy and surgery in stage II and III of rectal cancer is not well defined. Neither the regimen nor the duration is clear. Besides, guidelines from different expert groups are conflicting. Methods: 224 patients diagnosed from January 2003 to December 2013 with rectal adenocarcinoma T3/T4 and/or positive node staged by ultrasound or magnetic resonance imaging was collected retrospectively from the Pathology Department data base. Results: Of the 224 patients 61.6% were male, median of age at diagnosis 68.6 years (range 31.3-85.4). All of them received 50.4 Gy with different concomitant regimens (capecitabine, continuous infusion of fluoracil or bolus of fluoracil-leucovorin). 13.4% of patients achieved a pathological complete response. 76.8% of the cohort received adjuvant chemotherapy. The main reasons for not receiving chemotherapy were ECOG ≥ 2, surgery complications and a decision of the patient. 51.2% of patients received an oxaliplatin based regimen and the median time of chemotherapy duration was 4 months (range 1-6 months). Local relapse was diagnosed in 6.3% of patients while a systemic relapse was found in 22.3%. Patients without AC had a mean overall survival (OS) of 85.5 months (CI 95% 70.7-100.4) versus 119.8 monts (CI 95% 110.8-128.8) in the AC cohort (p 0.002) without reaching the median after 58 months (range 8-153.9) median follow-up. Disease free survival (DFS) was also better in the AC cohort with a mean DFS of 104 months (CI 95% 94.3-113.6) versus 71.4 months (CI 95% 55.4-87.4), p = 0.01. Conclusions: AC after chemoradiotherapy and surgery in stage II and III rectal cancer as a standard does not exist. In our cohort, AC showed a significant improve in OS and DFS, but the limitations of a retrospective study should be considered, as well as the impact of surgery on metastasis and salvage chemotherapies. Randomized studies are clearly needed.

751 Background: In the VELOUR trial, adding Z to FOLFIRI improves OS, PFS and RR in mCRC pts progressing after oxaliplatin ±biologic agents. The ASQoP trial (NCT01571284) was designed to gather safety and QoL data from mCRC in real-life setting. We report data collected by the Spanish investigators. Methods: ASQoP is single-arm, open-label trial evaluating safety and QoL of Z in mCRC pts as 2nd line. Eligible pts received Z (4mg/kg) q2wks on day 1/cycle, followed by FOLFIRI (dosing was at physician’s discretion) until disease progression, unacceptable toxicity, death, or investigator/pt decision. The EQ-5D was used for utility index (UI) measure and the EORTC QLQ-C30 as generic cancer instrument. QoL population consisted of pts completing the questionnaire at baseline and ≥1 assessment post-baseline and received ≥1 part of 1 dose of study treatment. Results: The safety population comprised 77 pts with ≥1 completed cycle of treatment. Grade (G)3/4 AEs were reported in 72.7% of pts (vs 83.5% in VELOUR), being G3 most commonly reported. There was no G4 hypertension, stomatitis, or proteinuria. G4 Diarrhea was found in 1.3% of pts. Mean baseline UI was 0.7 (95% CI, 0.63-0.78) in 51 pts, and remained relatively stable at cycles 3 (n=39) and 7 (n=24), with a mean (±SD) change from baseline of 0.03 (±0.26) and -0.06 (±0.35), respectively. Mean baseline global health status score was 63.1 (95% CI, 55.8-70.4) in 54 pts, and remained stable up to cycle 9 with a mean (±SD) change from baseline of 4.17 (±38). Conclusions: Thisanalysis has identified no new safety signals and suggests an acceptable toxicity profile with a relatively stable UI and QoL in Spanish mCRC pts in the real-life setting. [Table: see text]

Pancreatic neuroendocrine tumors (PNETs) are rare malignancies that arise from the islets of Langerhans. The role of standard chemotherapy in advanced well-differentiated PNETs remains to be defined. Sunitinib is an oral multitargeted inhibitor with antiangiogenic and antitumor properties that has shown significant improvement in survival in metastatic PNETs, although objective responses by Response Evaluation Criteria in Solid Tumors were only 9%. We herein report on the case of a middle-aged woman with metastatic PNET who was heavily pretreated for her advanced disease with limited success, and who showed clinical, biochemical, and radiological responses by using Choi criteria but not Response Evaluation Criteria in Solid Tumors criteria. To our knowledge, this is the first reported case of treatment with sunitinib in a patient with PNET in response to Choi criteria.

e21525Background: Given the high risk of toxicity to chemotherapy (CT) in elderly, decision making in this population is complex. In this sense, the project ONCOSARCO aims: 1) To know what (frailty...

