Search

Rapid growth in industrialization and urbanization in developing countries like India, leads to increasing scarcity of land which forces us to utilize the available land even though it is problematic. Problematic soils are those having low bearing capacity, high compressibility and high swelling/shrinkage and as such they are not suitable for any geotechnical application. In most geotechnical engineering projects, increase in concentration of Red mud, Maximum dry density of mixture increases. The mix containing 30% Red Mud + 67% Soil + 3% Fly Ash has good bearing strength characteristics. The bearing strengths of Red Mud were increased to 7.354% on addition of Red Mud and Fly Ash in the ratios of 30% and 3% respectively. With increase in concentration of red mud, California bearing ratio increase up to a fixed concentration of Red mud. With increase in percentage concentration of Red Mud, Optimum moisture content of the mixture (Red Mud + Fly Ash + Soil) increases. With increase in concentration of Red mud, Maximum dry density of mixture increases.

Mercury is a toxic heavy metal. Humans are exposed to mercury through several sources including environmental, occupational, contaminated food and water and from mercury-containing dental amalgam. Mercury exposure is known to harm the nervous system profoundly, and have a negative impact on digestive and immune systems, and other organs. To review and discuss the effect of mercury exposure through environmental or occupational routes on human reproduction, pregnancy, and its outcome. Published information about the potential toxic effects of mercury on human reproduction were collected and summarized. Literature was identified by systematic search using relevant keywords. Literature review revealed a number of negative impacts of mercury on human reproduction. These included effects on semen quality, including reduced sperm count, motility, and changes in morphology that may reduce fertility potential. There may also be an effect in changing reproductive hormone levels. Mercury exposure might also affect pregnancy but the data concerning mercury effects on female reproduction are limited except for some data about mercury exposure and poor pregnancy outcomes. Available data indicate that mercury exposure may have a toxicity effect on reproductive potential, especially in males. Prenatal mercury exposure may affect pregnancy or its outcome and this appears to be dependent upon dose, duration, and timing of exposure. Nutritional status of exposed individual might also influence the impact of mercury.

Skin is the largest organ of the body it protects us from several kinds of environmental hazards and also works as a connective unit between environment and individual. Skin can react in several ways against emotional factors. Alopecia areata and vitiligo are such diseases which effect individuals and their social environments. Vitiligo is a depigmented disorder where complete loss of melanocytes takes place. There are six major factors which define aetiology of vitiligo. Present study is an endeavour to establish a treatment which can change the painful allopathic treatment process of UV exposure, which results in post treatment hazards such as psores, inflammation, and pain. In the present study C57/BL6 mice were selected. The groups are divided in protocol 1; control, toxicant a and toxicant b, protocol 2; 100 mg/kg b.w, 200 mg/kg b.w and 300 mg/kg b.w of ethanolic extract of Psoraleya corylifolia. Linn seeds, and 100 mg/kg b.w, 200 mg/kg b.w and 300 mg/kg b.w of petrolium ether extract of Psoraleya corylifolia. Linn seeds. Topically applied groups of Psoraleya corylifolia Linn. seed oil for 3 weeks, 5 weeks and 7 weeks. The last group was petrolium ether 100 mg/kg b.w+ seed oil topically applied for 5 weeks. Further SOD (superoxide dis mutase), GSH (reduced glutathione), GPx (glutathione per oxidase), MDA (Malone di aldehyde), vitamin E were estimated on the depigmented skin samples. The study concluded that petrolium ether 100 mg/kg b.w showed better results for SOD and MDA, while for GSH and vitamin E ethanolic extract 300 mg/kg b.w showed better results in comparisons to the earlier one. The study successfully justified the hypothesis and the animals were relaxed during the study.

