Search

Background: Deficiency of natural anticoagulant antithrombin was first reported as a genetic risk factor for venous thromboembolism, antithrombin III (AT III) is encoded by the serpin family C member 1 (SERPINC1) gene, consisting of 432 amino acids, including 3 disulfide bonds and 4 possible glycosylation sites. Studies have shown that hereditary AT deficiency increases the incidence of venous thromboembolism by up to 20 times., Case Presentation: The case presented a 27-year-old young man with no acquired risk factors and a sudden onset of right lower extremity venous thrombosis and pulmonary embolism. A heterozygous mutation in gene SERPINC1 of c.1154-14G>A was detected in the patient, which is a deleterious mutation resulting in reduced AT III activity and increased risk of thrombotic events. The patient received anticoagulant therapy for approximately 5 months, and the thrombus gradually dissolved and no recurrent thrombotic events occurred during follow-up., Discussion: AT deficiency is a rare autosomal dominant genetic disease, they are mainly divided into 2 types according to the different effects on the structure or function of the encoded protein. The patient had a mutation in the SERPINC1 gene (c.1154-14G>A). Several cases of this type of mutation have been reported since 1991, and it is classified as AT deficiency type I., Conclusion: Thrombosis in patients with antithrombin deficiency is often unpredictable and can lead to fatal pulmonary embolism. Early genetic testing for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors is critical. Long-term anticoagulation treatment is an effective treatment, for this type of type I AT III deficiency combined with pulmonary embolism patients, warfarin is an effective anticoagulant drug., Competing Interests: The authors have no funding and conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Importance: Patients with trauma exhibit a complex balance of coagulopathy manifested by both bleeding and thrombosis. Antithrombin III is a plasma protein that functions as an important regulator of coagulation. Previous studies have found a high incidence of antithrombin III deficiency among patients with trauma., Objective: To assess whether changes in antithrombin III activity are associated with thrombohemorrhagic complications among patients with trauma., Design, Setting, and Participants: This cohort study was conducted from December 2, 2015, to March 24, 2017, at a level I trauma center. A total of 292 patients with trauma were followed up from their arrival through 6 days from admission. Data, including quantification of antithrombin III activity, were collected for these patients. Thromboprophylaxis strategy; hemorrhage, deep vein thrombosis (DVT), and pulmonary embolism screenings; and follow-up evaluations were conducted per institutional protocols. Data analyses were performed from September 28, 2023, to June 4, 2024., Main Outcomes and Measures: The primary study outcome measurements were associations between antithrombin III levels and outcomes among patients with trauma, including ventilator-free days, hospital-free days, intensive care unit (ICU)-free days, hemorrhage, venous thromboembolic events, and mortality., Results: The 292 patients had a mean (SD) age of 54.4 (19.0) years and included 211 men (72.2%). Patients with an antithrombin III deficiency had fewer mean (SD) ventilator-free days (27.8 [5.1] vs 29.6 [1.4]; P = .0003), hospital-free days (20.3 [8.2] vs 24.0 [5.7]; P = 1.37 × 10-6), and ICU-free days (25.7 [4.9] vs 27.7 [2.3]; P = 9.38 × 10-6) compared with patients without a deficiency. Antithrombin III deficiency was also associated with greater rates of progressive intracranial hemorrhage (21.1% [28 of 133] vs 6.3% [10 of 159]; P = .0003) and thrombocytopenia (24.8% [33 of 133] vs 5.0% [8 of 159]; P = 1.94 × 10-6). Although antithrombin III deficiency was not significantly associated with DVT, patients who developed a DVT had a more precipitous decrease in antithrombin III levels that were significantly lower than patients who did not develop a DVT., Conclusions and Relevance: In this cohort study of patients with trauma, antithrombin III deficiency was associated with greater injury severity, increased hemorrhage, and increased mortality, as well as fewer ventilator-free, hospital-free, and ICU-free days. Although this was an associative study, these data suggest that antithrombin III levels may be useful in the risk assessment of patients with trauma.

Rationale: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective., Patient Concerns: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS., Diagnoses: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father., Interventions: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation., Outcomes: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation., Lessons: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Background: Thrombophilia is a coagulation disorder closely associated with venous thromboembolism. Hereditary antithrombin III (AT III) deficiency is a type of genetic thrombophilia. In China, genetic thrombophilia patients mainly suffer from deficiencies in AT III, protein S, and protein C. Multiple mutations in the serpin family C member 1 (SERPINC1) can affect AT III activity, resulting in thrombosis., Case Presentation: This case presented a 17-year-old adolescent female who developed lower extremity venous thrombosis and subsequently pulmonary embolism (PE) following a right leg injury. A missense mutation in gene SERPINC1 of c.331 T > C, p.S111P was detected on the patient, resulting in a decreased AT III activity and an elevated risk of thrombosis. The patient received anticoagulation treatment for approximately 5 months. During follow-up, the blood clot gradually dissolved, and there have been no recurrent thrombotic events reported thus far., Discussion: Hereditary AT deficiency can be classified into two types based on the plasma levels of the enzymatic activity and antigen. Type I is a quantitative defect, while Type II is a qualitive defect. Until 2021, 486 SERPINC1 gene mutations have been registered, more than 18% of which are point mutations. The SERPINC1 mutation c.331 T > C in was firstly reported in 2017, which was classified into type I AT III deficiency., Conclusion: Hereditary thrombophilia is a coagulation disorder with a high omission diagnostic rate. Minor mutations in the SERPINC1 gene can also lead to hereditary AT III deficiency, which in turn can cause PE. We emphasized the importance of etiological screening for hereditary thrombophilia in venous thromboembolism patients without obvious high-risk factors. Long-term anticoagulation treatment and avoidance of potential thrombosis risk factors are critical for such patients., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)

