Search

Publisher Summary The fact that usually only one mutation is identified per gene and the fact that once a phenotype has been identified, the arduous task of genetic mapping, positional cloning, and gene validation must be undertaken before the gene underlying a particular mutant trait is identified, have motivated the development of alternative gene-based mutagenesis strategies utilizing totipotent mouse embryonic stem (ES) cells. ES cells can be grown in large numbers, they are amenable to a variety of genome modifications, and can contribute to the germ-line to allow for functional assessment of the genetic perturbation in the whole organism. The ability to create, characterize, and maintain mutations in cell culture presents an attractive alternative to expand the current mouse mutant collection. Gene targeting and gene-trap-based insertional mutagenesis are two widely adopted techniques for generating mouse mutants using ES cells. In both cases, severe loss-of-function mutations often arise because of gross disruption of the genomic locus. On the contrary, alkylating agents, such as N-ethyl-N-nitrosourea (ENU), mainly cause single base substitutions. This chapter discusses the technical details of a gene-based screen in chemically mutagenized ES cells for generating allelic series of mutations in genes of interest.

Previous experiments have indicated that zidovudine is cytotoxic to early murine embryos both in vivo and in vitro. Newer nucleoside analogs (ddI, ddC, and d4T) with antiretroviral activity were tested to determine whether they had similar toxicity. Exposure of two-cell embryos to each of these three drugs inhibited blastocyst formation only at concentrations > or = to 100 microM. Sublethal preblastocyst exposure to d4T resulted in failure to develop beyond the blastocyst stage at 10 microM; no effect was seen with ddC or ddI at concentrations up to 100 microM. In each instance, however, cytotoxicity of all three drugs was significantly less than with zidovudine at equivalent concentration. These experiments suggest that newer antiretroviral nucleosides may be safer to use in early pregnancy than zidovudine.

Using selectable genes as proof of principle, a new high-throughput genotype-based mutation screen in mouse embryonic stem (ES) cells was developed [Chen et al. (2002) Nat. Genet. 24, 314-317]. If expanded to nonselectable genes, this approach would allow one to proceed quickly from sequence to whole-animal phenotypes. Here data are presented showing that a screen of a cryopreserved library of clonal, germ line competent, N-ethyl-N-nitrosurea (ENU) mutagenized ES cells can identify a large series of allelic mutations in Smad2 and Smad4, two nonselectable genes of the transforming growth factor beta superfamily of signaling molecules. Whole animal phenotypic analyses of some of these alleles provided evidence for novel developmental processes mediated by these components of transforming growth factor beta signaling, demonstrating the utility of non-null alleles created by chemical mutagens. The accurately assessed mutation load of the ES cell library indicates that it is a valuable resource for developing mouse lines for genetic and functional studies. This methodology can conceptually be applied for the generation of an allelic series of subtle mutations at any locus of interest in the mouse.

Mouse embryos homozygous for the allele eed(l7Rn5-3354SB) of the Polycomb Group gene embryonic ectoderm development (eed) display a gastrulation defect in which epiblast cells move through the streak and form extraembryonic mesoderm derivatives at the expense of development of the embryo proper. Here we demonstrate that homozygous mutant ES cells have the capacity to differentiate embryonic cell types both in vitro as embryoid bodies and in vivo as chimeric embryos. In chimeric embryos, eed mutant cells can respond to wild-type signals and participate in normal gastrulation movements. These results indicate a non-cell-autonomous function for eed. Evidence of mutant cell exclusion from the forebrain and segregation within somites, however, suggests that eed has cell-autonomous roles in aspects of organogenesis. A requirement for eed in the epiblast during embryonic development is supported by the fact that high-contribution chimeras could not be rescued by a wild-type extraembryonic environment.

Sorting nexins 1 (Snx1) and 2 (Snx2) are homologues of the yeast gene VPS5 that is required for proper endosome-to-Golgi trafficking. The prevailing thought is that Vps5p is a component of a retrograde trafficking complex called the retromer. Genetic and biochemical evidence suggest mammals may have similar complexes, but their biological role is unknown. Furthermore, if SNX1 and SNX2 belong to such complexes, it is not known whether they act together or separately. Herein, we show that mice lacking SNX1 or SNX2 are viable and fertile, whereas embryos deficient in both proteins arrest at midgestation. These results demonstrate that SNX1 and SNX2 have a highly redundant and necessary function in the mouse. The phenotype ofSnx1-/-;Snx2-/-embryos is very similar to that of embryos lacking another retromer homologue, Hβ58. This finding suggests that SNX1/SNX2 and Hβ58 function in the same genetic pathway, providing additional evidence for the existence of mammalian complexes that are structurally similar to the yeast retromer. Furthermore, the viability ofSnx1-/-andSnx2-/-mice demonstrates that it is not necessary for SNX1 and SNX2 to act together. Electron microscopy indicates morphological alterations of apical intracellular compartments in theSnx1-/-;Snx2-/-yolk-sac visceral endoderm, suggesting SNX1 and SNX2 may be required for proper cellular trafficking. However, tetraploid aggregation experiments suggest that yolk sac defects cannot fully account forSnx1-/-; Snx2-/-embryonic lethality. Furthermore, endocytosis of transferrin and low-density lipoprotein is unaffected in mutant primary embryonic fibroblasts, indicating that SNX1 and SNX2 are not essential for endocytosis in all cells. Although the two proteins demonstrate functional redundancy,Snx1+/-;Snx2-/-mice display abnormalities not observed inSnx1-/-;Snx2+/-mice, revealing that SNX1 and SNX2, or their genetic regulation, are not equivalent. Significantly, these studies represent the first mutations in the mammalian sorting nexin gene family and indicate that sorting nexins perform essential functions in mammals.