This research paper explores the surge in demand for virtual reality (VR) headsets among young people. The demand has risen by 241.6% due to the popularity of VR games, driven by cheap VR headset makers in countries like India. However, these low-cost VRs have negative impacts on users' health and the environment because of their poor construction and ergonomic design, as well as short lifespan. To mitigate these issues, the paper proposes a platform called Fitgo, which provides VR-like experiences through smartphones while promoting physical activity and reducing the usage of hazardous VRs. Fitgo is a sustainable solution that protects users' health and promotes a greener technology ecosystem. In conclusion, the paper highlights the need for smartphone-based VR experiences to prevent young people from using low-quality VRs that negatively impact their health and the environment., {"references":["1.\tMalfatti, S. M., dos Santos, F. F., & dos Santos, S. R. (2010, November). Using mobile phones to control desktop multiplayer games. In 2010 Brazilian Symposium on Games and Digital Entertainment (pp. 230-238). IEEE.","2.\tLane, N. D., Miluzzo, E., Lu, H., Peebles, D., Choudhury, T., & Campbell, A. T. (2010). A survey of mobile phone sensing. IEEE Communications magazine, 48(9), 140-150.","3.\tNick, T., Coersmeier, E., Geldmacher, J., & Goetze, J. (2010, July). Classifying means of transportation using mobile sensor data. In The 2010 International Joint Conference on Neural Networks (IJCNN) (pp. 1-6). IEEE.","4.\tFluttercommunity.dev - Sensors Plus 2.0.1","5.\tSiriborvornratanakul, T. (2016). A study of virtual reality headsets and physiological extension possibilities. In Computational Science and Its Applications–ICCSA 2016: 16th International Conference, Beijing, China, July 4-7, 2016, Proceedings, Part II 16 (pp. 497-508). Springer International Publishing.","6.\tDevicespecifications.com - POCO M4 Pro 5G Review","7.\tLavoie, R., Main, K., King, C., & King, D. (2021). Virtual experience, real consequences: the potential negative emotional consequences of virtual reality gameplay. Virtual Reality, 25, 69-81.","8.\tImarc Group - Top Players in the Global Virtual Reality Gaming Market","9.\tPressBooks - Augmented Reality Marketing [Chapter - Sensors for AR/VR]"]}

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

Copper deficient Anaemia arises when the body's equilibrium of copper ingestion, retention, and waste is insufficient to fully support cell production. Despite the fact that Anaemia seldom causes death, it has a substantial influence on overall wellbeing. This illness is readily recognized and treated in the modern world, yet clinicians often neglect it. However, in impoverished nations, it is a global medical issue that affects a large section of the population. Generally, iron deficiency Anaemia prevention and therapy are grossly inadequate, particularly among disadvantaged mothers and kids. The illness's medical and molecular characteristics are investigated first, followed by an analysis of key economic, ecological, pathogenic, and genetical that converge across communities. Given the availability of iron on the earth, Adult iron is a regular phenomenon and the leading source of anaemia across the globe. To truly comprehend the iron scarcity, the concepts of iron availability and requirement for the development of red cells must be explored. Anaemia.

This study presented the bioactive lead(II) compounds of oxazine and thiazine Schiff-bases using NMR (1H, 13C), FT-infrared spectroscopy, UV-visible, molar conductance, elemental analysis and molecular weight. The molecular parameters e.g. bond length, bond angle, HOMO/LUMO energy gap and softness/hardness was calculated by DFT-B3LYP/Lanl2dz basis set. According to the spectral data, the Schiff-base coordinated to the lead atom in bidentate mode. A theoretical DFT computational investigation was conducted to supplement the experimental data. The antibacterial activity of lead complexes against E. coli (–) and S. aureus (+) bacteria was determined by disc-diffusion method. Lead complexes of thiazine derivatives are more active than oxazine derivatives. In order to better understand the molecular interaction and binding mode of the drugs, a molecular docking study has been carried out on the protein 3q8u (NDK) from S. aureus. A docking investigation with the NDK protein (S. aureus) revealed that compound 1h has the highest binding affinity (-8.18 Kcal/mol) among the eight ligands (1a-h).