Literature regarding the management of thrombus refractory to first-line treatment in the setting of pregnancy is limited, and management is made even more complicated in the context of thrombophilia. This case reviews the management of a patient with antithrombin deficiency who developed a massive thrombus during pregnancy, which was complicated by May-Thurner syndrome, lack of improvement with heparin, and preterm labor. The patient received multidisciplinary care throughout the pregnancy. At 35 weeks, anticoagulation was paused as she underwent induction of labor and delivery followed by postpartum placement of inferior vena cava filter and restarting heparin. Successful management of our pregnant patient with thrombus refractory to heparin hinged on individualized treatment for medical optimization with anticoagulation and antithrombin concentrate prior to labor followed by immediate postpartum placement of inferior vena cava filter., (Copyright © 2023 Wolters Kluwer Health, Inc. All rights reserved.)

Antithrombin deficiency is a high-risk factor for venous thromboembolism during pregnancy, whereas cerebral venous thrombosis is rare. Cerebral venous thrombosis related to coronavirus disease 2019 (COVID-19) vaccines has been reported; however, there are a few reports of cerebral venous thrombosis after a messenger RNA (mRNA) vaccination. A 25-year-old female in her sixth week of pregnancy presented with headache 24 days after BNT162b2 mRNA COVID-19 vaccination. The following day, she presented with altered sensorium and was diagnosed with severe cerebral venous thrombosis. She demonstrated heparin resistance and was found to have an inherited antithrombin deficiency. A heterozygous missense variant in SERPINC1 (c.379T>C, p.Cys127Arg, 'AT Morioka') was detected by DNA analysis. Despite intensive care with unfractionated heparin, antithrombin concentrate, and repeated endovascular treatments, she died on the sixth day of hospitalization. Cerebral venous thrombosis in pregnant women with an antithrombin deficiency can follow a rapid and fatal course. Treatment with unfractionated heparin and antithrombin concentrate may be ineffective in severe cerebral venous thrombosis cases with antithrombin deficiency. Early recognition of antithrombin deficiency and an immediate switch to other anticoagulants may be required. Although the association between cerebral venous thrombosis and the vaccine is uncertain, COVID-19 vaccinations may require careful evaluation for patients with prothrombic factors.

Rationale: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia., Patient Concerns: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain., Diagnoses: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4)., Interventions: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy., Outcomes: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed., Lessons: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD., Competing Interests: The authors have no conflicts of interest to disclose., (Copyright © 2022 the Author(s). Published by Wolters Kluwer Health, Inc.)

Antithrombin (AT) deficiency is a high-risk thrombophilia and a rare condition. The risk of venous thromboembolism (VTE) is increased in AT-deficient women during pregnancy and the postpartum period and is especially high in women with a prior history of VTE. A thorough assessment of VTE risk is recommended in pregnant AT-deficient women, comprising the degree and type of AT deficiency, genetic mutations, personal and family history, and additional preexisting or pregnancy-specific risk factors. Due to a lack of adequate study data, there is limited guidance on the management of AT deficiency in pregnancy, including the need for prophylactic anticoagulation, the appropriate dose of low-molecular-weight heparin (LMWH), and the role of AT substitution. LMWH is the medication of choice for the pharmacological prophylaxis and treatment of VTE in pregnancy. Patients with a history of VTE should receive full-dose LMWH during pregnancy and the postpartum period. AT concentrates are a treatment option when anticoagulation is withheld in potentially high-risk events such as childbirth, bleeding, or surgery and in cases of acute VTE despite the use of therapeutic dose anticoagulation. Women with AT deficiency should be counseled at specialized centers for coagulation disorders or vascular medicine, and close cooperation between obstetricians and anesthesiologists is warranted before delivery and during the peripartum period., Competing Interests: Susanne Heimerl has recieved Payment or honoraria for presentations from Takeda Pharmaceutical and Roch. Also Support for attending meetings from Takeda Pharmaceutical and Swedish Orphan Biovitrum.Birgit Linnemann has recieved consulting fees and Payment for lectures and presentations from Bayer, BMS/Pfizer, Daichi Sankyo, Leo, Sanofi., (Thieme. All rights reserved.)

Background: The best thromboprophylaxis for pregnant women with congenital antithrombin deficiency (CAD) is controversial., Objective: To clarify the effectiveness of a protocol for venous thromboembolism (VTE) prevention in pregnant women with CAD., Methods: Women at high risk of VTE were administered antithrombin concentrate and heparin after conception, whereas those at low risk of VTE were administered heparin alone until delivery. All women received antithrombin concentrate at delivery except for one who was diagnosed with CAD., Results: Ten women had CAD, including one in the high-risk group and nine in the low-risk group. No women had VTE at delivery as per the protocol for VTE prevention. Almost all women had increased antithrombin activity before delivery followed by maintenance at ≥ 70% due to antithrombin concentrate administration. VTE prophylaxis during and after delivery was successful in all women with CAD. However, one woman in the low-risk group did not receive heparin and developed VTE induced by severe hyperemesis at 9 gestational weeks, before the diagnosis of CAD. Women in the high-risk group received antithrombin concentrate after delivery but had increased D-dimer levels at postpartum., Conclusions: Our protocol to prevent VTE in pregnant women with CAD is safe and effective., (© 2022. Japanese Society of Hematology.)