The mouse Polycomb-group gene, embryonic ectoderm development (eed), appears to regulate cellular growth and differentiation in a developmental and tissue specific manner. During embryogenesis, eed regulates axial patterning, whereas in the adult eed represses proliferation of myeloid and B cell precursors. The present report demonstrates two novel functional activities of eed: alteration of thymocyte maturation and suppression of thymic lymphoma development. Mice that inherit the viable hypomorphic 17Rn5(1989SB) eed allele sustain a partial developmental block at or before the CD4(-)CD8(-)CD44(-)CD25(+) stage of thymocyte differentiation. Furthermore, mice that are homozygous or heterozygous for the hypomorphic eed allele have an increased incidence and decreased latency of N-methyl-N-nitrosourea-induced thymic lymphoma compared to wild-type littermates. These findings support the notion that Polycomb-group genes exert pleiotropic effects dictated by developmental stage and cellular context.

Mammalian SWI/SNF complexes utilize either brahma (Brm) or brahma-related gene 1 (Brg1) catalytic subunits to remodel nucleosomes in an ATP-dependent manner. Brm was previously shown to be dispensable, suggesting that Brm and Brg1 are functionally redundant. To test this hypothesis, we have generated a Brg1 null mutation by gene targeting, and, surprisingly, homozygotes die during the periimplantation stage. Furthermore, blastocyst outgrowth studies indicate that neither the inner cell mass nor trophectoderm survives. However, experiments with other cell types demonstrate that Brg1 is not a general cell survival factor. In addition, Brg1 heterozygotes are predisposed to exencephaly and tumors. These results provide evidence that biochemically similar chromatin-remodeling complexes have dramatically different functions during mammalian development.

This study presents the annotated genomic sequence and exon-intron organization of the human and mouse epidermal growth factor receptor (EGFR) genes located on chromosomes 7p11.2 and 11, respectively. We report that the EGFR gene spans nearly 200 kb and that the full-length 170-kDa EGFR is encoded by 28 exons. In addition, we have identified two human and two mouse alternative EGFR transcripts of 2.4-3.0 kb using both computational and experimental methods. The human 3.0-kb and mouse 2.8-kb EGFR mRNAs are predominantly expressed in placenta and liver, respectively, and both transcripts encode 110-kDa truncated receptor isoforms containing only the extracellular ligand-binding domain. We also have demonstrated that the aberrant 2.8-kb EGFR transcript produced by the human A431 carcinoma cell line is generated by splicing to a recombinant 3'-terminal exon located in EGFR intron 16, which apparently was formed as a result of a chromosomal translocation. Finally, we have shown that the human, mouse, rat, and chicken 1.8- to 3.0-kb alternative EGFR transcripts are generated by distinct splicing mechanisms and that each of these mRNAs contains unique 3' sequences that are not evolutionarily conserved. The presence of truncated receptor isoforms in diverse species suggests that these proteins may have important functional roles in regulating EGFR activity.

Atrioventricular and semilunar valve abnormalities are common birth defects, but how cardiac valvulogenesis is directed remains largely unknown. During studies of genetic interaction between Egfr, encoding the epidermal growth factor receptor, and Ptpn11, encoding the protein-tyrosine-phosphatase Shp2, we discovered that Egfr is required for semilunar, but not atrioventricular, valve development. Although unnoticed in earlier studies, mice homozygous for the hypomorphic Egfr allele waved-2 (Egfrwa2/wa2) exhibit semilunar valve enlargement resulting from over-abundant mesenchymal cells. Egfr-/- mice (CD1 background) have similar defects. The penetrance and severity of the defects in Egfrwa2/wa2 mice are enhanced by heterozygosity for a targeted mutation of exon 2 of Ptpn11 (ref. 3). Compound (Egfrwa2/wa2:Ptpn11+/-) mutant mice also show premature lethality. Electrocardiography, echocardiography and haemodynamic analyses showed that affected mice develop aortic stenosis and regurgitation. Our results identify the Egfr and Shp2 as components of a growth-factor signalling pathway required specifically for semilunar valvulogenesis, support the hypothesis that Shp2 is required for Egfr signalling in vivo, and provide an animal model for aortic valve disease.

Gene targeting has provided considerable insight into the functions of numerous genes since it was developed a decade ago (1-4). A listing of the diversity of targeted genes and breadth of mutant phenotypes characterized to date can be obtained through mouse mutation databases (http://www.bis.med. jhmi.edu/Dan/tbase.html and http://biomednet.com/cgi-bin/ mko/mkohome.pl) (5, 6). However, in order to take full advantage of this technology, classical genetic methods should be utilized to extend our knowledge of individual genes to genetic pathways. In this chapter, the significance of genetics in gene targeting and phenotype interpretation are discussed. We describe how Mendelian and quantitative genetics can be exploited to map modifier loci or generate animals carrying mutations in two or more genes. We also discuss the development and application of classical genetic approaches towards elucidating gene function such as generation of allelic series and creation of deletion complexes throughout the genome in ES cells and mice. Several genetic considerations should be taken into account during the initial stages of a gene targeting experiment. In order to maximize homologous recombination efficiency, both arms of a targeting vector should be isolated from the same strain of mice as that of the ES cells (see Chapter 1 for details). Although most ES cell lines have been isolated from 129 strains of mice, significant genetic variation exists among the different substrains, which is sometimes evident by pronounced differences in coat colour (see Chapter 4, Table 1) (7, 8). For instance, 129/Sv mice (Aw/Aw, +c-Tyr +p/+c-Tyr +p ) have a white-bellied agouti (Aw) phenotype, whereas 129/SvJ mice (Aw/Aw, Tyrc p/T yrc-ch p) have a cream colour owing to the effect of mutant tyrosinase (Tyr) and pink-eyed dilution (p) alleles which are epistatic to Aw (9). Molecular analysis of different 129 substrains using microsatellite markers has provided insight into their genetic differences and revealed that 129/SvJ is particularly divergent and actually contaminated with genomic regions of non-129 origin (7, 8). Before the significance of this heterogeneity was appreciated, many targeting vectors were constructed from 129/SvJ DNA for use in 129/Sv ES cell lines.

