Search

We report an investigation into analogues of the thrombin binding aptamer (TBA). Individual thymidines were replaced by the unusual residue 5-hydroxymethyl-2'-deoxyuridine (hmU). This differs from the canonical thymidine by a hydroxyl group on the 5-methyl group. NMR and CD data clearly indicate that all TBA derivatives retain the ability to fold into the "chair-like" quadruplex structure. The presence of the hmU residue does not significantly affect the thermal stability of the modified aptamers compared to the parent, except for analogue H9, which showed a marked increase in melting temperature. Although all TBA analogues showed decreased affinities to thrombin, H3, H7, and H9 proved to have improved anticoagulant activities. Our data open up the possibility to enhance TBA biological properties, simply by introducing small chemical modifications., (© 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

Trans-resveratrol, a polyphenol extracted from Vitis vinifera, has different beneficial effects following its administration on the skin. Here the potential use of binary systems to enhance in vitro and in vivo activity of trans-resveratrol was investigated. Thus the aqueous solubility of trans-resveratrol was investigated in the presence of growing concentrations of polyethylene glycol (PEG) or β-cyclodextrin (βCD) as solubilizing excipients. Then, the solid dispersion of trans-resveratrol with PEG or inclusion complexes trans-resveratrol/βCD were prepared and characterised by different methods. Cytotoxicity and inhibition of reactive oxygen species (ROS) following H2O2 challenge in the presence of trans-resveratrol, alone or associated to the excipients, was evaluated on human keratinocyte HaCaT cell line. Both the trans-resveratrol-containing binary systems induced significant reduction of H2O2-induced ROS production, especially in the case of βCD that was selected for the following phase of the study. Thus, the effect of a cream containing trans-resveratrol, alone or associated to βCD, on different skin parameters such as corneometry, colorimetry and elastometry, was evaluated on human volunteers. All patients showed a visible improvement of clinical conditions with a remarkable decrease of aging signs, but this effect was higher of the hemi face treated with the βCD-containing formulation versus formulation containing trans-resveratrol alone.

Herein, we report optically pure modified acyclic nucleosides as ideal probes for aptamer modification. These new monomers offer unique advantages in exploring the role played in thrombin inhibition by a single residue modification at key positions of the TBA structure.

In this study, a sterile and biocompatible chitosan (CHI) gel for wound healing applications was formulated. CHI powder was treated in autoclave (ttCHI) to prepare sterile formulations. The heat treatment modified the CHI molecular weight, as evidenced by GPC analysis, and its physical-chemical features. Differential scanning calorimetry studies indicated that the macromolecules, before and after thermal treatment, differ in the strength of water-polymer interaction leading to different viscoelastic and flow properties. Thermally treated CHI exhibited the following effects: (i) increased the proliferation and migration of human foreskin foetal fibroblasts at 24 h; (ii) accelerated wound healing (measured as area of lesion) at 3 and 10 days in an in vivo model of pressure ulcers. These effects were linked to the increase of the hydroxyproline and haemoglobin content as well as Wnt protein expression. Moreover, we found a reduction of myeloperoxidase activity and TNF-α mRNA expression. These observations suggest the potential of this novel CHI gel in wound healing and other therapeutic applications.

In a previous work we have demonstrated that the DNA sequence CGGTGGT folds into a higher order G-quadruplex structure (2Q), obtained by the 5'-5' stacking of two unusual G(:C):G(:C):G(:C):G(:C) planar octads belonging to two identical tetra-stranded parallel quadruplexes, when annealed in the presence of ammonium or potassium ions. In the present paper, we discuss the role played by the title nucleosides X and Y (where X and Y stand for A, C, G, or T) on the formation and stability of 2Q structures formed by the XGGYGGT oligodeoxynucleotides. We found that the above mentioned dimerization pathway is not peculiar to the CGGTGGT sequence, but is possible for all the remaining CGGYGGT sequences (with Y = A, C, or G). Furthermore, we have found that the TGGAGGT sequence, despite the absence of the 5'-ending C, is also capable of forming a 2Q-like higher order quadruplex by using a slightly different dimerization interface, as characterized by NMR spectroscopy. To the best of our knowledge, this is the first characterization of a quadruplex multimer formed by an oligodeoxynucleotide presenting a thymine at its 5'-end. Examples of such structures were observed previously only in crystals and in the presence of non-physiological cations. Our results expand the repertoire of DNA quadruplex nanostructures of chosen length and add further complexity to the structural polymorphism of G-rich DNA sequences., (Copyright © 2013 Elsevier Masson SAS. All rights reserved.)