Setting: In the article, we remember the role of antithrombin (AT) in hemostasis, escalation of AT-potential with heparin and difficulties with monitoring the effectiveness of LMWH therapy (low molecular weight heparin) in patients with AT deficiency. We pay most of our attention to hereditary AT deficiency and its thromboembolic risk in pregnancy., Methods: In the introduction, the principle of AT function, its two main domains and the regulation of synthesis are cleared. We describe the causal mutations of hereditary AT deficiency in SERPINC1 gen and the relation to a thromboembolic risk. The general recommendations for patients with hereditary AT deficiency and pregnant women are mentioned. As the risk of thromboembolic disease is escalated in pregnancy, the LMWH should always be considered. There has been frequently observed that patients with AT deficiency do not elevate anti-Xa-levels when standard prophylactic LMWH doses are used. This fact well illustrates that heparin without AT may not inhibit the active coagulant factors efficiently enough. Therefore, if a high thromboembolic risk in the patient’s anamnesis is present, the LMWH dosing should be escalated. In individual cases, concomitant administration of an antithrombin concentrate to the heparin treatment is recommended at the time of delivery or in the case of deep venous thrombosis. In this article, three cases of unusual pregnancy in patients with different types of AT deficiency are reported. The case reports are summarized from the Department of Hematology at Hospital Kolín, the Centre of Hemostasis and Thrombosis at Institute of Hematology and Blood Transfusion in Prague and from cooperating obstetrical departments in the Czech Republic., Results: We demonstrated the threat of hereditary AT deficiency in three case reports. In one case, the estimated risk of thromboembolism – type I of AT-deficiency (quantitative) – was in a good correlation with real peripartal complications. In the next two cases with different types of AT deficiency, we showed surprising courses of complicated pregnancies., Conclusion: As it has been shown, it is not safe to estimate the risk of thromboembolism on the base of causal mutation for AT deficiency. For present clinical practice, we should still remember AT deficiency as a potentially very dangerous thromboembolic disorder for mother and fetus; thus, excellent cooperation of an obstetrician and a hematologist is necessary.

Antithrombin deficiency (ATD) was described in 1965 by Olav Egeberg as the first known inherited form of thrombophilia. Today, it is understood that ATDs can be congenital or acquired, leading to qualitative, quantitative, or mixed abnormalities in antithrombin (AT). All ATDs ultimately hinder AT's ability to serve as an endogenous anticoagulant and antiinflammatory agent. As a result, ATD patients possess higher risk for thromboembolism and can develop recurrent venous and arterial thromboses. Because heparin relies on AT to augment its physiologic function, patients with ATD often exhibit profound heparin resistance. Although rare as a genetic disorder, acquired forms of ATD are seen with surprising frequency in critically ill patients. This review discusses ATD in the context of surgical critical care with specific relevance to trauma, thermal burns, cardiothoracic surgery, and sepsis., (Copyright © 2020 Elsevier Inc. All rights reserved.)

Background: Antithrombin (AT) is the primary physiological anticoagulant of normal hemostasis. Hereditary AT deficiency, an autosomal dominant thrombotic disease caused by mutations in the AT gene (SERPINC1), is associated with venous thromboembolism., Objective: We investigated the phenotypes, genotypes, and pathogenesis of hereditary AT deficiency in a 12-year-old boy (proband) who developed a pulmonary embolism and a subsequent deep vein thrombosis., Methods: The AT activity and AT antigen level of the proband and his family members were measured. Mutation sites in all seven exons of SERPINC1 were identified. Analysis of conserved regions around codon 462 of the SERPINC1 gene and functional predictions were performed using bioinformatics tools., Results: The proband, his father, and his paternal grandmother demonstrated reduced AT activity and antigen levels consistent with Type I AT deficiency. A novel heterozygous missense mutation, c.1385G>A (Cys462Tyr) was identified in all three symptomatic family members. This missense mutation causes disruption of the 279Cys-462Cys disulfide bond and leads to type Ⅰ hereditary AT deficiency., Conclusion: A SERPINC1 missense mutation (Cys462Tyr) causing damage to the 279Cys-462Cys disulfide bond of the AT protein appears to be the cause of Type I AT deficiency in this family. These findings indicate one pathological mechanism associated with hereditary AT deficiency., (Copyright © 2020. Published by Elsevier Inc.)

: The incidence of antithrombin III (AT III) deficiency is very rare. The most common complication of AT III deficiency is deep venous thrombosis, which causes a low incidence of intracranial sinus thrombosis. We presented a 31-year-old Chinese woman patient who had a family history of AT III deficiency admitted to our hospital. She had a history of pulmonary embolism. She took rivaroxaban for a long time to prevent thrombosis. After giving birth, she stopped taking the medication for half a year and suffered from drug withdrawal symptoms. Four months after drug withdrawal, she suddenly fell into a coma. After diagnosis, it was found to be caused by a subarachnoid hemorrhage. Finally, she was diagnosed with sagittal and transverse sinus thrombosis. After treatment with mechanical thrombectomy, she fully recovered. In sum, we concluded that mechanical thrombectomy was efficient for AT III deficiency and treating thrombosis.