Because of urbanisation, surfaces of buildings and pavements have increasingly displaced green areas in urban areas. Because of this, solar energy is absorbed by roads, buildings, & rooftops, increasing the surface temperature over that of the surrounding air. This is known as an "Urban Heat Island" (UHI). Urban heat islands can worsen the quality of the environment where people live, increase energy demand, elevate ground-level ozone, and potentially raise death rates. Because of the seriousness of the situation, considerable study has been conducted, and a lot of literature on the subject is now available. This review presents the types, causes, effects, mitigation measures and methods to detect the UHI with their limitations. One of the major findings is that increasing landscaping areas and using high-albedo materials have a great effect on reducing UHI. The majority of researchers are working towards the detection of UHI and suggesting mitigation strategies, then reviewing the implemented mitigation measures and policy making. Keywords: Urban heat island (UHI); Types of UHI; UHI Causes, effects & mitigation strategies; methods to detect the UHI with their limitations

Water is an essential element for the survival of all living creatures on earth. No life is possible without water. Drinking water is quite essential, similarly, proper drinking manners are significant in maintaining health. In the present study, we recommend a specific shape of drinking water utensil as an essential and influencing factor for human health. The shape of the drinking water utensil should be a curved surface, rather than a plain cylindrical water bottle, we recommend the old Indian Lotay for the best drinking water utensil. To support our hypothesis we conducted a questionnaire-based double-blind study based on STORB guidelines. The study was conducted on 400 people from different circumstantial and age groups, based on 16 questions. We found that the people drinking directly with the modern day plastic water bottles are more prone to the digestive issues such as indigestion, acidity, and gastritis. Hence we strongly oppose the existing water bottle shape (cylindrical with a narrow neck) for drinking, because it physiologically harms the human health

The high altitude of the Himalayan cold desert represents a valuable habitat of natural resources. The extreme climatic condition manifested by intense mutagenic UV-radiation, physiological drought, desiccation and strong winds, makes the survival of plants really difficult. As a consequence of this atmospheric stressor, the plants produce unique metabolites which play a preventive role in intrinsic mechanism of sustenance. Many plant species of this region have been investigated in search of novel antioxidants and antimicrobials. Plants synthesize several antioxidants that aid in antioxidant defense system, thereby protecting plants against damage caused by active ROS. These compounds include chlorophyll derivatives, alkaloids, essential oils, phytosterols, phenolics and polyphenolics. Some of the antioxidants that have been isolated from plants include curcumin, quercetin, ascorbic acid, resveratrol amongst many other compounds. Additionally, the emergence of resistance to multiple antimicrobial agents has become a major threat to public health. Hence, fresh efforts towards new drug identification and development are greatly needed. Plants have long been used in traditional Indian medicine for numerous therapeutic benefits and low toxicity. Considering the growing interest in quest for search of plant based antimicrobials and antioxidants; an effort has been carried to systematically record the antioxidants and antimicrobial potential of plants of Himalayan region.