4007Background: Hypoxia in PDAC is associated with disease progression and poor prognosis. Evo is a hypoxia-activated prodrug of Br-IPM that is preferentially activated under hypoxic conditions. Th...

e15145Background: Data of outcomes of elderly patients ( ≥ 70) with stage II and III rectal cancer treated with multimodal treatment (neoadjuvant chemoradiotherapy, surgery and adjuvant chemotherap...

269 Background: TTFields are alternating electric fields delivered to the region of the tumor by means of non-invasive transducer arrays. TTFields interfere with mitotic spindle formation, thus having an anti-mitotic activity. In pancreatic cancer, TTFields decreased proliferation and clonogenic potential in vitro, and reduced tumor volume in vivo. The PANOVA trial was designed to test TTFields, combined with chemotherapy, in pancreatic cancer. Methods: Twenty patients with advanced pancreatic adenocarcinoma were enrolled in a prospective, single arm study of TTFields at 150 kHz, concomitant with standard weekly gemcitabine. All patients had histologically-confirmed unresectable tumors, with an ECOG performance score of 0-1 and no prior chemotherapy or radiation therapy. The primary endpoint was incidence and severity of treatment emergent adverse events (AEs). Secondary endpoints included progression free survival (PFS), PFS rate at 6 months, overall survival (OS) and response rate. Results: The median age was 73 (range – 49-81) and 60% of the patients were females. Most patients (80%) had an ECOG score of 1. Twelve patients (60%) had distant metastases, while the others had locally advanced disease. Median compliance with TTFields was 78% (14 hours/day), with median duration of 5 months. Fourteen patients (70%) had serious (grade 3-5) AEs during the study period. Six patients (30%) had hematological, 45% gastrointestinal and 15% pulmonary AEs. Ten patients (50%) had treatment-related skin toxicity, of which only 2 were grade 3, both resolved with appropriate treatment. No TTFields-related serious AEs were reported. The median PFS was 8.3 months (95% CI 4.3, 10.3). PFS rate at 6 months was 56%. Of the evaluable tumors, 30% had partial response and another 30% stable disease. The median OS was 14.9 months and 1-year survival rate was 55%. Conclusions: TTFields concomitant to gemcitabine are tolerable and safe for advanced pancreatic cancer patients. The efficacy results are promising and support further research in this indication. An extension of the PANOVA protocol, including 20 additional patients who receive gemcitabine, nab-paclitaxel and TTFields is ongoing. Clinical trial information: NCT01971281.

Inactivation of MLH1 due to promoter hypermethylation strongly suggests a sporadic origin, providing exclusion criteria for Lynch syndrome. The aim of this study is to compare the utility of methylation analysis of MLH1 and BRAF V600E mutations for the selection of patients with MLH1 negative colorectal cancer for genetic testing. MLH1 methylation status was evaluated by MethyLight and methylation-specific MLPA (MS-MLPA) in tumor DNA from 73 colorectal cancer patients with loss of MLH1 protein expression. These tumors were analyzed for BRAF V600E mutations, and genetic testing for germline MLH1 mutations was performed in all corresponding patients. Ten patients had germline mutations in MLH1 and none of their tumors showed significant MLH1 methylation or BRAF V600E mutation. MLH1 genetic testing excluded patients by MethyLight in 47 patients (64%), by MS-MLPA in 49 (67%), and BRAF V600E mutation in only 25 patients (34%) (χ2P = 0.00001). Specificity was 75% for MethyLight, 78% for MS-MLPA and 40% for BRAF V600E mutation. The use of MethyLight or MS-MLPA instead of BRAF mutation resulted in a cost reduction of 41% and 45%, respectively, per every MLH1 mutation detected. Taken together, methylation analysis of MLH1 shows better performance characteristics than BRAF V600E mutation in the selection of patients for genetic testing of MLH1, especially when using MS-MLPA. Supported in part by a grant from the Fundación de la CV para la investigación en el Hospital General Universitario de Alicante (Grupos consolidados 2008). L.P.-C. is the recipient of a grant from the Instituto de Salud Carlos III (FI07/00303). N.A. is supported by Schering-Plough.