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions., (© 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

The idea of this study was to combine hyaluronic acid (HA) viscosupplementation and a local/controlled delivery of a hydrophobic anti-inflammatory drug. To this aim, we investigated the ability of an octenyl succinic anhydride (OSA) modified HA (OSA-HA), to act as a solubility enhancer and as a platform for slow release of hydrophobic drug(s). This novel HA derivative could act as a viscosupplementation agent and, for this reason, a rheological study was conducted along with calorimetric analysis. Differential scanning calorimetry (DSC) results revealed that the ability of HA to sequester water is enhanced by the introduction of lipophilic functions within HA molecules, resulting in a decrease of the fraction of free water able to freeze compared to the unmodified HA. Moreover, OSA-HA solutions appear to be an appropriate tool to be used in viscosupplementation therapy owing to their suitable viscoelastic features. Our results indicate that OSA-HA is able to self-assemble into micelles, load a hydrophobic drug and release the active molecule with controlled kinetics. In particular, the analysis of release profiles showed that, in all cases, drug diffusion into the gel is faster compared to gel/drug dissolution, being the dissolution contribution more relevant as the OSA-HA concentration increases., (Copyright © 2013 Elsevier Ltd. All rights reserved.)

Polymer chain entanglements in organic solvents can be considered a key parameter in the formation of non-spherical beads when electrospraying is employed. The shape of micro/nanometric drug delivery systems plays a major role since it can affect circulation, extravasation, distribution and in vivo clearance of the devices. In this frame, we investigated the influence of polymer processing parameters on the design of polylactic-co-glycolic acid non-spherical microdevices loaded with triamcinolone acetonide (TrA), a sparingly water soluble corticosteroid, prepared by electrospraying technique through a one-step process. In particular, we verified that the formation of non-spherical MDs is related to the presence of entanglements among polymer chains to select the optimal solution to be sprayed. The addition of TrA did not substantially affect the particle morphology in terms of size, size distribution and circularity at all the tested drug loadings. Furthermore, the drug could be released for a prolonged period, with controlled and reproducible kinetics for over 3 weeks. The mathematical modeling of release profiles highlighted that the release is mainly driven by degradation, at a higher extent in the case of low drug loading.

In this article, we report an investigation, based on NMR and CD spectroscopic and electrophoretic techniques, of 5'TGGGGT3' analogues containing two or three 3'-3' or 5'-5' inversion sites in the G-run, namely 5'TG3'-3'G5'-5'GGT3' (Q350), 5'TG3'-3'GG5'-5'GT3' (Q305), 5'TGG3'-3'G5'-5'GT3' (Q035), 5'TG3'-3'G5'-5'G3'-3'GT5' (Q353) and 3'TG5'-5'G3'-3'G5'-5'GT3' (Q535). Although the sequences investigated contain either no or only one natural 3'-5' linkage in the G-tract, all modified oligodeoxyribonucleotides (ODNs) have been shown to form stable tetramolecular quadruplex structures. The ability of the 3'-3' or 5'-5' inversion sites to affect the glycosidic conformation of guanosines and, consequently, base stacking, has also been investigated. The results of this study allow us to propose some generalizations concerning strand arrangements and the glycosidic conformational preference of residues adjacent to inverted polarity sites. These rules could be of general interest in the design of modified quadruplex structures, in view of their application as G-wires and modified aptamers.

Computational techniques, and in particular molecular dynamics (MD) simulations, have been successfully used as a complementary technique to predict and analyse the structural behaviour of nucleic acids, including peptide nucleic acid- (PNA-) RNA hybrids. This study shows that a 7-base long PNA complementary to the seed region of miR-509-3p, one of the miRNAs involved in the posttranscriptional regulation of the CFTR disease-gene of Cystic Fibrosis, and bearing suitable functionalization at its N- and C-ends aimed at improving its resistance to nucleases and cellular uptake, is able to revert the expression of the luciferase gene containing the 3'UTR of the gene in A549 human lung cancer cells, in agreement with the MD results that pointed at the formation of a stable RNA/PNA heteroduplex notwithstanding the short sequence of the latter. The here reported results widen the interest towards the use of small PNAs as effective anti-miRNA agents.

Investigations of heterochiral oligodeoxynucleotides 5'-TD1GD2GD3-3'-3'-GL3GL2TL1-5' (L33) and 3'-TD1GD2GD3-5'-5'-GL3GL2TL1-3' (L55) forming quadruplex structures are reported. Data indicate the presence of enantiomeric left- and right-handed quadruplex helices. In the case of L55, NMR experiments point to an unusual equilibrium between them.

Regular screening methods may miss the diagnosis of occult hepatitis B infection and seronegative hepatitis C virus infection in immunocompromised patients. A cross-sectional study within a Spanish cohort of HIV-infected children yielded 6 of 254 (2.4%) possible occult hepatitis B infection cases and 2 of 254 (0.8%) seronegative hepatitis C virus-infected patients. Implementation of occult hepatitis screening in the routine care of these children may be warranted.

Inspired by the multiple roles cyclodextrins can play in polymeric systems, here we engineered poly(ethylene oxide) (PEO) films with (2-hydroxypropyl)-β-cyclodextrin (CD) as multipurpose ingredient. To shed light on the potential of CD in formulating PEO buccal films for the delivery of poorly water-soluble drugs, we preliminarily assessed thermal and mechanical properties as well as wettability of films prepared at different PEO/CD ratios. PEO/CD platform containing 54% by weight of CD was chosen as the optimized composition since it matched acceptable mechanical properties, in terms of tensile strength and elasticity, with a good wettability. The platform was tested as buccal delivery system for triamcinolone acetonide (TrA), a lipophilic synthetic corticosteroid sparely water soluble. Confocal Raman imaging clearly showed that CD was homogeneously (i.e. molecularly) dispersed in PEO. Nevertheless, homogenous drug distribution in the film without TrA crystallization occurred only in the presence of CD. Finally, CD-containing PEO film placed in simulated buccal fluids provided a useful speed-up of TrA release rate while showing slower dissolution as compared to PEO film. These results, as well as compliance with quality specifications of pharmaceutical manufacturing products, strongly support the soundness of the strategy and prompt toward further applications of PEO/CD films in buccal drug delivery., (Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.)