Mustard (Brassica juncea L.) is an important oil seed crop in the Brassicaceae family. It is widely cultivated in India for its edible leaves, oil and medicinal properties. In January 2022, we noticed necrotic symptoms typical black rot disease on Brassica juncea (L.) cv. Pusa Bold grown in Indian Agricultural Research Institute, India. Initially, chlorotic lesions emerged on the leaf margin, which progressed to angular V-shaped necrotic lesions and blackened veins. Disease progression became a necrotic appearance in the leaf results browning and papery leaf texture appeared. The suspected causal agent was isolated from three different diseased plants of Pusa Bold on nutrient sucrose agar medium that formed pale yellow, mucoid, and fluidal colonies. Three representative isolates originated from three different plants were sub-cultured on YGCA medium. These isolates are Gram-negative, oxidase negative, KOH positive, nonfluorescent on King's Medium B agar, and positive for starch hydrolysis test (Schaad and White 1974). The 16S ribosomal RNA gene and avirulence genes - AvrBs1 and AvrGf1 were amplified and sequenced in these three isolates with other Xanthomonas campestris pv. campestris (Xcc) isolates. The DNA sequence analysis revealed that these isolates are within the species of X. campestris. The race 1 specific marker namely xcc-b100_4389 was used to characterized the race by detection of 1090bp fragment respectively from gDNA of Xcc isolates (Rubel et al., 2017). The pathogenicity of these isolates was tested twice on youngest leaves of 30-day-old plants of Pusa Bold to convey Koch postulates. Inoculum of three isolates were prepared in nutrient broth at 28°C for 48-h. The pathogenicity test was conducted by small scissors dipped in a bacterial suspension (~ 108 cfu/ml) to cut leaf near margins at 10 points per leaf and the three youngest leaves per plant with three replications. The number of infected points per leaf and the severity of symptoms were assessed 15 and 30 days after inoculation (Singh et al., 2011; 2016). The chlorotic lesions with V-shaped symptoms were appeared on all inoculated plants after 15 and 30 dpi (days post-inoculation). The bacteria were reisolated from inoculated plants and has the same identity as original isolates by using 16S rRNA, avr genes and race 1 specific marker PCR, thereby confirming Koch's postulates. The bacterial inoculation was repeated and the same symptoms appear. Most of the crucifers are infected with black rot disease e.g., cauliflower, cabbage, Brussels, sprout etc. (Vicente et al., 2001). The nucleotide BLAST analysis of 16S rRNA, AvrBs1, AvrGf1 showed a 100% identity with different Xcc strains reported from Germany (B100; AM920689), Brazil (ATCC 33913; AE008922), India (Xcc-C7; CP077958), France (CFBP 5817; CM002673) and China (8004; CP000050) (Singh et al. 2022). Whilst, the nBLAST analysis of xcc-b100_4389 showed 100% nucleotide identity with Xcc race 1 (B100; AM920689), Germany. The sequences were deposited in GenBank (16S rRNA: OM839780; AvrBs1: OM994397; AvrGf1: OM994398; xcc-b100_4389: OM994399). The XccAK1 strain (ITCCBH_0014) was deposited in Indian Type Culture Collection, ICAR-IARI, New Delhi, India. Presently, it is a first report of necrotic black rot on B. juncea cv. Pusa Bold incited by Xcc race 1, India. Previous research reported the black rot disease on other species of the Brassica genus e.g., B. oleracea, and B. napus in Serbia (Popovic et al., 2013) and Argentina (Gaetan et al., 2005).

Background: MANET is a constrained environment having limited energy, restricted bandwidth, and unstable wireless connectivity, etc. It creates a high demand to design an efficient QoS routing protocol having a multi-criteria metric to make efficient routing decisions. Aims: This work is to enhance end-to-end network throughput. To achieve our aim we optimized MBQA-OLSR, which is an enhancement of MP-OLSR. MP-OLSR is enhancement of OLSR, which is a prominent proactive routing protocol. Main advantageous concept in OLSR is selection of MPR nodes that minimize excessive transmission of control packets. Selected MPR nodes should carry enough battery to increase network life time. Packet loss is another issue on wirelesThe main aim of QoS based routing protocol EB-OLSR (Energy efficient and Bandwidth aware Optimized Link State Routing) is to achieve enhanced aggregate network throughput. Which is acquired by selecting QoS qualified efficient nodes to transmit data packets. EB-OLSR set out analogous efficient mobile nodes for routing by applying newly defined multi-criteria metric EPNI (Efficiency Parameters for Node Indexing) which estimates the node’s efficiency index on the basis of four QoS parameters that are unconsumed power, slothful period, queue length and residual bandwidth.s links, it is due to poor quality unstable links; hence link quality is another work of this paper. Method: We obtained a single node index for each mobile node through EPNI metric based on residual battery, node idle time, packet queue length and residual bandwidth. Result: EB-OLSR produced aggregate network throughput enhancement of 574 bits per second in comparison of MP-OLSR and 390.66 bits per second in comparison to MBQA-OLSR. Average End-to-End Delay for EB-OLSR is 0.41, 0.16 times less and Packet Delivery Ratio enhances 30.74%, 9.5% respectively. Conclusion: This paper evaluated network performance parameters of proposeExperimental results proved that the EB-OLSR is an energy-efficient and bandwidth aware optimized link-state routing protocol, which successfully meets the main aim of this study i.e. throughput enhancement of mobile ad-hoc network. The EPNI metric is the major strength of the work which is used to get a single-valued weighted sum of multiple criteria.d routing protocol EB-OLSR that are packet delivery ratio average end to end delay and throughput. It has been observed from simulation experiments that EB-OLSR outer perform other compared similar kind of routing protocols at different network sizes. In proposed work, EPNI metric is defined to get weighted sum of multiple criteria and it is considered to make decision for routing data packets. Single valued multiple criteria evaluation helps to simplify relationship and priority between multiple criteria and combined them in a single node index. Hence along with optimized throughput control overheads are also minimized. EB-OLSR is energy efficient and bandwidth aware optimized link state routing protocol, which successfully meet the main aim of this study i.e. throughput enhancement of mobile ad-hoc network. Aggregate throughput enhances 574 bits per second in comparison of MP-OLSR and 390.66 bits per second in comparison of MBQA-OLSR. Average End-to-End Delay for EB-OLSR is 0.41, 0.16 times less in comparison of MP-OLSR, MBQA-OLSR respectively. Packet delivery ratio enhances 30.74% in comparison of MP-OLSR and 9.5% in comparison of MBQA-OLSR. Performance analyzes at varying traffic load shows only slighter improvement. In this study, we put fixed weights to every considered metric according to general priority. In future, we will study the priorities of metrics in different network scenarios like at varying node speeds, at different mobility patterns, etc to see whether priorities of metrics changes in different scenario or not.