We have characterized an induced mutation, called embryonic ectoderm development or eed, that disrupts A-P patterning of the mouse embryo during gastrulation. Positional cloning of this gene revealed it to be the highly conserved homologue of the Drosophila gene extra sex combs, which is required for maintenance of long-term transcriptional repression of homeotic gene expression. Mouse embryos homozygous for loss-of-function alleles of eed initiate gastrulation but display abnormal mesoderm production. Very little embryonic mesoderm is produced; in contrast, extraembryonic mesoderm is relatively abundant. These observations, along with mRNA in situ hybridization analyses, suggested a defect in the anterior primitive streak, from which much of the embryonic mesoderm of the wild-type embryo is derived. To analyse this defect, we initiated clonal analysis of the pre-streak epiblast in eed mutant embryos, using the lineage tracer horseradish peroxidase (HRP). The results of these studies indicate that epiblast cells ingress through the anterior streak, but the newly formed mesoderm does not migrate anteriorly and is mislocalized to the extraembryonic compartment. Abnormal localization of mesoderm to the extraembryonic region did not appear to be due to a restriction and alteration of distal epiblast cell fate, since the majority of clones produced from regions fated to ingress through the anterior streak were mixed, displaying descendants in both embryonic and extraembryonic derivatives. eed mutant embryos also fail to display proper epiblast expansion, particularly with respect to the A-P axis. Based on patterns of clonal spread and calculated clone doubling times for the epiblast, this does not appear to be due to decreased epiblast growth. Rather, epiblast, which is normally fated to make a substantial contribution to the axial midline, appears to make mesoderm preferentially. The data are discussed in terms of global morphogenetic movements in the mouse gastrula and a disruption of signalling activity in the anterior primitive streak.

Lumican, a prototypic leucine-rich proteoglycan with keratan sulfate side chains, is a major component of the cornea, dermal, and muscle connective tissues. Mice homozygous for a null mutation in lumican display skin laxity and fragility resembling certain types of Ehlers-Danlos syndrome. In addition, the mutant mice develop bilateral corneal opacification. The underlying connective tissue defect in the homozygous mutants is deregulated growth of collagen fibrils with a significant proportion of abnormally thick collagen fibrils in the skin and cornea as indicated by transmission electron microscopy. A highly organized and regularly spaced collagen fibril matrix typical of the normal cornea is also missing in these mutant mice. This study establishes a crucial role for lumican in the regulation of collagen assembly into fibrils in various connective tissues. Most importantly, these results provide a definitive link between a necessity for lumican in the development of a highly organized collagenous matrix and corneal transparency.

Deletion complexes consisting of multiple chromosomal deletions induced at single loci can provide a means for functional analysis of regions spanning several centimorgans in model genetic systems. A strategy to identify and map deletions at any cloned locus in the mouse is described here. First, a highly polymorphic, germ-line competent F 1(129/Sv-+ Tyr + p × CAST/Ei) mouse embryonic stem cell line was established. Then, x-ray and UV-induced mutagenesis was performed to determine the feasibility of generating deletion complexes throughout the mouse genome. Reported here are the selection protocols, induced mutation frequencies, cytogenetic and extensive molecular analysis of mutations at the X-chromosome-linked hypoxanthine phosphoribosyltransferase ( Hprt ) locus and at the neural cell adhesion molecule ( Ncam ) locus located on chromosome 9. Mutation analysis with PCR-based polymorphic microsatellite markers revealed deletions of Hprt locus, whereas results consistent with deletions covering >28 cM were observed at the Ncam locus. Fluorescence in situ hybridization with a chromosome 9 paint revealed that some of the Ncam deletions were accompanied by complex chromosome rearrangements. In addition, deletion mapping in combination with loss of heterozygosity of microsatellite markers revealed a putative haploinsufficient region distal to Ncam . These data indicate that it is feasible to generate x-ray-induced deletion complexes in mouse embryonic stem cells.

The suprachiasmatic nuclei (SCN) express the highly polysialylated form of the neural cell adhesion molecule (NCAM) that has been proposed to promote plasticity in the adult brain. To investigate a role for NCAM in SCN circadian clock function, we examined the daily locomotor rhythm of mice homozygous for a mutation,Ncamtm1Cwr, which results in deletion of the NCAM-180 isoform that in brain carries polysialic acid (PSA). Mutant mice entrained well to a 12 hr light/dark cycle but exhibited a significantly shortened free-running period and longer activity duration under constant darkness (DD) than did wild-type mice. By the third week of DD treatment, circadian rhythmicity in the mutant was abolished. Immunocytochemical analyses of the mutant SCN revealed an abnormal number and distribution of vasoactive intestinal polypeptide-producing neurons, suggesting a developmental effect of the mutant phenotype; however, a direct physiological effect of the mutation on clock function was indicated by the fact that removal of PSA from adult wild-type SCN by microinjection of endoneuraminidase shortened the free-running period to a similar extent as in the mutant. Together, these data indicate critical roles for NCAM and PSA in the development and physiology of the mammalian SCN circadian clock.

The 129 mouse is the most widely used strain in gene targeting experiments. However, numerous substrains exist with demonstrable physiological differences. In this study a set of simple sequence length polymorphisms (SSLPs) was used to determine the relatedness of selected 129 substrains. 129/SvJ was significantly different from the other 129 substrains and is more accurately classified as a recombinant congenic strain (129cX/Sv), being derived from 129/Sv and an unknown strain. This mixed genetic background could complicate gene targeting experiments by reducing homologous recombination efficiency when constructs and ES cells are not derived from the same 129 substrain. Additionally, discrepancies due to different genetic backgrounds may arise when comparing phenotypes of genes targeted in different 129-derived ES cell lines.