The antiviral activity of certain acyclic nucleosides drew our attention to the fact that the replacement of the furanose ring by an alkyl group bearing hydroxyl(s) could be a useful structural modification to modulate the biological properties of those nucleosides. Herein, we report on the synthesis of some novel acadesine analogues, where the ribose moiety is mimicked by a D-ribityl or by a hydroxybutyl chain.

Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores.

The trans-resveratrol (t-res), a non-flavonoid polyphenol extracted from different plants, has recently earned interest for application on the skin for different applications. In this work, the potential of nanocarriers, namely transfersomes and ethanol-containing vesicles, to deliver t-res into/through the skin was investigated. Thus, transfersomes with different surfactants, namely polysorbate 80 (Tw80), sodium cholate (SC) and sodium deossicholate (SDC) and ethanol-containing vesicles with different lipid composition, namely soy phosphatidylcholine (SPC) and cholesterol (chol), encapsulating t-res were prepared and characterized. The nanocarriers had a mean diameter ranging between 83 and 116 nm with a high t-res encapsulation efficiency (≥ 70%). Moreover, cytotoxicity as well as the inhibition of production of reactive oxygen species (ROS) and lipid peroxidation, following incubation of H(2)O(2)-stimulated human keratinocyte (HaCaT) with t-res, as free or encapsulated into the nanocarriers, were investigated. Only blank nanocarriers containing Tw80 or ethanol were cytotoxic and led to increase of ROS, but this effect was not observed when using nanocarriers encapsulating t-res. Finally, permeation studies on porcine skin carried out on Franz diffusion cells, showed that only ethanol-containing vesicles based SPC were able to promote t-res permeation through the skin., (Copyright © 2012 Elsevier B.V. All rights reserved.)

An acyclic pyrimidine analogue, containing a five-member cycle fused on the pyrimidine ring, was synthesized and introduced at position 7 or 12 of the 15-mer oligodeoxynucleotide GGTTGGTGTGGTTGG, known as thrombin-binding aptamer (TBA). Characterization by 1H NMR and CD spectroscopies of the resulting aptamers, TBA-T7b and TBA-T12b, showed their ability to fold into the typical antiparallel chairlike G-quadruplex structure formed by TBA. The apparent CD melting temperatures indicated that the introduction of the acyclic residue, mainly at position 7, improves the thermal stability of resulting G-quadruplexes with respect to TBA. The anticoagulant activity of the new molecules was then valued in PT assay, and it resulted that TBA-T7b is more potent than TBA in prolonging clotting time. On the other hand, in purified fibrinogen assay the thrombin inhibitory activity of both modified sequences was lower than that of TBA using human enzyme, whereas the potency trend was again reversed using bovine enzyme. Obtained structure-activity relationships were investigated by structural and computational studies. Taken together, these results reveal the active role of TBA residues T7 and T12 and the relevance of some amino acids located in the anion binding exosite I of the protein in aptamer-thrombin interaction.

The substitution of a hydroxyl group by a fluorine atom in a potential drug is an efficient reaction that can, in principle, improve its pharmacological properties. Herein, the synthesis of the novel compound 5'-fluoro-5'-deoxyacadesine (5'-F-AICAR), a strict analogue of AICAR that cannot be 5'-phosphorylated to ZMP by cellular kinases, is reported.

Several anti-HIV aptamers adopt DNA quadruplex structures. Among these, "Hotoda's aptamer" (base sequence TGGGAG) was one of the first to be discovered. Although it has been the topic of some recent research, no detailed structural investigations have been reported. Here we report structural investigations on this aptamer and analogues with related sequences, by using UV, CD, and NMR spectroscopy as well as electrophoretic techniques. The addition of a 3'-end thymine has allowed us to obtain a single, investigable quadruplex structure. Data clearly point to the presence of an A-tetrad. Furthermore, the effects of the incorporation of an 8-methyl-2'-deoxyguanosine at the 5'-end of the G-run were investigated., (Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.)

This communication reports on the synthesis and biophysical, biological and SAR studies of a small library of new anti-HIV aptamers based on the tetra-end-linked G-quadruplex structure. The new aptamers showed EC(50) values against HIV-1 in the range of 0.04-0.15 μM as well as affinities for the HIV-1 gp120 envelope in the same order of magnitude.

A small collection of ring-expanded nucleosides (RENs), containing the unprecedented bis-alkylated imidazo[4,5-d][1,2,6]oxadiazepine heterocyclic ring system, has been synthesized through a new general approach. Results of preliminary cytotoxicity tests on breast (MCF-7) and lung (A549) cancer cell lines are also reported.