Excessive air pollution, both ambient and indoor are might be detrimental to human wellbeing and are related to morbidity and mortality, it may also affect the reproductive function and its outcome. It is a recognized fact that air pollution contains several toxicants, gases, particulate matter, toxic metals etc. Some of them might affect reproductive and developmental process and a few are persistent. The information accessible on air pollution to human male reproduction is stated to affect semen quality by diminishing one or more sperm quality parameters i.e., sperm morphology, concentration, motility etc. and may causes sperm DNA damage, these might alter the fertility potential which in turn affect pregnancy or its outcome. The impact might be related to the pollutant’s concentration and duration of exposure. The data on impact of air contamination on endocrine function are inadequate, inconsistence and the diversity of existence of air contaminants in area to area and multiplicity in semen quality parameters assessed in various studies as well as study design variables complicated the problem of evaluation of impact of air pollution on male reproduction. The data available suggests the air pollution is might be injurious to human male reproductive health, which depends upon amounts of air pollutants in the air, duration of exposure etc. but more comprehensive data are needed to substantiate the findings. The data are also needed on indoor air pollution on reproduction as people are might be subjected to greater quantities of some of the indoor air pollutants as compared to ambient air pollution.

Culture is a broad term that is not only used to define how human being live and interact with each other but it also includes shared attitudes and values. If we see academic culture in specific then it can be said that it involves ways of behaving and consists of those attitudes and values which are shared by people working or studying within the educational institutions. Academic culture of educational institutions largely involves academic viewpoints, morals, integrities and environments. Higher education plays an important role in shaping the academic culture of the country so the role of universities becomes very important in this regard. This paper aims to study the role of universities in India in shaping the academic culture of a country. It is based on secondary sources like government websites, United Nations Educational Scientific and Cultural Organisation (UNESCO) reports, journals (national and international), books, articles etc.

Nurses are the heart of the health care system. They develop a plan of care, working collaboratively with physicians, therapists, the patient’s families and other team members that focus on treating illness to improve quality of life. This study was conducted to enhance the knowledge of nal year students of BSc Nursing and GNM who are the future nurses regarding partograph because they have to implement their partograph-related knowledge. A sample of 64 students of BSc Nursing and GNM was imparted training in partograph. The assessment after the training revealed that majority of students (42.18%) students had average knowledge regarding E-learning partograph.

Oxazine and thiazine heterocycles have distinctive interests due to their important class of natural and non-natural products and exhibit high biological activities in the pharmaceutical and biological fields. This work was planned to synthesize Schiff base of 1,3-oxazine and 1,3-thiazine derivative from 4-phenyl substituted chalcones. The structures of the newly synthesized targeted compounds were established from UV, IR, 1H NMR, 13C NMR and DFT calculations. The molecular properties HOMO-LUMO energy, energy gap, softness and harness were calculated using DFT/B3LYP/6-311G (d,p) basis set. in vitro Antibacterial activities of Schiff bases of 1,3-oxazines and 1,3-thiazines derivatives were investigated against Gram-positive (Staphylococcus aureus) and Gram-negative bacteria (Escherichia coli) and compared with each other. It was found that thiazine derivatives showed higher activity.