Background and Aims: Splanchnic vein thromboses (SVT) are a rare condition that can be life-threatening. The most severe thrombophilia associated to SVT is antithrombin (AT) deficiency, usually caused by SERPINC1 mutations. Although transitory AT deficiencies and congenital disorders of the N-glycosylation pathways (CDG) have been recently reported as causes of AT deficiency, the current AT clinical screening still only includes anti-FXa activity. This study aims to (a) improve the detection of AT deficiency in SVT and (b) characterize the features of AT deficiency associated with SVT., Methods: The study was performed in 2 cohorts: (a) 89 SVT patients with different underlying etiologies but in whom AT deficiency had been ruled out by classical diagnostic methods; and (b) 271 unrelated patients with confirmed AT deficiency and venous thrombosis. AT was evaluated by functional (anti-FXa and anti-FIIa) and immunological methods (ELISA, crossed immunoelectrophoresis, western blot), and SERPINC1 sequencing was performed., Results: In 4/89 patients (4.5%) additional alterations in AT were found (two had SERPINC1 mutations, one had a specific variant causing transient AT deficiency and one patient had CDG). In 11 of the 271 patients (4.1%) with AT deficiency and thrombosis, thrombosis was located at the splanchnic venous territory., Conclusions: Antithrombin deficiency may be underdiagnosed by current clinical screening techniques. Therefore, a comprehensive AT evaluation should be considered in cases of rethrombosis or doubtful interpretation of anti-FXa activity levels. SVT is a relatively common localization of the thrombotic event in patients with congenital AT deficiency., (© 2019 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.)

The frequency of severe antithrombin deficiency (SAD) was examined in the hematopoietic disorder-, infectious-, and basic-types of the disseminated intravascular coagulation (DIC). A posthoc analysis of 3008 DIC patients (infectious-type, 1794; hematological disorder-type, 813; and basic-type, 401) from post-marketing surveillance data of thrombomodulin alfa was performed. The clinical features of patients and outcomes were compared between patients with and without SAD, using an antithrombin cutoff value of 50%. Patients with SAD accounted for 40.4% of infectious-type DIC, 8.0% of hematopoietic disorder-type DIC, and 26.7% of basic-type DIC. There was no significant difference in thrombin-antithrombin complex levels between patients with and without SAD. The decreased fibrinogen level and differences in clinical features were significantly greater but the increases in fibrinolytic markers were significantly lower in patients with SAD than in those without. The 28-day survival rate was significantly lower in patients with SAD than in those without. Severe antithrombin deficiency was observed in all types of DIC, including hematopoietic disorders. Both hypofibrinolysis and hypercoagulability in patients with SAD may cause multiple organ failure and poor outcomes.

Genetic predispositions to venous thromboembolism (VTE) are relatively frequent in the general population and comprise a heterogeneous group of disorders. Whereas the most frequent congenital risk factors for thrombosis only moderately increase the risk, a deficiency in antithrombin (AT), one of the most important natural inhibitors of blood coagulation, carries a higher risk. Congenital AT deficiency is an infrequently encountered genetic risk factor for VTE, and different subtypes vary with regard to their thrombotic risk. Patients with congenital AT deficiency, especially those with quantitative deficiency (type 1), may develop thrombosis early in life and often have a conspicuous family history of first- and second-degree relatives with VTE. Women are particularly affected because of the risk potentiation by combined estrogen/progestogen oral contraceptive use or pregnancy. The lack of controlled trials or even observational studies of large cohorts does not allow therapeutic decisions to be based on scientific evidence. In this review, we will discuss cases with thrombotic manifestations and the tailored management of patients with this congenital thrombosis risk factor., (© 2019 by The American Society of Hematology.)

Objective: Hereditary antithrombin (AT) deficiency increases the risk of venous thromboembolism (VTE) in pregnant woman. We report the first case of administration of recombinant human antithrombin (rhAT) to a pregnant Japanese woman with AT deficiency., Case Report: A 30-year-old woman, gravida 2 para 0, was referred to our hospital because of AT deficiency. Unfractionated heparin was administered from 13 weeks of gestation and rhAT was administered from labor onset. A cesarean section was performed and the patient and her baby were healthy, with no sequelae., Conclusion: We concluded that rhAT was effective for preventing VTE during delivery, with no potential infection risks., (Copyright © 2019. Published by Elsevier B.V.)

Inherited antithrombin (AT) deficiency is a rare autosomal dominant disorder, caused by mutations in the AT gene (SERPINC1). Considering that the genotype phenotype relationship in AT deficiency patients remains unclear, especially in pediatric patients, the aim of our study was to evaluate genotype phenotype correlation in a Serbian pediatric population. A retrospective cohort study included 19 children younger than 18 years, from 15 Serbian families, with newly diagnosed AT deficiency. In 21% of the recruited families, mutations affecting exon 4, 5, and 6 of the SERPINC1 gene that causes type I AT deficiency were detected. In the remaining families, the mutation in exon 2 causing type II HBS (AT Budapest 3) was found. Thrombosis events were observed in 1 (33%) of those with type I, 11 (85%) of those with AT Budapest 3 in the homozygous respectively, and 1(33%) in the heterozygous form. Recurrent thrombosis was observed only in AT Budapest 3 in the homozygous form, in 27% during initial treatment of the first thrombotic event. Abdominal venous thrombosis and arterial ischemic stroke, observed in almost half of the children from the group with AT Budapest 3 in the homozygous form, were unprovoked in all cases.Conclusion: Type II HBS (AT Budapest 3) in the homozygous form is a strong risk factor for arterial and venous thrombosis in pediatric patients. What is Known: • Inherited AT deficiency is a rare autosomal dominant disorder, caused by mutations in the SERPINC1gene. • The genotype phenotype correlation in AT deficiency patients remains unclear, especially in pediatric patients. What is New: • The genetic results for our paediatric population predominantly showed the presence of a single specific mutation in exon 2, that causes type II HBS deficiency (AT Budapest 3). • In this group thrombosis mostly occurred as unprovoked, in almost half of them as abdominal thrombosis or stroke with high incidence of recurrent thrombosis, in 27% during initial treatment.