Objective: According to the concept of adipose tissue expandability, the vascular complications of obesity are related less to the amount of stored fat than to the low-grade inflammation that excess fat storage may elicit. We tested this concept in 7-year-old children by assessing whether carotid intima-media thickness (cIMT) is related to obesity measures or to circulating highly sensitive C-reactive protein (hsCRP), as a marker of low-grade inflammation., Study Design: The study group comprised 135 asymptomatic Caucasian children (72 girls and 63 boys; mean age, 7.1±1.1 years) with normal height and weight distributions. Relationships were assessed among cIMT, hsCRP, obesity measures (ie, body mass index [BMI], total fat by bioelectric impedance, and visceral fat by ultrasound), insulin resistance (by the homeostasis model assessment for insulin resistance), and fasting serum lipid levels., Results: cIMT was correlated with hsCRP, but not with BMI or body fat; the regression coefficients between cIMT and hsCRP (adjusted for age, sex, BMI, body fat, and serum lipid levels) were fairly similar across all BMI categories (β=0.370-0.411; all P<.001 to<.0001). Serum hsCRP increased with increasing BMI, total fat, and visceral fat (all P<.001)., Conclusion: At age 7 years, cIMT is already associated with low-grade inflammation, as measured by hsCRP, but not with BMI or body fat. These findings imply that public health strategies aimed at early prevention of cardiovascular disease may need to target low-grade inflammation rather than only BMI or adiposity., (Copyright © 2012 Mosby, Inc. All rights reserved.)

In this article, we report a structural study, based on NMR and CD spectroscopies, and molecular modelling of all possible d(TG(3)T) and d(TG(4)T) analogues containing two 8-methyl-2'-deoxyguanosine residues (M). Particularly, the potential ability of these modified residues to orientate the strands and then to affect the folding topology of tetramolecular quadruplex structures has been investigated. Oligodeoxynucleotides (ODNs) TMMGT (T12) and TMMGGT (F12) form parallel tetramolecular quadruplexes, characterized by an all-syn M-tetrad at the 5'-side stacked to all-anti M- and G-tetrads. ODNs TMGMT (T13) and TMGGMT (F14) form parallel tetramolecular quadruplexes, in which an all-anti G core is sandwiched between two all-syn M-tetrads at the 5'- and the 3'-side. Notably, the quadruplex formed by T13 corresponds to an unprecedented structure in which the syn residues exceed in number the anti ones. Conversely, ODN TGMGMT (F24) adopts a parallel arrangement in which all-anti G-tetrads alternate with all-syn M-tetrads. Most importantly, all data strongly suggest that ODN TMGMGT (F13) forms an unprecedented anti-parallel tetramolecular quadruplex in which G and M residues adopt anti and syn glycosidic conformations, respectively. This article opens up new understandings and perspectives about the intricate relationship between the quadruplex strands orientation and the glycosidic conformation of the residues.

Introduction: The objective of this systematic review is to determine if the treatment of streptococcal pharyngitis with a daily dose of amoxicillin is similar in effectiveness to other dosing schedules (every 6, 8 or 12 hours) of the same antibiotic or penicillin V., Material and Methods: Randomised clinical trials (RCT) comparing amoxicillin (one dose per day) compared to other dosages of amoxicillin (every 8-12 hours) or penicillin V (every 6, 8 or 12 hours). Search databases consulted: Medline, Central, EMBASE and Google Scholar. The results were combined using the risk difference (RD). We measured the effectiveness of each treatment with a negative throat culture on the 14-21th day, being previously positive to group A Streptococcus (under a non-inferiority hypothesis, where the upper limit of the 95% confidence interval [95% CI] of the DR does not exceed 10%) and clinical failure on days 10-21. The results were combined according to a fixed effects model or random depending on whether or not there was heterogeneity., Results: Four RCT met the selection criteria with 1,314 participants (657 received amoxicillin once per day, and 657 received other antibiotics or dosages): a) any positive culture for Streptococcus (14-21st day, 4 RCTs): DR: -0.5% (95% CI: -5.1% to 4.2%; b) persistence of the same serotype (14-21st day, 3 RCT): DR: 0.32% (95% CI: -3.1% to 3.7%; c) clinical failure (2 RCT): DR: 1.7% (95% CI: -1.9% to 5.4%; d) adverse effects (4 RCT): DR: -0.39% (95% CI: -1.5% to 6.8%). There were no statistically significant differences in any comparisons., Conclusions: Amoxicillin, administered once daily is not inferior to other dosages of the same antibiotic or penicillin V. These results are important because they may facilitate compliance., (Copyright © 2010 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.)

The solid-phase synthesis of the first example of a new diphosphate AICAR derivative is reported. The new substance is characterized by the presence of a 5'-phosphate group while a second phosphate moiety is installed on a 5-hydroxypentyl chain attached to the 4-N-position of AICAR. Cyclization of the diphosphate derivative by pyrophosphate bond formation allowed for the formation of a novel AICAR-based cyclic ADP-ribose (cADPR) mimic.