In recent years, molecular genetic studies of plant development, particularly flower development, have uncovered a number of homeotic gene.s 1,2. These genes specify cell fates. Are plant homeotic genes also regulated by the polycomb-trStborax group of genes? A recent Nature paper indicates that the answer is yes, at least for one floral homentic gene.

Background: SWI/SNF chromatin remodeling complexes consist of many subunits that are combined combinatorially to define distinct forms of the remodeling complex. The AT-rich DNA binding domain containing subunits, ARID1A and ARID2 are two such defining subunits of the BAF and PBAF forms of SWI/SNF. The ARID subunits are highly mutated in a wide variety of cancers, with mutations being particularly common in hepatocellular carcinoma. ARID1A and ARID2 mutations are mutually exclusive, and the pattern of mutations in these subunits suggest they function as tumor suppressors in the same pathway. However, the precise mechanism of action, the transcriptional programs these subunits control, and the interaction between different forms of the SWI/SNF complex remain unknown. Approach: We explored the effect of ARID1A and ARID2 on the transcriptome using RNAseq following knockdown of each complex in a hepatocellular carcinoma cell line. These data sets were integrated with public ChIP-seq data from the same cell line to identify the functional modules in which ARID1A and ARID2 participate. Comparisons between the genes altered in response to loss of ARID1A and ARID2 and the transcriptional regulators associated with these gene sets allowed us to identify several novel factors that functionally interact with SWI/SNF. Results: Knockdown of each subunit primarily led to distinct changes in the transcriptome of the cell at several expected categories, including cell cycle regulators and DNA damage response genes. Surprisingly, a significant number of genes were changed in both conditions, often in opposing directions, suggesting that ARID1A and ARID2 may functionally antagonize one another at particular targets of genes. Gene set enrichment analysis suggested that opposite-regulated genes are enriched for targets of the histone lysine demethylase PHF8. Computational analysis of public ChIP-seq data and co-immunoprecipitation experiments identified PHF8 as a direct interacting partner of the SWI/SNF complex. These results suggest that distinct forms of SWI/SNF control separate transcriptional programs. In cases where a gene changes in both knockdown condtions, different forms of the complex often act in opposition to one another. Future examination of the areas of cooperativity and competition between ARID1A and ARID2 will shed light on their role in chromatin state in the liver and hepatocellular carcinoma. Comparison of transcriptional changes after removal of a complex member to public chromatin regulator binding profiles can provide novel insight into the different interactions and the mechanisms of regulation coordinated by distinct forms of the SWI/SNF complex. This abstract is also presented as Poster A40. Citation Format: Jesse Raab, Terry Magnuson. Comparison of the gene regulatory programs controlled by the mutually exclusive SWI/SNF subunits ARID1A and ARID2. [abstract]. In: Proceedings of the AACR Special Conference on Chromatin and Epigenetics in Cancer; Jun 19-22, 2013; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2013;73(13 Suppl):Abstract nr PR13.

Transmission ratio distortion (TRD) associated with mouse t haplotypes causes +/t males to transmit the t-bearing chromosome to nearly all their offspring. Of the several genes involved in this phenomenon, the t complex responder (Tcrt) locus is absolutely essential for TRD to occur. A candidate Tcrt gene called Tcpl0bt was previously cloned from the genetically defined Tcrt region. Its location, restricted expression in testis, and a unique postmeiotic alternative splicing pattern supported the idea that Tcp10bt was Tcrt. To test this hypothesis in a functional assay, ES cells were derived from a viable partial t haplotype, and the Tcp10bt gene was mutated by homologous recombination. Mutant mice were mated to appropriate partial t haplotypes to determine whether the targeted chromosome exhibited transmission ratios characteristic of the responder. The results demonstrated that the targeted chromosome retained full responder activity. Hence, Tcp10bt does not appear to be Tcrt. These and other observations necessitate a reevaluation of genetic mapping data and the actual nature of the responder.

Anterior-posterior (A-P) patterning is of fundamental importance throughout vertebrate embryonic development. Murine members of the trithorax (trx) and Polycomb group (Pc-G) of genes regulate A-P patterning of segmented axial structures, demonstrating conserved upstream regulation of homeotic pathways between Drosophila and mouse. Here we report the positional cloning of a classical mouse mutation, eed (for embryonic ectoderm development), which is the highly conserved homologue of the Drosophila Pc-G gene esc (for extra sex combs), a long-term repressor of homeotic genes. Mutants homozygous for a null allele of eed display disrupted A-P patterning of the primitive streak during gastrulation. Mutant embryos lack a node, notochord and somites, and there is no neural induction. In contrast to absence of anterior structures, extra-embryonic mesoderm is abundant. Mice carrying a hypomorphic eed mutation exhibit posterior transformations along the axial skeleton. These results indicate that eed is required globally for A-P patterning throughout embryogenesis.

The neural cell adhesion molecule (NCAM) is a membrane-associated member of the immunoglobulin superfamily capable of both homophilic and heterophilic binding. To investigate the significance of this binding, a gene targeting strategy in embryonic stem (ES) cells was used to replace the membrane-associated forms of NCAM with a soluble, secreted form of its extracellular domain. Although the heterozygous mutant ES cells were able to generate low coat color chimeric mice, only the wild-type allele was transmitted, suggesting the possibility of dominant lethality. Analysis of chimeric embryos with high level of ES cell contribution revealed severe growth retardation and morphological defects by E8.5-E9.5. The second allele was also targeted, and embryos derived almost entirely from the homozygous mutant ES cells exhibited the same lethal phenotype as observed with heterozygous chimeras. Together, these results indicate that dominant lethality associated with the secreted NCAM does not require the presence of membrane-associated NCAM. Furthermore, the data indicate that potent bioactive cues or signals can be generated by NCAM.