: Pregnancy carries a high risk of thromboembolic complications, especially in the postpartum period. This risk is particularly high in women with inherited thrombophilias, among these antithrombin deficiency seems to carry the highest risk. In this case, the use of low molecular weight heparin (LMWH) is recommended, while the use of antithrombin concentrate is controversial. We report our experience of seven pregnancies occurred in five women: two, with a personal and familiar history negative for venous thromboembolism, were treated with LMWH during pregnancy and antithrombin concentrate immediately before and after the delivery. The other three women had a personal and familiar history positive for venous thromboembolism and were treated with LMWH and antithrombin concentrate during all the pregnancy and the postpartum period. No thromboembolic or hemorrhagic complications were observed in both groups, demonstrating that our strategy could be safe and effective.

: Inherited antithrombin (AT) deficiency, with prevalence in the general population ranging 0.02-0.17%, is an autosomal dominant disorder associated with a high risk of venous thromboembolism. In most cases, deficiency is caused by mutations in the AT-coding gene (SERPINC1). Only 24 splicing defects have been described causing AT deficiency, all affecting exon flanking regions. The aim of the current study was to characterize the mutations underlying AT deficiency in 10 venous thromboembolism Polish patients aged 42.9 (14-63) years. Whole SERPINC1 gene sequencing was done by next generation sequencing methods. Eight cases had mutations previously described. However, we identified two new intronic mutations that might affect the correct splicing of exon 6 according to in-silico predictions: c.1154-1 G>C, which strongly disturbs the acceptor sequence and c.1219-534 A>G, a deep intronic mutation that might generate a cryptic donor sequence; both might compete with the wild-type donor sequence and explain the associated moderate AT deficiency of carriers. In conclusion, we show the molecular base of AT deficiency in 10 new Polish patients, including two novel SERPINC1 gene mutations potentially affecting splicing.

Portal vein thrombosis (PVT) has been reported in many patients with and without liver cirrhosis. The portal vein is a rare site of thrombosis, and various conditions can predispose an individual to PVT. Among those conditions, hereditary thrombophilia has been increasingly reported recently. We herein report the case of a non-cirrhotic 30-year-old man who developed acute PVT with hereditary antithrombin deficiency. Antithrombin (AT) replacement therapy was required along with heparin. Given our experience with this case, we believe that a screening test for prothrombotic disorders, such as AT deficiency, should be considered in cases of PVT.

Introduction . Antithrombin is a serpin that inhibits multiple procoagulant serine proteases and acts as an endogenous anticoagulant. Thus, congenital antithrombin deficiency constitutes a major thrombophilic state, the most severe so far. Areas covered . In the present work, we globally review the biology, genetics, diagnosis, and management of congenital antithrombin deficiency, and also discuss puzzling questions and future perspectives regarding this severe inherited thrombophilia. Expert opinion . Although this disorder exerts high clinical heterogeneity, many carriers will need careful and long-term anticoagulation and/or thromboprophylaxis, especially in high-risk situations, such as surgery and pregnancy. Notably, antithrombin concentrates constitute a considerable arsenal for both treatment and prevention of acute venous thrombosis in subjects with antithrombin deficiency. Current evidences are based almost exclusively on retrospective case series, so an integrated functional, biochemical and molecular characterization will be of clinical relevance and guide hematologists' personalized decisions.

A thrombophilic disorder is a hereditary or acquired condition that increases the risk of thrombosis. The most common hereditary thrombophilias that predispose to venous thrombosis in the Caucasian population are the heterozygous forms of the factor V Leiden and prothrombin G20210A mutation that are generally detected by direct DNA genotyping. Immunologic antigen assays and chromogenic or clot-based activity assays are used to identify deficiencies in the natural coagulation inhibitors antithrombin, protein C and protein S. Because pre-analytical errors and acquired causes of low antithrombin, protein C or protein S levels are considerably more common than hereditary deficiencies, all potential conditions that may lower activity levels of the natural coagulation inhibitors (e.g. concomitant liver disease, pregnancy, anticoagulant therapy) must be considered and excluded before the diagnosis of an inhibitor deficiency can be made. To avoid misclassification, the diagnosis should not be made based on a single abnormal test result. Thus, repetitive testing when the patient is not on anticoagulant therapy is mandatory to confirm the diagnosis. Screening for antiphospholipid syndrome (APS) comprises testing for lupus anticoagulants (LAs) and the presence of IgG or IgM antibodies directed against phospholipids and phospholipid-binding proteins such as β-2-glycoprotein-I. A combination of clot-based assays has been recommended to demonstrate LA activity, whereas solid-phase immunoassays allow the detection of anti-cardiolipin and anti-β-2-glycoprotein-I antibodies. The diagnosis of APS requires the persistence of antiphospholipid antibodies for at least 12 weeks together with thrombotic and/or obstetric features of APS., Competing Interests: Prof. Dr. B. Linnemann received honoraria and/or travel reimbursements over the last three years for lectures and consultancy work related to the topic of this article from Bayer, Boehringer Ingelheim, Bristol-Myers Squibb, Pfizer and Siemens Healthcare.Priv.-Doz. Dr. C. Hart received honoraria and/or travel reimbursements over the last three years for lectures and consultancy work related to the topic of this article from Bayer, Boehringer Ingelheim, Bristol-Myers Squibb, Pfizer and Leo Pharma., (Georg Thieme Verlag KG Stuttgart · New York.)