In this work, we establish the use of surface-enhanced Raman scattering (SERS) as a label-free analytical technique for the direct detection of G-quadruplex formation. In particular, we demonstrate that SERS analysis allows the evaluation of the relative stability of G quadruplexes that differ for the number of G tetrads and investigate several structural features of quadruplexes, such as the orientation of glycosidic bonds, the identification of distortions in the sugar-phosphate backbone, and the degree of hydrogen-bond solvation. Herein, the fluctuation of the SERS spectra, due to the specific interaction of vibrational modes with the SERS-active substrate, is quantitatively analyzed before and after quadruplex formation. The results of this study suggest a perpendicular orientation of the quadruplexes (with or without the 3'-tetra end linker) with respect to the silver colloidal surface, which opens new perspectives for the use of SERS as a label-free analytical tool for the study of the binding mode between quadruplexes and their ligands.

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K(+) or NH(4)(+) ions, through the 5'-5' stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads.

The growing amount of literature about G-quadruplex DNA clearly demonstrates that such a structure is no longer viewed as just a biophysical strangeness but it is instead being considered as an important target for the treatment of various human disorders such as cancers or venous thrombosis. In this scenario, with the aim of finding brand new molecular scaffolds able to interact with the groove of the DNA quadruplex [d(TGGGGT)](4), we recently performed a successful structure-based virtual screening (VS) campaign. As a result, six molecules were found to be somehow groove binders. Herein, we report the results of novel NMR titration experiments of these VS-derived ligands with modified quadruplexes, namely [d(TGG(Br)GGT)](4) and [d(TGGGG(Br)T)](4). The novel NMR spectroscopy experiments combined with molecular modelling studies, allow for a more detailed picture of the interaction between each binder and the quadruplex DNA. Noteworthy, isothermal titration calorimetry (ITC) measurements on the above-mentioned compounds revealed that 2, 4, and 6 besides their relatively small dimensions bind the DNA quadruplex [d(TGGGGT)](4) with higher affinity than distamycin A, to the best of our knowledge, the most potent groove binder identified thus far., (Copyright © 2011 Elsevier Masson SAS. All rights reserved.)

Previous studies indicate that some perylene bisimide derivatives can drive the assembly of DNA G-quadruplexes, thus suggesting the possible advantage in the adoption of perylene-conjugated G-rich oligonucleotides in biological and biotechnological applications. Nevertheless, the typical poor solubility of perylene bisimides strongly limits the number of suitable chemical strategies to prepare perylene-conjugated oligonucleotides. In order to overcome these difficulties, we employed the earlier described core twisted perylene derivatives possessing unique optical and electronic properties, besides good solubility in common solvents. As a first result, the large-scale synthesis of a new dibromoperylene derivative (PEOEBr) phosphoramidite building block is herein reported. Furthermore, the structural behavior of the conjugated PEOEBr-GGGTTAGGG (HTRp2) human telomeric repeat was investigated by using CD, UV, fluorescence, and gel electrophoresis techniques in desalted water and in K(+)- and Na(+)-containing buffers. We observed that the peculiar property of PEOEBr moieties to form dimers instead of extended aggregates drives the HTRp2 strands toward dimerization and mainly promotes the formation of quadruplex species having both the 5'-ends located at the same side of the structures. However, the counterions present in solutions (K(+) or Na(+)) as well as the strand concentration, also contribute to influence the topology and the stoichiometry of formed structures. Furthermore, unlike the unmodified sequence GGGTTAGGG (HTR2), HTRp2 strands quickly associate into G-quadruplexes even in desalted water, as assessed by CD experiments.

CD and NMR studies on heterochiral oligodeoxynucleotides (d/l-ODNs) forming quadruplex structures are reported. Heterochiral ODNs, based on sequence TGGGGT, are able to form stable either right- or left-handed quadruplexes depending on d/l ratio and residues position. Results suggest that the 3'-end and the core of the G-run are more important than the 5'-end in determining the quadruplex handness. Particularly, oligonucleotide T(D)G(D)G(L)G(L)G(D)T(D) (L34) at low temperatures forms a well-defined left-handed quadruplex, notwithstanding it is mostly composed by natural d residues. This structure is characterized by three all-anti G-tetrads and one all-syn G-tetrad., (Copyright © 2011 Elsevier Masson SAS. All rights reserved.)