Purpose: Immunohistochemistry for mismatch repair proteins has shown utility in the identification of Lynch syndrome, but majority of tumors with loss of MLH1 expression are due to sporadic hypermethylation of the MLH1 promoter. These tumors can also show epigenetic silencing of other genes, such as p16. The aim of our study is to evaluate the utility of p16 immunohistochemistry in the prediction of MLH1germline mutations. Experimental Design: p16 immunohistochemistry was appropriately evaluated in 79 colorectal cancers with loss ofMLH1expression.Methylation of MLH1 and p16 were quantitatively studied using real-time PCR assay Methylight. BRAF V600E mutation in tumor tissue was also investigated. Genetic testing for germline mutation of MLH1was made on 52 patients. Results: Loss of p16 expression was seen in 21 of 79 samples (26.6%). There was found statistically significant association between p16 expression and p16 methylation (P < 0.001), MLH1 methylation (P < 0.001), and BRAF mutation (P < 0.005). All tumors with loss of p16 expression showed hypermethylation of p16 (21of 21), 95.2% (20 of 21) showed MLH1 methylation, and 71.4% (15 of 21) were mutated for BRAF V600E. Mutational analysis showed pathogenic germline mutations in 8 of the patients, harboring 10 tumors. All 10 of these tumors showed normal staining of p16 in the immunochemical analysis. Conclusions: p16 immunohistochemistry is a good surrogate marker for p16 and MLH1 epigenetic silencing due to hypermethylation, and is useful as screening tool in the selection of patients for genetic testing in Lynch syndrome. Generalitat Valenciana Conselleria de Sanitat (AP 021/07), Fundación de la CV para la Investigación en el Hospital General Universitario de Alicante (2008). Beca predoctoral Instituto de Salud Carlos III (FI07/00303, Lucía Perez-Carbonell).

9 páginas, 1 figura, 4 tablas.-- et al., [Purpose]: It is not clear that the published estimates of the breast and ovarian cancer penetrances of mutations in BRCA1 and BRCA2 can be used in genetic counseling in countries such as Spain, where the incidence of breast cancer in the general population is considerably lower, the prevalence of BRCA2 mutations seems to be higher, and a distinct spectrum of recurrent mutations exists for both genes. We aimed to estimate these penetrances for women attending genetic counseling units in Spain. [Experimental Design]: We collected phenotype and genotype data on 155 BRCA1 and 164 BRCA2 mutation carrier families from 12 centers across the country. Average age-specific cumulative risks of breast cancer and ovarian cancer were estimated using a modified segregation analysis method. [Results]: The estimated average cumulative risk of breast cancer to age 70 years was estimated to be 52% [95% confidence interval (95% CI), 26-69%] for BRCA1 mutation carriers and 47% (95% CI, 29-60%) for BRCA2 mutation carriers. The corresponding estimates for ovarian cancer were 22% (95% CI, 0-40%) and 18% (95% CI, 0-35%), respectively. There was some evidence (two-sided P = 0.09) that 330A>G (R71G) in BRCA1 may have lower breast cancer penetrance. [Conclusions]: These results are consistent with those from a recent meta-analysis of practically all previous penetrance studies, suggesting that women with BRCA1 and BRCA2 mutations attending genetic counseling services in Spain have similar risks of breast and ovarian cancer to those published for other Caucasian populations. Carriers should be fully informed of their mutation- and age-specific risks to make appropriate decisions regarding prophylactic interventions such as oophorectomy.