Objectives: To determine whether precardiopulmonary bypass (CPB) normalization of antithrombin levels in infants to 100% improves heparin sensitivity and anticoagulation during CPB and has beneficial effects into the postoperative period., Design: Randomized, double-blinded, placebo-controlled prospective study., Setting: Multicenter study performed in 2 academic hospitals., Participants: The study comprised 40 infants younger than 7 months with preoperative antithrombin levels <70% undergoing CPB surgery., Interventions: Antithrombin levels were increased with exogenous antithrombin to 100% functional level intraoperatively before surgical incision., Measurements and Main Results: Demographics, clinical variables, and blood samples were collected up to postoperative day 4. Higher first post-heparin activated clotting times (sec) were observed in the antithrombin group despite similar initial heparin dosing. There was an increase in heparin sensitivity in the antithrombin group. There was significantly lower 24-hour chest tube output (mL/kg) in the antithrombin group and lower overall blood product unit exposures in the antithrombin group as a whole. Functional antithrombin levels (%) were significantly higher in the treatment group versus placebo group until postoperative day 2. D-dimer was significantly lower in the antithrombin group than in the placebo group on postoperative day 4., Conclusion: Supplementation of antithrombin in infants with low antithrombin levels improves heparin sensitivity and anticoagulation during CPB without increased rates of bleeding or adverse events. Beneficial effects may be seen into the postoperative period, reflected by significantly less postoperative bleeding and exposure to blood products and reduced generation of D-dimers., (Copyright © 2018 Elsevier Inc. All rights reserved.)

Antithrombin III (ATIII) deficiency is a rare disorder in which thrombosis can be induced by stimuli that do not usually lead to thrombus formation, including minor injuries and surgery. Therefore, patients with ATIII deficiency undergoing cardiovascular surgery that involves heparinization require careful perioperative management. We experienced five patients with ATIII deficiency who underwent cardiovascular surgery and were managed with ATIII replacement. By administration of ATIII concentrate, preoperative ATIII activity was maintained at ≥120% and postoperative ATIII activity at ≥80%. All five patients were treated successfully without postoperative complications such as hemorrhage or thrombosis. In patients with ATIII deficiency undergoing cardiac surgery, it is important to perform ATIII replacement to achieve preoperative ATIII activity ≥120% and postoperative ATIII activity ≥80%, while the activated clotting time (ACT) is maintained at >400 seconds during cardiopulmonary bypass. In addition, long-term postoperative anticoagulant therapy is necessary in hereditary ATIII deficiency patients with a history of thrombosis.

A 19-year-old man was referred due to sudden onset of right foot pain and chest discomfort. Contrast-enhanced computed tomography revealed massive thrombi in the right pulmonary artery and femoral vein. The patient's father had experienced multiple recurrences of venous thromboembolism (VTE) and was diagnosed with inherited antithrombin deficiency by a genetic examination. The patient was administered the oral factor Xa inhibitor rivaroxaban (30 mg). After seven days, the thrombus disappeared. Rivaroxaban (15 mg) was continued for 6 months with no recurrence, indicating the efficacy of this factor Xa inhibitor for the treatment and prevention of VTE in patients with antithrombin deficiency.

: Antithrombin is a major suppressor of thrombin, factor Xa and blood coagulation. Inherited antithrombin deficiency is rare and is considered among the common causes of inherited thrombophilia. The relationship between antithrombin and IUGR, is questionable. The aim of this study was to trace the relationship between antithrombin deficiency and the intrauterine weight reduction and neonatal morbidity. The study was conducted on 55 full-term neonates (including 25 baby boys and 30 baby girls), all were admitted to Neonatal Intensive Care Unit in Cairo University Hospitals with IUGR; and another 110 healthy full-term neonates as control group. ATIII activities were assessed in citrated of patient and control samples automatically on coagulometer (Stago, France). There was a highly significant relationship regarding ATIII deficiency in IUGR group in relation to control group (P value <0.001). In conclusion, we have identified antithrombin deficiency in Egyptian infants as an additional cause for low-birth weight and intrauterine growth retardation.

Background: The risk of thromboembolic events during pregnancy in patients with antithrombin deficiency is increased. Preventing thromboembolic events during pregnancy in the case of antithrombin deficiency is still a matter of concern., Case Presentation: We present a case of a 19-year-old primigravida Greek Pomak woman, who was diagnosed as having congenital antithrombin deficiency. She had a history of recurrent miscarriages and a family history of thrombosis. She was managed with adjusted doses of low molecular weight heparin throughout her pregnancy, with regular anti-Xa and antithrombin level monitoring. Prior to delivery and for 4 days after delivery she received human antithrombin III concentrate. She delivered a small for gestational age baby with no other complications. She required an increased dose of heparin due to heparin resistance., Conclusions: Antithrombin deficiency is associated with an increased risk of venous thromboembolic events with a 50% risk of thromboembolic events before the 50th year of life. It is a rare condition, so data concerning the optimal management during pregnancy are limited. The selection of patients who should receive low molecular weight heparin prophylaxis as well as dose intensity and monitoring are discussed. In our patient a conventional low molecular weight heparin dose proved to be inadequate at least at the laboratory level.

Competing Interests: Competing interests: None declared.