The present investigation examined the differential expression of the full-length (fl) and the truncated (tr) forms of the epidermal growth factor receptor (EGFr) in the preimplantation mouse uterus and blastocyst. Northern blot hybridization using a complementary RNA probe specific to the full-length form (EGFr-fl) detected a 6.5-kb transcript, whereas that of the truncated form (EGFr-tr) detected a 2.7-kb transcript in the preimplantation mouse uterus on days 1 and 4 of pregnancy (day 1 = vaginal plug). In situ hybridization using these probes detected the EGFr-fl transcripts only in the stroma and myometrium, but not in the epithelium, whereas EGFr-tr transcripts were detected in all major uterine cell-types. To confirm the results of in situ hybridization, RT-PCR was performed on RNA isolated from separated uterine cell-types on day 4 of pregnancy using sequence specific primers for the two forms of the receptor. The results concur that the EGFr-tr transcript is expressed in the epithelium, stroma and myometrium, whereas that of the EGFr-fl transcript is not expressed in the epithelium. In the preimplantation blastocyst, RT-PCR detected the EGFr-fl messenger RNA, but not the EGFr-tr messenger RNA. These results suggest that the blastocyst, not the uterine epithelium, is the target for EGF family of growth factors in embryo-uterine interaction during implantation.

The expression of an oncogenic rasHa gene in epidermal keratinocytes stimulates the tyrosine phosphorylation of protein kinase C delta and inhibits its enzymatic activity (Denning, M. F., Dlugosz, A. A., Howett, M. K., and Yuspa, S. H. (1993) J. Biol. Chem. 268, 26079-26081). Keratinocytes expressing an activated rasHa gene secrete transforming growth factor alpha (TGFalpha) and have an altered response to differentiation signals involving protein kinase C (PKC). Because the neoplastic phenotype of v-rasHa expressing keratinocytes can be partially mimicked in vitro by chronic treatment with TGF alpha and the G protein activator aluminum fluoride (AlF4-), we determined if TGF alpha or AlF4- could induce tyrosine phosphorylation of PKCdelta. Treatment of primary keratinocyte cultures for 4 days with TGFalpha induced tyrosine phosphorylation of PKCdelta, whereas AlF4- only slightly stimulated PKCdelta tyrosine phosphorylation. The PKCdelta that was tyrosine-phosphorylated in response to TGFalpha had reduced activity compared with the nontyrosine-phosphorylated PKCdelta. Treatment of keratinocytes expressing a normal epidermal growth factor receptor (EGFR) with TGFalpha or epidermal growth factor for 5 min induced PKCdelta tyrosine phosphorylation. This acute epidermal growth factor treatment did not induce tyrosine phosphorylation of PKCdelta in keratinocytes isolated from waved-2 mice that have a defective epidermal growth factor receptor. In addition, the level of PKCdelta tyrosine phosphorylation in v-rasHa-transduced keratinocytes from EGFR null mice was substantially lower than in v-rasHa transduced wild type cells, suggesting that activation of the EGFR is important for PKC delta tyrosine phosphorylation in ras transformation. However, purified EGFR did not phosphorylate recombinant PKC delta in vitro, whereas members of the Src family (c-Src, c-Fyn) and membrane preparations from keratinocytes did. Furthermore, clearing c-Src or c-Fyn from keratinocyte membrane lysates decreased PKCdelta tyrosine phosphorylation, and c-Src and c-Fyn isolated from keratinocytes treated with TGFalpha had increased kinase activity. Acute or chronic treatment with TGFalpha did not induce significant PKCdelta translocation in contrast to the phorbol ester 12-O-tetradecanoylphorbol-13-acetate, which induced both translocation and tyrosine phosphorylation of PKCdelta. This suggests that TGFalpha-induced tyrosine phosphorylation of PKC delta results from the activation of a tyrosine kinase rather than physical association of PKCdelta with a membrane-anchored tyrosine kinase. Taken together, these results indicate that PKCdelta activity is inhibited by tyrosine phosphorylation in response to EGFR-mediated signaling and activation of a member of the Src kinase family may be the proximal tyrosine kinase acting on PKCdelta in keratinocytes.

A murine transgene, HRD, is methylated only when carried in certain inbred strain backgrounds. A locus on distal chromosome 4, Ssm1 (strain-specific modifier), controls this phenomenon. In order to characterize the activity of Ssm1, we have investigated developmental acquisition of methylation over the transgene. Analysis of postimplantation embryos revealed that strain-specific methylation is initiated prior to embryonic day (E) 6.5. Strain-specific transgene methylation is all-or-none in pattern and occurs exclusively in the primitive ectoderm lineage. A strain-independent pattern of partial methylation occurs in the primitive endoderm and trophectoderm lineages. To examine earlier stages, embryonic stem (ES) cells were derived from E3.5 blastocysts and examined for transgene methylation before and after differentiation. Though the transgene had already acquired some methylation in undifferentiated ES cells, differentiation induced further, de novo methylation in a strain-dependent manner. Analysis of methylation in ES cultures suggests that the transgene and endogenous genes (such as immunoglobulin genes) are synchronously methylated during early development. These results are interpreted in the context of a model in which Ssm1-like modifier genes produce alterations in chromatin structure during and/or shortly after implantation, thereby marking target loci for de novo methylation with the rest of the genome during gastrulation.

Gene targeting was used to create a null allele at the epidermal growth factor receptor locus (Egfr). The phenotype was dependent on genetic background. EGFR deficiency on a CF-1 background resulted in peri-implantation death due to degeneration of the inner cell mass. On a 129/Sv background, homozygous mutants died at mid-gestation due to placental defects; on a CD-1 background, the mutants lived for up to 3 weeks and showed abnormalities in skin, kidney, brain, liver, and gastrointestinal tract. The multiple abnormalities associated with EGFR deficiency indicate that the receptor is involved in a wide range of cellular activities.