242 Background: The prognosis of patients diagnosed with Pancreatic Cancer (PC) is dismal with a 5-year survival rate of around 5%. Familial Pancreatic Cancer (FPC) is an autosomal dominant rare syndrome defined as families with two or more first-degree relatives with pancreatic cancer that do not fulfill the criteria of any other inherited tumor syndrome. The Spanish familial pancreatic cancer registry, Pan-Gen-FAM was established in 2009 in order to identify and manage families at high risk of developing PC. Methods: Information on the family history of cancer is collected in order to determine the phenotype of individual families and patients are offered genetic testing of known FPC associated genes pertinent to their familial syndrome. An individualized clinical screening program is devised for the early detection of a pancreatic tumor consisting of periodic monitoring by imaging techniques (EUS and MRI) and the evaluation of minimally-invasive tumor biomarkers approaches including Circulating Tumor Cells (CTC) and circulating free DNA in blood. Results: To date the registry includes 125 individuals representing some 41 families. Of 17 families tested so far BRCA2 germline mutations were detected in 5 families and a BRCA1 mutation in 1 family. 43 individuals underwent clinical screening. More pancreatic abnormalities were found by EUS (41%) than by MRI (31%). The most frequent abnormal findings were parenchymal changes associated with chronic pancreatitis. Eight cystic lesions were identified. One lesion was identified as a well differentiated neuroendocrine tumor and another was shown to have benign cytology and whilst carcinoma was found in a third patient, this patient underwent a subsequent partial pancreatectomy. The remaining patients with cystic lesions are undergoing close clinical observation. Seventy three patients underwent CTC determinations and all patients tested negative. Conclusions: Periodic screening of high risk individuals by EUS and RMI can detect small tumors and premalignant lesions. We hypothesize that these persons will have a higher probability of long-term survival than sporadic cases.

201 Background: Advanced gastric cancer (AGC) is a highly lethal disease worldwide with a median overall survival (OS) of less than 12 months. Ramucirumab was the first targeted agent to show survival benefit in the second-line (2L) treatment of AGD. From the REGARD trial, women exhibited a trend towards a worse survival when compared to men. Methods: We retrospectively analyzed the outcome of a Spanish cohort of 55 AGC patients who had received at least two consecutive chemotherapy lines of treatment at our institution. We preselected some clinical parameters (age, gender, Lauren subtype, Her-2 status, grade of differentiation, primary tumor localization and resection, TNM stage, neoadjuvant/adjuvant administration, mono/polychemotherapy in 2L, irinotecan- or taxane-based 2L, Trastuzumab treatment, and administration of third-lines [3L]) to be tested as potential prognostic factors. We focused our analysis on the gender effect in OS after 2L treatment in AGC. The SPSS software package was used for all statistical analyses (Mann-Whitney U test, Chi Square, Kaplan-Meier, Cox regression). Results: Women, diffuse subtype, poorly differentiated tumors, sub-cardia location, single-agent 2L and 3L administration were the clinical characteristics with a significant shorter OS by the univariable analysis. Median OS of women (5 months, 95%CI 3.9-6.0) was significant lower than that in men (13 months, 95%CI 7.9-18.0) by both Log-Rank and Breslow tests (p 0.002). We found no significant differences in age, progression-free survival or time-on-treatment between men and women. Female gender was significantly associated with more taxane-based 2L and with less 3L treatment administration. When 3L treatment administration was excluded in the multivariable analysis, female gender was the only independent prognostic factor of all the clinical parameters included in our review (HR 0.33, 95%CI 0.15-0.75, p 0.008). Conclusions: Our retrospective study found that gender, Lauren subtype, grade of differentiation, primary tumor location, polychemotherapy and 3L administration may be potential prognostic factors in AGC after 2L treatment. Female gender was an independent prognostic factor in our Spanish cohort.

e15019 Background: Overall survival (OS) is considered the traditional endpoint for assessing the efficacy of first-line treatments in clinical trials with advanced gastric cancer. Progression free...

3560 Background: Downsizing with chemotherapy (CT) unresectable liver-limited disease (LLD) can permit resection and prolonged survival in patients (pts) with colorectal cancer (CRC). We assessed t...

4122 Background: G and E have shown a survival benefit in the 1st-line setting in mPC. The aim of this study was to assess whether combining C with G+E was safe and effective as compared with G-E i...