Purpura fulminans associated with antithrombin 3 (AT 3) deficiency is very rare in adults and neonates. It can be categorized into three principal forms - neonatal, idiopathic and acute infectious. Purpura fulminans has been reported to cause cardiac, pulmonary and renal damage in rare cases. We describe an adult case of purpura fulminans developing in association with AT 3 deficiency without infection following a surgical procedure, and acute kidney injury (AKI) developing secondary to rhabdomyolysis and disseminated intravascular coagulation (DIC). To the best of our knowledge there have been no previous cases of purpura fulminans and AKI developing in association with acquired AT 3 deficiency without infection after surgery.

Background: CHADS 2 (congestive heart failure, hypertension, age ≥ 75 years, diabetes mellitus, stroke) and CHA 2 DS 2 -VASc (congestive heart failure, hypertension, age ≥ 75 years, diabetes mellitus, stroke, vascular disease, age 65 to 74 years, sex category) scores showed just moderate discrimination ability in predicting thromboembolic complications in patients with nonvalvular atrial fibrillation (AF)., Hypothesis: To determine the association of antithrombin III (AT-III) deficiency and mean platelet volume (MPV) with the development of stroke or left atrial (LA) thrombus in patients with AF., Methods: AT-III and MPV were analyzed in 352 patients with AF. The primary endpoint was a composite of ischemic stroke event and incidental LA thrombus., Results: There were 50 events (14.2%) during a mean 35.4 months of follow-up. A significantly higher stroke or LA thrombus rate was observed in the low-AT-III group (<70%) than that in the high-AT-III group (≥70%). A significantly higher stroke or LA thrombus rate was observed in the high-MPV group (≥7.0 fL) than that in the low-MPV group (<7.0 fL). AF patients with an MPV ≥7.0 fL and AT-III deficiency had higher stroke or LA thrombus risk than those without an MPV ≥7.0 fL and AT-III deficiency. In the Cox proportional hazard analysis, high MPV was found to be an independent predictor of stroke or LA thrombus risk (hazard ratio: 6.408; 95% confidence interval: 2.874-14.286). Although AT-III deficiency was not an independent predictor of stroke or LA thrombus risk, a trend was observed., Conclusions: High MPV and AT-III deficiency were predictive markers for stroke or LA thrombus. Their predictive power for stroke was independent of antiplatelet treatment, anticoagulation therapy, and a high CHA 2 DS 2 -VASc score in patients with AF., (© 2017 Wiley Periodicals, Inc.)

Background: Hereditary thrombophilia (HT) is a genetic predisposition to thrombosis. Asian mutation spectrum of HT is different from Western ones. We investigated the incidence and clinical characteristics of HT in Korean patients with unprovoked venous thromboembolism (VTE)., Methods: Among 369 consecutive patients with thromboembolic event who underwent thrombophilia tests, we enrolled 222 patients diagnosed with unprovoked VTE. The presence of HT was confirmed by DNA sequencing of the genes that cause deficits in natural anticoagulants (NAs). Median follow-up duration was 40±38 months., Results: Among the 222 patients with unprovoked VTE, 66 (29.7%) demonstrated decreased NA level, and 33 (14.9%) were finally confirmed to have HT in a genetic molecular test. Antithrombin III deficiency (6.3%) was most frequently detected, followed by protein C deficiency (5.4%), protein S deficiency (1.8%), and dysplasminogenemia (1.4%). The HT group was significantly younger (37 [32-50] vs. 52 [43-65] years; P < 0.001) and had a higher proportion of male (69.7% vs. 47%; P = 0.013), more previous VTE events (57.6% vs. 31.7%; P = 0.004), and a greater family history of VTE (43.8% vs. 1.9%; P < 0.001) than the non-HT group. Age <45 years and a family history of VTE were independent predictors for unprovoked VTE with HT (odds ratio, 9.435 [2.45-36.35]; P = 0.001 and 92.667 [14.95-574.29]; P < 0.001)., Conclusions: About 15% of patients with unprovoked VTE had HT. A positive family history of VTE and age <45 years were independent predictors for unprovoked VTE caused by HT.

Antithrombin (AT) deficiency, a rare disorder of the coagulation system, is a serious risk factor for thromboembolism. Approximately 50-90% of patients with AT deficiency develop thromboembolism during their lifetime. In addition, surgery is a major risk factor for thromboembolism in these patients. We herein report the case of a 90-year-old woman with AT deficiency who was safely and successfully managed using rivaroxaban (a direct oral factor Xa inhibitor) during the perioperative period of surgery for right femur fracture. The present case illustrates the effectiveness of rivaroxaban in preventing thromboembolisms due to surgery, even in very elderly patients with antithrombin deficiency. Further investigations are needed to determine the optimal dosage of rivaroxaban.

Patients with low antithrombin III (AT III) has increased risk for arteriovenous thromboembolic (TE) disease. We report a 28-year-old Malay lady who presented with spontaneous right calf pain and swelling of one week duration. She was on oral contraceptive pills and had a history of travelling for a long distance prior to the presentation. Her brother who was diagnosed with AT III deficiency had arterial thrombosis at a young age. She was diagnosed as having right popliteal vein thrombosis by ultrasound and treated with subcutaneous fondaparinux. While on treatment, she developed massive bilateral pulmonary embolism (PE). Thrombophilia study showed reduced AT III activity (38μl/dl) and normal results for protein C, protein S, activated protein C resistance and lupus anticoagulant assays. This patient has heterozygous AT III deficiency added with significant acquired factors responsible for the TE events. Those with AT III deficiency may have resistance to heparin therapy and require higher doses of heparin.