In the mouse, the embryonic ectoderm development (eed) region is defined by deletions encompassing the albino (c) locus of chromosome 7. The region is located 1-2 cM distal to the c locus and was of undetermined size. Embryos homozygous for deletions removing eed display defects in axial organization during gastrulation. Two loci, identified by chemical mutagenesis, are known to map within the eed interval. One, l7Rn5 , probably represents the gene required for gastrulation. The second, l7Rn6, is required for survival after birth. fit1, a third locus identified by chemical mutagenesis, maps distal to the eed interval and is also required for survival after birth. A 900-kb YAC contig has been constructed, and deletion breakpoints defining the limits of the regions containing these loci have been localized. Their positions place the eed region within a maximum 150-kb interval at the proximal end of the contig, while fit1 maps to a 360-kb interval within the middle of the contig. Several clusters of rare-cutting restriction sites map within these regions and represent potential locations of candidate genes.

Lumican, a member of the small interstitial proteoglycan gene (SIPG) family, is a keratan sulfate proteoglycan present in large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle (Hassell et al. 1993), skin (Chakravarti et al. submitted), and intervertebral discs (B. Johnstone, personal communication). Like decorin, another SIPG member, lumican also interacts with collagen and limits growth of fibrils in diameter (Rada et al. 1993; Scott 1988). In the cornea, lumican not only interacts with collagen molecules to limit fibril growth, but by virtue of its keratan sulfate-containing glycosaminoglycan side chains plays a crucial role in the regular spacing of fibrils and acquisition of corneal transparency (Scott 1991). The primary structure of lumican, derived from cDNA sequencing of chicken, bovine, and human clones, shows all the characteristic features of the SIPG family, namely, four and two cysteines in the Nand C-terminal globular domains, I and III, and a central, cysteine-free domain l_I, with 9 ~ sheet-forming leucine motifs (Blochberger et al. 1992; Funderburgh et al. 1993; Chakravarti et al. submitted). In the human, lumican localizes to Chromosome (Chr) 12q21.3-22 (Chakravarti et al. submitted). We report localization of the mouse lumican gene to distal Chr 10 by segregation analysis of restriction fragment length variants (RFLV) in recombinant inbred (RI) strains of mice. This study further extends the conservation of synteny between human Chr 12q21.3-22 and distal mouse Chr 10. We used a lumican coding sequence, PCR amplified from a mouse lumican genomic clone in Southern analyses for chromosome localization. Mouse genomic clones for lumican were obtained by screening a 129/Sv genomic DNA library (Stratagene) with a human lumican cDNA probe. The mouse lumican coding sequence was amplified from one of these genomic clones, with oligonucleotide primers that amplify nucleotides 263-681 from human lumican cDNA. PCR amplification yielded a product of expected size (primer pairs, upper 5'AGTGTACCAATGGTGCCTCCTG3' and lower 5 'CAGTCTGGCTATCTGATTGAAGCTC3'; PCR conditions: hold at 94~ 5 rain, cycle program 94~ 1 rain, 50~ anneal, extend at 72~ The nucleotide sequence of this PCR product (data not shown) yielded the derived amino acid sequence of 108 amino acids from the highly conserved central domain II of lumican sharing 96% identity with bovine, 93% identity with human, and 77% identity with chicken at the amino acid level (Funderburgh et al. 1993; Chakravarti et al. submitted; Blochberger et al. 1992). The mouse coding sequence was used to identify lumican

C l lDSD is an X-ray-induced deletion generated at the Oak Ridge National Laboratory (Russell et al. 1979) that spans ~3 cM (Sharan et al. 1991) of mouse Chromosome (Chr) 7 including the c (albino) locus. The c11DSD-deletion breakpoint fusion fragment was cloned from a C3H/101 background (Sharan et al. 1991). Clones from a wild-type 129/SV phage genomic library (Stratagene) corresponding to the proximal and distal breakpoints of the deletion were isolated. The cHDSD-breakpoint fusion fragment and wildtype clones were sequenced and compared. The purpose was to determine whether any flanking rearrangements and/or sequence motifs were associated with the fusion site. Sequence flanking the cllDSD-breakpoint fusion was aligned with the wild-type proximal and distal sequences (Fig. 1). Homology between the C l lDSD and proximal wildtype sequence ends at the fusion site, after which homology between the distal wild-type and c 11DsD sequences begins (Fig. 1). The exact fusion site could not be determined because of a two-base overlap marked by the box in Fig. 1. A single base mismatch was present in both homologous proximal and distal sequences, and these are probably the result of polymorphism between strains. No significant sequence homology was found between the proximal and distal sides of the fusion. A BLASTN (Altschul et al. 1990) search showed the proximal side to be ~80% homologous to rat (Bilofsky and Burks 1988) and mouse (Shehee et al. 1987) long interspersed elements (LINEs), whereas the distal side showed no homology matches. This breakpoint fusion sequence in context with two other sequenced radiation-induced breakpoint fusions, pCp (Nakatsuet al. 1993) and Aa2 (Strobel et al. 1990), illustrates the precise nature with which induced double-strand breaks can be joined.

Mesoderm induction is fundamental for establishing the basic body plan of the vertebrate embryo and mutations are critical for dissecting this process. Mouse embryos lacking msd (mesoderm deficiency) do not produce mesoderm but have well-defined extraembryonic and thickened embryonic ectoderm. Distribution of transcripts indicate that temporal regulation of gene expression relevant to gastrulation has begun but primitive-streak formation and mesoderm induction are blocked. Both msd-deficient embryos and embryonic stem (ES) cells fail to form highly differentiated structures of mesoderm origin, but are capable of ectodermal differentiation. Thus, the effects of the msd mutation are restricted to mesoderm formation and could result from the inability to respond to an inducing signal.