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

Introduction: The aim of this systematic review is to assess whether antibacterial agents are more effective than either placebo or no intervention at all in the treatment of acute bacterial sinusitis., Patients and Methods: We reviewed the databases and search engines: PubMed, EMBASE, Cochrane Central Register of Controlled Trials and Google Scholar to identify randomized clinical trials (RCTs) in children comparing antibiotics versus placebo. Sinusitis was considered as the persistence of clinically compatible symptoms for at least 10 days. The methodological quality was assessed using the Jadad scale. Four RCTs were selected. We studied the following variables: cure, clinical improvement (on days 10 to 14), relapse-recurrence (from day 14 to day 60) and presence of adverse effects. The results were combined using meta-analysis. We used the fixed effects model or random model depending on whether or not there was heterogeneity. We estimated the combined relative risk (RR) and 95% confidence interval., Results: Only two RCTs had a Jadad scale score ≥3. Variable cure-improvement (4 RCTs): RR 1.11 (95% CI: 0.9 to 1.3). Variable relapse-recurrence (3 RCTs): RR 0.9 (95% CI: 0.6 to 1.5). Adverse effects (4 RCTs): 2.01 (95% CI 1.1 to 3.8)., Conclusions: In children with acute sinusitis, antibacterial agents at the studied doses did not appear to provide benefit in terms of cure and improvement, assessed at 10 to 14 days of follow up. Similarly, the percentage of relapse-recurrence was not lower among children who received antibiotics. Antibiotics are associated more frequently with adverse effects., (Copyright © 2010 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.)

Poloxamer thermoresponsive gels are widely explored in controlled drug delivery. Nevertheless, these gels possess inadequate mechanical properties, poor bioadhesiveness, and high permeability to water. To overcome these issues, we blended mucoadhesive hyaluronic acid (HA) with poloxamer analogs. This study aimed to investigate the features affecting the microscopic properties of the gels, which determine their macroscopic properties and capability to control/sustain protein release. Results showed that HA hampers water-poloxamer interactions, thus, strongly influencing physicochemical properties of poloxamer gels. This leads to gels with improved mechanical properties in which the diffusion kinetics of macromolecular active molecules are drastically slowed down. Poloxamer-HA gels can sustain the delivery of proteins, such as insulin, and may allow the modulation of its release kinetics by modifying HA content within the gels in the administration sites in which the active molecule release mechanism is mainly governed by its diffusion.

The biophysical and biological properties of unprecedented anti-HIV aptamers are presented. The most active aptamer (1L) shows a significant affinity to the HIV protein gp120.

Guanine-rich nucleic acid sequences can adopt G-quadruplex structures stabilized by layers of four Hoogsteen-paired guanine residues. Quadruplex-prone sequences are found in many regions of human genome and in the telomeres of all eukaryotic organisms. Since small molecules that target G-quadruplexes have been found to be effective telomerase inhibitors, the identification of new specific ligands for G-quadruplexes is emerging as a promising approach to develop new anticancer drugs. Distamycin A is known to bind to AT-rich sequences of duplex DNA, but it has recently been shown to interact also with G-quadruplexes. Here, isothermal titration calorimetry (ITC) and NMR techniques have been employed to characterize the interaction between a dicationic derivative of distamycin A (compound 1) and the [d(TGGGGT)](4) quadruplex. Additionally, to compare the binding behaviour of netropsin and compound 1 to the same target, a calometric study of the interaction between netropsin and [d(TGGGGT)](4) has been performed. Experiments show that netropsin and compound 1 are able to bind to [d(TGGGGT)](4) with good affinity and comparable thermodynamic profiles. In both cases the interactions are entropically driven processes with a small favourable enthalpic contribution. Interestingly, the structural modifications of compound 1 decrease the affinity of the ligand toward the duplex, enhancing the selectivity.

The study of DNA G-quadruplex stabilizers has enjoyed a great momentum in the late years due to their application as anticancer agents. The recognition of the grooves of these structural motifs is expected to result in a higher degree of selectivity over other DNA structures. Therefore, to achieve an enhanced knowledge on the structural and conformational requisites for quadruplex groove recognition, distamycin A, the only compound for which a pure groove binding has been proven, has been chemically modified. Surprisingly, structural and thermodynamic studies revealed that the absence of Coulombic interactions results in an unprecedented binding position in which both the groove and the 3' end of the DNA are occupied. This further contribution adds another piece to the so far elusive puzzle of the recognition between ligands and DNA quadruplexes and will serve as a platform for a rational design of new groove binders.

Abasic sites represent the most frequent lesion in DNA. Since several events generating abasic sites concern guanines, this damage is particularly important in quadruplex forming G-rich sequences, many of which are believed to be involved in several biological roles. However, the effects of abasic sites in sequences forming quadruplexes have been poorly studied. Here, we investigated the effects of abasic site mimics on structural, thermodynamic and kinetic properties of parallel quadruplexes. Investigation concerned five oligodeoxynucleotides based on the sequence d(TGGGGGT), in which all guanines have been replaced, one at a time, by an abasic site mimic (dS). All sequences preserve their ability to form quadruplexes; however, both spectroscopic and kinetic experiments point to sequence-dependent different effects on the structural flexibility and stability. Sequences d(TSGGGGT) and d(TGGGGST) form quite stable quadruplexes; however, for the other sequences, the introduction of the dS in proximity of the 3'-end decreases the stability more considerably than the 5'-end. Noteworthy, sequence d(TGSGGGT) forms a quadruplex where dS does not hamper the stacking between the G-tetrads adjacent to it. These results strongly argue for the central role of apurinic/apyrimidinic site damages and they encourage the production of further studies to better delineate the consequences of their presence in the biological relevant regions of the genome.