Genetic risk factors predispose to thrombophilia and play the most important etiopathogenic role in venous thromboembolism (VTE) in people younger than 50 years old. At least one inherited risk factor could be found in about half of the cases with a first episode of idiopathic VTE.Roughly, genetic risk factors are classified into two main categories: loss of function mutations (such as deficiencies of antithrombin, protein C, protein S) and gain of function mutations, (such as prothrombin mutation G20210A, factor V Leiden). A revolutionary contribution to the genetic background of VTE was brought by the achievements of the genome-wide association studies which analyze the association of a huge number of polymorphisms in large sample size.Hereditary thrombophilia testing should be done only in selected cases. The detection of hereditary thrombophilia has impact on the management of the anticoagulation in children with purpura fulminans, pregnant women at risk of VTE and may be useful in the assessment of the risk for recurrent thrombosis in patients presenting an episode of VTE at a young age (<40 years) and in cases with positive family history regarding thrombosis.

Venous thromboembolism is uncommon after knee arthroscopy, and there are no guidelines for thromboprophylaxis in elective routine knee arthroscopy. Preoperative evaluation of common thrombophilias should provide guidance for postarthroscopy thromboprophylaxis in otherwise healthy patients who are at high risk for venous thromboembolism. This study assessed 10 patients with venous thromboembolism after total hip or knee arthroplasty. Patients were assessed if venous thromboembolism occurred within 6 months after knee arthroscopy (n=10) or total hip or knee arthroplasty (n=21). This study assessed gene mutations (factor V Leiden, prothrombin G20210A, plasminogen activator inhibitor, methylenetetrahydrofolate reductase) and serologic thrombophilias (high levels of factors VIII and XI, homocysteine, anticardiolipin immunoglobulin G and immunoglobulin M antibodies, and lupus anticoagulant; low antigenic protein C, S, and free S; and antithrombin III deficiency). The same coagulation data were obtained for normal subjects (n=110). The major thrombophilias in the arthroscopy group were factor V Leiden heterozygosity (40%), high factor VIII level (50%), and high homocysteine (30%). The respective values in control subjects were 2% (P=.0004), 7% (P=.0011), and 5% (P=.02). When the arthroscopy group was compared with the 21 patients who had venous thromboembolism after total hip or knee arthroplasty, the sole difference was factor V Leiden heterozygosity, which was 40% vs 0%, respectively (P=.007). Although venous thromboembolism after knee arthroscopy is uncommon, to identify high-risk patients and guide postoperative thromboprophylaxis, the authors suggest routine preoperative measurement of 3 common familial thrombophilias: factor V Leiden, factor VIII, and homocysteine. [Orthopedics. 2016; 39(6):e1052-e1057.]., (Copyright 2016, SLACK Incorporated.)

Background: Heparin fulfills its anticoagulant action through activation of antithrombin (AT), and thus thrombosis secondary to AT deficiency can be associated with heparin resistance., Observation: A 12-year-old girl with severe venous thrombosis was referred to us because of undetectable anti-Xa levels despite low-molecular-weight heparin therapy. Laboratory investigations revealed a homozygous AT mutation in the heparin binding site (AT Budapest III). She was subsequently treated with rivaroxaban successfully., Conclusions: Heparin resistance warrants evaluation for AT deficiency. Rivaroxaban may be considered a valid anticoagulant alternative to low-molecular-weight heparin in these patients.

A 22-year-old male was admitted to our hospital with deep vein thrombosis that was complicated by antithrombin deficiency. This deficiency was refractory to anticoagulation therapy. Although catheter-directed thrombolysis could not reperfuse the total occlusion in the left deep vein, a combination of thrombectomy, catheter-directed thrombolysis, and antithrombin concentrate treatment was able to dissolve the clots and ameliorate the blood flow into the left deep vein. Antithrombin concentrate administration would be effective in the treatment of antithrombin deficiency with medical refractory deep vein thrombosis.

Objective: To review insights gained in the past several years about hereditary antithrombin (AT) deficiency and to outline approaches to the management of patients with AT deficiency in the acute and chronic settings., Data Sources: An extensive literature search of Scopus (January 2008-April 2016) was performed for the terms congenital antithrombin deficiency, inherited antithrombin deficiency, or hereditary antithrombin deficiency Additional references were identified by reviewing literature citations., Study Selection: All relevant English-language case reports, reviews, clinical studies, meeting abstracts, and book chapters assessing hereditary AT deficiency were included., Data Synthesis: AT deficiency significantly increases the risk of venous thromboembolism (VTE). The risk of VTE is particularly high during pregnancy, the postpartum period, and following major surgery. Effective clinical management includes determination of the appropriate type and duration of antithrombotic therapy (ie, AT replacement for acute situations) while minimizing the risk of bleeding. For persons newly diagnosed with AT deficiency, age, lifestyle, concurrent medical conditions, family history, and personal treatment preferences can be used to individualize patient management. Patients should be informed of the risks associated with hormonal therapy, pregnancy, surgical procedures, and immobility, which further increase the risk of VTE in patients with AT deficiency., Conclusion: AT deficiency poses the highest risk for VTE among the hereditary thrombophilias, often requiring long-term anticoagulation. Undertaking an evaluation for hereditary thrombophilia is controversial; however, a diagnosis of VTE in association with AT deficiency can have management implications. An important treatment option for patients with this disorder in high-risk situations is AT concentrate., (© The Author(s) 2016.)