It previously has been demonstrated that zidovudine (AZT) is lethal to early murine embryos. The effect of the drug on pre- and postimplantation embryos was examined to delineate the timing of this toxicity and to investigate its possible mechanisms. Embryos exposed in the whole mouse during preblastocyst development were unable to proceed beyond the blastocyst stage. Similarly, when two-cell embryos harvested from unexposed females were exposed to low-concentration (1 microM) AZT in vitro over 24 h, development beyond the blastocyst stage was inhibited. In contrast, drug exposure during in vitro blastocyst and postblastocyst development resulted in little or no morphologic toxicity. Further investigation revealed that preblastocyst AZT exposure resulted in the development of blastocysts with significantly lower cell numbers than control embryos. While embryonic exposure to AZT at the blastocyst and postblastocyst stages also resulted in retarded cell division, the effects were milder than those recorded after preblastocyst exposure. These data demonstrate that the critical period of AZT toxicity toward murine embryos is between ovulation and implantation and indicate that AZT directly suppresses cell division in the preimplantation embryo.

In the past, understanding of the process of gastrulation in the mouse has primarily been based on morphological analyses. Recently, a number of molecules have been implicated in mesoderm induction and axis formation in Xenopus, and several of these exhibit unique patterns of expression during mouse gastrulation. These gene-expression data, together with fate mapping, ectopic expression experiments and mutational analysis, will now facilitate studies on the functional aspects of gastrulation in the mouse.

Mutations are important for defining and dissecting complex pathways of normal development and for relating biological function to protein structure. Most of the known mutations in mouse have occurred spontaneously and were identified because of visible phenotypic effects associated with the mutated gene in the heterozygous state. More recently, an intense effort has been under way to induce random or site-directed germ-line mutations. For example, the specific-locus method has been used to generate mutations in localized regions of the genome (1). Irradiated animals are mated to a test stock homozygous for a number of visible markers. The resulting array of mutations, many of which are deletions, are detected because of visible phenotypes produced in F1 offspring. The deletions are useful for studying the marker locus as well as the surrounding chromosomal region. The dilute-short ear-deletion complex of chromosome 9 (2, 3) and the albino-deletion complex of chromosome 7 (4–7) represent two examples of this approach.

Six essential genes located near the mouse albino locus have been identified as required during specific periods of development. Amongst these six, each is required either during the preimplantation stages of development, at specific times during gastrulation, within 12 hrs after birth or during juvenile development. These genes were identified as a result of extensive genetic complementation analysis using embryos homozygous for the albino deletions. Although, in principal, the associated developmental abnormalities could result from loss of multiple genes, the deletion phenotype in one case is identical to that induced by chemical mutagenesis. These results indicate that the abnormalities observed in deletion homozygotes may result from single gene loss. The deletions have proven useful not only as genetic tools to localize the position of the genes, but also as molecular entry points to the regions containing these genes. The current methodology being used to isolate candidate genes from the albino region is also reviewed here.

The albino-deletion complex in the mouse defines a genetically well-characterized region of chromosome 7 in which a number of loci essential for normal development and viability reside. One locus, designated alf or hsdr-1, is necessary for neonatal survival. Its absence results in hypoglycemia associated with biochemical and ultrastructural abnormalities in hepatocytes and proximal tubule cells of the kidney. We constructed a long-range physical map of the region defined by the proximal segment of the albino-deletion complex as a step toward localizing alf/hsdr-1. Sixteen markers, including 11 whose isolation is described here and in the accompanying paper (A. Schedl et al., 1992, Genomics 14, 288-297), were ordered on a panel of albino-deletion DNAs and their distribution was examined by pulsed-field gel electrophoresis. The resulting approximately 4300-kb physical map covers the entire region absent from the prototypic alf/hsdr-1 deletion c14CoS, estimated as approximately 3600 kb. Since the deletion c11DSD complements and overlaps most of c14CoS, alf/hsdr-1 was mapped at the proximal extreme of c14CoS, approximately 3000 kb from the albino locus. The density of CpG islands was found to be very heterogeneous across the region mapped.

The locus alf/hsdr-1, defined by the albino-deletion complex on mouse chromosome 7, is essential for neonatal survival. Animals homozygous for a subset of the deletions die shortly after birth due to impaired gene expression in liver parenchymal cells and kidney proximal tubular cells. Here, we describe a detailed analysis of the region containing alf/hsdr-1 by means of chromosome jumping from flanking markers. Three chromosome jumping libraries based on the restriction enzymes XmaI and SalI were constructed. Isolation of eight jumping clones distributed over 450 kb allowed more than 240 kb to be cloned in genomic lambda and cosmid libraries. Five of the probes map within the minimal genetic interval for alf/hsdr-1, which is defined by the proximal borders of the deletions c10R75M and c11DSD. The breakpoints of these deletions were precisely mapped, which allowed alf/hsdr-1 to be localized to a 310-kb interval.

The albino-deletion complex consists of more than 37 deletions that remove an area of mouse chromosome 7 including the albino coat-color locus. Previous genetic and embryological studies with five of these deletions (c11DSD, c5FR60Hg, c4FR60Hd, c2YPSj, c6H) defined at least two genes required for normal development of the embryonic and extraembryonic ectoderm of early postimplantation embryos. A molecular genetic analysis of this region has been initiated using palb 18, a genomic clone that defines the D7TM18 locus that maps to a region of chromosome 7 removed by the c11DSD deletion but not by the c5FR60Hg, c4FR60Hd, c2YPSj, or c6H deletions. palb 18 was obtained by chromosomal microdissection and microcloning of the wild-type albino region. A genomic clone isolated with palb 18 contains a repeat sequence localized primarily to the proximal region of the five deletions. The repeat sequence hybridizes differentially to the five deletion DNAs. The patterns of hybridization associated with these DNAs were used to define the order of the proximal breakpoints as centromere-c11DSD-c2YPSj-(c5FR60Hg-c4FR60Hd)-c6H. This order was confirmed by isolation of additional single-copy sequences. The molecular probes described here should allow for identification and isolation of the deletion breakpoints and thus provide immediate access to the distal side of the deletions where the genes affecting the development of the embryonic and extraembryonic ectoderm are located.