An amphiphilic hyaluronic acid (HA) derivative has been obtained by the amidation of the carboxylic group of the glucuronic acid. This derivative, HYADD4-G (HY4), is the hexadecylamide of 500-730 kDa hyaluronic acid, derived from Streptococcus equi at about 2% degree of substitution (2 mol hexadecylamine per 100 mol hexuronic acid). Its viscoelastic properties, at a concentration of 5 mg/mL in phosphate buffer saline, have been compared with those solutions of native HA, having the same molecular weight. Changes in the viscoelastic properties of equine synovial fluid (SF) when mixed with HY4 over a series of volume ratios-viz 1:2, 1:1, 3:1, and 7:1-have been evaluated. HY4 is able to associate into aqueous solution, and its rheological behavior is typical of a weak gel. Throughout the frequency range investigated (0.1-10 Hz), the elastic modulus G' is higher than the viscous modulus G'', and both moduli are frequency independent, and G' value is about two orders of magnitude higher than that of a comparable solution of native HA. The addition of HY4 to equine synovial fluid (SF) increased its viscoelasticity at all the SF:HY4 ratios tested. These results demonstrate that HY4 is able to integrate with SF, increasing the synovial fluid rheology, and could be an interesting new option in viscosupplement therapy of osteoarthritis, particularly considering its low degree of chemical modification from native HA., ((c) 2009 Wiley Periodicals, Inc.)

This paper investigates the variation between null and overt subject pronouns in Catalan, a null subject language. We account for this variation in game-theoretical terms: that is, we analyze the distribution of both overt and null pronouns as a result of the strategic interaction between participants in a communicative exchange.First, we examine the Position of Antecedent Hypothesis (PAH), as put forward by Carminati (2002). This hypothesis proposes that null and overt pronouns have different biases: null pronouns prefer antecedents in subject positions, while overt pronouns prefer antecedents in non-subject positions. Carminati (2002) tested the PAH for Italian in a variety of intrasentential contexts. In this paper, we show experimentally that the PAH also holds for Catalan even in across-sentence contexts. In the second place, we also show how the PAH can be naturally redefined as a game of partial information, in which speaker and hearer are trying to communicate. This redefinition does not just translate the PAH into a different notation, but it extends the PAH into a model that makes more accurate predictions, since it can account also for the cases in which the biases predicted by the PAH are not obeyed.

In the past decade, DNA G-quadruplexes have come into the limelight thanks to their biological implications and to their potential druggability in anticancer therapy. In particular, it has been found that small molecules that stabilize G-quadruplex structures are effective inhibitors of telomerase which plays a critical role in tumorigenesis. So far, the quadruplex groove recognition, which is expected to give a higher degree of selectivity over the other DNA structures, has been demonstrated for very few compounds. Thus with the aim of detecting new and structurally diverse groove binders, a structure-based virtual screening campaign has been performed using the X-ray structure of the [d(TGGGGT)](4) quadruplex. Remarkable results were achieved, and six brand new different molecular entities have been found to interact with the groove through NMR experiments. The reported results will certainly stimulate further studies aimed at the design and optimization of new quadruplex-specific groove binders to be applied as anticancer agents and for other diseases.

G-quadruplexes are characteristic structural arrangements of guanine-rich DNA sequences that abound in regions with relevant biological significance. These structures are highly polymorphic differing in the number and polarity of the strands, loop composition, and conformation. Furthermore, the cation species present in solution strongly influence the topology of the G-quadruplexes. Recently, we reported the synthesis and structural studies of new G-quadruplex forming oligodeoxynucleotides (ODNs) in which the 3'- and/or the 5'-ends of four ODN strands are linked together by a non-nucleotidic tetra-end-linker (TEL). These TEL-ODN analogs having the sequence TGGGGT are able to form parallel G-quadruplexes characterized by a remarkable high thermal stability. We report here an investigation about the influence of the reduction of the TEL size on the molecularity, topology, and stability of the resulting TEL-G-quadruplexes using a combination of circular dichroism (CD), CD melting, (1)H NMR spectroscopy, gel electrophoresis, and molecular modeling data. We found that all TEL-(TGGGGT)(4) analogs, regardless the TEL size and the structural orientation of the ODN branches, formed parallel TEL-G-quadruplexes. The molecular modeling studies appear to be consistent with the experimental CD and NMR data revealing that the G-quadruplexes formed by TEL-ODNs having the longer TEL (L1-4) are more stable than the corresponding G-quadruplexes having the shorter TEL (S1-4). The relative stability of S1-4 was also reported. (c) 2009 Wiley Periodicals, Inc. Biopolymers 91: 466-477, 2009.

Insight into the influence of inversion of polarity sites on the structural features of quadruplex structures is presented. The NMR and CD studies concern modified oligodeoxynucleotides (ODNs) based on the quadruplex forming sequence TGGGT. The presence of inversion of polarity sites not only does not compromise the formation of quadruplexes, but in some cases it increases the thermal stability of modified complexes compared with that of the unmodified one.