The Polycomb group (PcG) proteins are thought to silence gene expression by modifying chromatin. The Polycomb repressive complex 2 (PRC2) plays an essential role in mammalian X-chromosome inactivation (XCI), a model system to investigate heritable gene silencing. In the mouse, two different forms of XCI occur. In the preimplantation embryo, all cells undergo imprinted inactivation of the paternal X-chromosome (Xp). During the peri-implantation period, cells destined to give rise to the embryo proper erase the imprint and randomly inactivate either the maternal X-chromosome or the Xp; extraembryonic cells, on the other hand, maintain imprinted XCI of the Xp. PRC2 proteins are enriched on the inactive-X during early stages of both imprinted and random XCI. It is therefore thought that PRC2 contributes to the initiation of XCI. Mouse embryos lacking the essential PRC2 component EED harbor defects in the maintenance of imprinted XCI in differentiating trophoblast cells. Assessment of PRC2 requirement in the initiation of XCI, however, has been hindered by the presence of maternally derived proteins in the early embryo. Here we show that Eed −/− embryos initiate and maintain random XCI despite lacking any functional EED protein prior to the initiation of random XCI. Thus, despite being enriched on the inactive X-chromosome, PcGs appear to be dispensable for the initiation and maintenance of random XCI. These results highlight the lineage- and differentiation state–specific requirements for PcGs in XCI and argue against PcG function in the formation of the facultative heterochromatin of the inactive X-chromosome., Synopsis During the development of an embryo, an equal population of cells gives rise to different tissues and organs and this occurs via the activation and silencing of different sets of genes. The Polycomb group (PcG) proteins are required for silencing genes for proper development. PcGs play an important role in silencing of one of the two X-chromosomes in female mammals. XX females inactivate one X-chromosome to equalize X-linked gene dosage to that of XY males. X-chromosome inactivation (XCI) is established in cells of the early embryo and when these cells divide they maintain silencing of the same X-chromosome. XCI, therefore, is a model system to understand long-term gene regulation. Here the authors test whether PcGs help initiate XCI by examining mouse embryos lacking the essential PcG protein EED. Their results show that XCI in embryonic cells occurs normally despite lacking EED. PcGs therefore are not required to initiate or maintain XCI in embryonic cells. The findings shed light on the specific requirements for PcGs in XCI and argue against a general silencing function for PcGs in XCI.

Nature 383, 250–253 (1996) THE amino-acid sequence was accidentally omitted from Fig. la. The complete figure is shown here.

Aneuploid mouse embryos and fetuses are an important system for investigating the pathogenesis of the developmental and functional consequences of chromosome imbalance in mammals. However, the fact that almost all mouse aneuploids die in embryonic or fetal life restricts their usefulness for studies of loci and functions that are expressed only after birth. As an approach to rescuing aneuploid cells, we have prepared chimeras by aggregating aneuploid embryos with diploid embryos at the 8-16 cell stage. This technique has allowed us to produce trisomy 17 reversible diploid (Ts17 reversible 2n) chimeras containing cells of a trisomic state, which is ordinarily lethal at 10-12 days of gestation. All of the analyzed organs from the chimeras, including brain, liver, kidney, lung, muscle, heart, thymus, spleen, bone marrow, blood, and skin, contained both Ts17 and 2n cells. The proportion of Ts17 cells in each organ as estimated from coat color, enzyme markers (glucosephosphate isomerase), and karyotypes ranged from 5% to 85%, most commonly 20-40%. This is in contrast to the control 2n reversible 2n chimeras in which the 2n component on the same genetic background as the Ts17 generally comprised 60-90% of the cell population. The growth rates of the living Ts17 reversible 2n chimeras were in the lower half of the normal range, and the oldest animals are now age 14 mo. No progeny were obtained from Ts17 germ cells in the two fertile T217 reversible 2n chimeras. In comparison with analogous human situations, it is striking that, except for a kink in the tail of one living animal, none of the Ts17 reversible 2n chimeras had any discernible structural abnormalities. Our findings indicate that it is feasible to rescue cells from autosomal aneuploidies that otherwise result in early fetal death.

In general, autosomal monosomy is lethal much earlier in mammalian development than autosomal trisomy. In an attempt to understand why monosomy is so deleterious, we have begun to characterize the development of mouse embryos monosomic for chromosome 19. A dramatic loss of monosomy 19 embryos was found to occur between days 3 and 4 of development. This loss occurred both in vivo and in vitro and with intact blastocysts or isolated inner cell masses. Experiments with inbred strains showed that this loss was not; due to the expression of recessive lethal genes. While monosomic embryos were found to have fewer cells than normal and trisomic litter-mates beginning at the early morula stage, the ability to form blastocysts is not interfered with. Electron microscopy revealed no difference in the cellular ultrastructure of monosomic when compared with diploid embryos” Furthermore, two-dimensional gel electrophoresis did not reveal any differences in the proteins synthesized by monosomie, trisomic or diploid litter-mates when examined at day 3 of development. These results indicate a lack of gross genomic disturbances in monosomic embryos. When monosomy diploid chimaeras were made, viable monosomic cells were found in day-9 post-implantation embryos, well past the lethal period. Thus, in chimaerip embryos, the normal cells appear to be able to provide whatever is lacking, suggesting that monosomy 19 is not a cell lethal. Instead, death may be due to a dosage alteration in specific gene products needed during early development.