The influence of hyaluronic acid (HA) on the gelation properties of poloxamers blends has been studied with the aim of engineering thermosensitive and mucoadhesive polymeric platforms for drug delivery. The gelation temperature (T(gel)), viscoelastic properties and mucoadhesive force of the systems were investigated and optimised by means of rheological analyses. Poloxamers micellar diameter was evaluated by photon correlation spectroscopy (PCS). Moreover in order to explore the feasibility of these platforms for drug delivery, the optimised systems were loaded with acyclovir and its release properties studied in vitro. By formulating poloxamers/HA platforms, at specific concentrations, it was possible to obtain a thermoreversible gel with a T(gel) close to body temperature. The addition of HA did not hamper the self assembling process of poloxamers just delaying the gelation temperature of few Celsius degrees. Furthermore, HA presence led to a strong increase of the poloxamer rheological properties thus indicating possible HA interactions with micelles through secondary bonds, such as hydrogen ones, which reinforce the gel structure. These interactions could also explain PCS results which show, in systems containing HA, aggregates with hydrodynamic diameters much higher than those of poloxamer micelles. Mucoadhesion experiments showed a rheological synergism between poloxamers/HA gels and mucin dispersion which led to a change of the flow behaviour from a quite Newtonian one of the separate solutions to a pseudoplastic one of their mixture. In vitro release experiments indicated that the optimised platform was able to prolong and control acyclovir release for more than 6h.

A new modified acyclic nucleoside, namely N(1)-(3-hydroxy-2-hydroxymethyl-2-methylpropyl)-thymidine, was synthesized and transformed into a building block useful for oligonucleotide (ON) automated synthesis. A series of modified thrombin binding aptamers (TBAs) in which the new acyclic nucleoside replaces, one at the time, the thymidine residues were then synthesized and characterized by UV, CD, MS, and (1)H NMR. The biological activity of the resulting TBAs was tested by Prothrombin Time assay (PT assay) and by purified fibrinogen clotting assay. From a structural point of view, nearly all the new TBA analogues show a similar behavior as the unmodified counterpart, being able to fold into a bimolecular or monomolecular quadruplex structure depending on the nature of monovalent cations (sodium or potassium) coordinated in the quadruplex core. From the comparison of structural and biological data, some important structure-activity relationships emerged, particularly when the modification involved the TT loops. In agreement with previous studies we found that the folding ability of TBA analogues is more affected by modifications involving positions 4 and 13, rather than positions 3 and 12. On the other hand, the highest anti-thrombin activities were detected for aptamers containing the modification at T13 or T12 positions, thus indicating that the effects produced by the introduction of the acyclic nucleoside on the biological activity are not tightly connected with structure stabilities. It is noteworthy that the modification at T7 produces an ON being more stable and active than the natural TBA.

The use of small molecules that bind and stabilize G-quadruplex structures is emerging as a promising way to inhibit telomerase activity in tumor cells. In this paper, isothermal titration calorimetry (ITC) and 1H NMR studies have been conducted to examine the binding of distamycin A and its two carbamoyl derivatives (compounds 1 and 2) to the target [d(TGGGGT)]4 and d[AG3(T2AG3)3] quadruplexes from the Tetrahymena and human telomeres, respectively. The interactions were examined using two different buffered solutions containing either K+ or Na+ at a fixed ionic strength, to evaluate any influence of the ions present in solution on the binding behaviour. Experiments reveal that distamycin A and compound 1 bind the investigated quadruplexes in both solution conditions; conversely, compound 2 appears to have a poor affinity in any case. Moreover, these studies indicate that the presence of different cations in solution affects the stoichiometry and thermodynamics of the interactions.

Structural insight into DNA quadruplex structures formed by oligodeoxyribonucleotides 3'TG5'-5'GGGT3' (QS55) and 5'TG3'-3'GGGT5' (QS33) is presented. NMR analysis reveals that QS33 forms a parallel-like four-fold symmetric quadruplex, while QS55 possesses a two-fold symmetry and is characterized by a tetrameric antiparallel quadruplex embedded between two parallel tracts. The results reported here describe unprecedented quadruplex complexes provided by peculiar structural features never reported to date. These structures might inspire the design of new aptameric nucleic acids characterized by novel structural motifs hardly realizable with unmodified DNA/RNA.

Herein we report an efficient solid-phase synthesis of some N-1-alkyl-substituted analogs of cyclic inosine-diphosphate-ribose (cIDPR), a mimic of cyclic ADP-ribose (cADPR) which has been described as an agonist of the cADPR/Ca(2+) signalling system. The proposed synthetic strategy uses a polystyrene support bearing inosine by a 2',3'-acetal linkage which is converted into several N-1-alkylinosine-bis-phosphate derivatives which in turn were cyclized by a solid-phase pyrophosphate bond formation.

In this work we investigated the interaction between the short ac(4)a C-rich peptide nucleic acid (PNA) probe and two intramolecular G-quadruplex targets having the same G-tetrad core, but different folding topologies. The T(G(4)T)(3)G(4)T and the recently reported tetra-end-linked-(TG(4)T)(4) G-rich oligonucleotides (GROs) were chosen and synthesized for this study. UV, CD, and MS experiments revealed the formation of novel 1:1 G-quadruplex-PNA complexes besides the expected DNA-PNA heteroduplexes.