Back to Search
Start Over
Localization of mouse lumican (keratan sulfate proteoglycan) to distal chromosome 10
- Source :
- Mammalian genome : official journal of the International Mammalian Genome Society. 6(5)
- Publication Year :
- 1995
-
Abstract
- Lumican, a member of the small interstitial proteoglycan gene (SIPG) family, is a keratan sulfate proteoglycan present in large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle (Hassell et al. 1993), skin (Chakravarti et al. submitted), and intervertebral discs (B. Johnstone, personal communication). Like decorin, another SIPG member, lumican also interacts with collagen and limits growth of fibrils in diameter (Rada et al. 1993; Scott 1988). In the cornea, lumican not only interacts with collagen molecules to limit fibril growth, but by virtue of its keratan sulfate-containing glycosaminoglycan side chains plays a crucial role in the regular spacing of fibrils and acquisition of corneal transparency (Scott 1991). The primary structure of lumican, derived from cDNA sequencing of chicken, bovine, and human clones, shows all the characteristic features of the SIPG family, namely, four and two cysteines in the Nand C-terminal globular domains, I and III, and a central, cysteine-free domain l_I, with 9 ~ sheet-forming leucine motifs (Blochberger et al. 1992; Funderburgh et al. 1993; Chakravarti et al. submitted). In the human, lumican localizes to Chromosome (Chr) 12q21.3-22 (Chakravarti et al. submitted). We report localization of the mouse lumican gene to distal Chr 10 by segregation analysis of restriction fragment length variants (RFLV) in recombinant inbred (RI) strains of mice. This study further extends the conservation of synteny between human Chr 12q21.3-22 and distal mouse Chr 10. We used a lumican coding sequence, PCR amplified from a mouse lumican genomic clone in Southern analyses for chromosome localization. Mouse genomic clones for lumican were obtained by screening a 129/Sv genomic DNA library (Stratagene) with a human lumican cDNA probe. The mouse lumican coding sequence was amplified from one of these genomic clones, with oligonucleotide primers that amplify nucleotides 263-681 from human lumican cDNA. PCR amplification yielded a product of expected size (primer pairs, upper 5'AGTGTACCAATGGTGCCTCCTG3' and lower 5 'CAGTCTGGCTATCTGATTGAAGCTC3'; PCR conditions: hold at 94~ 5 rain, cycle program 94~ 1 rain, 50~ anneal, extend at 72~ The nucleotide sequence of this PCR product (data not shown) yielded the derived amino acid sequence of 108 amino acids from the highly conserved central domain II of lumican sharing 96% identity with bovine, 93% identity with human, and 77% identity with chicken at the amino acid level (Funderburgh et al. 1993; Chakravarti et al. submitted; Blochberger et al. 1992). The mouse coding sequence was used to identify lumican
- Subjects :
- Genetic Markers
Lumican
Keratan sulfate
Molecular Sequence Data
Mice, Inbred Strains
Chromosomes
Glycosaminoglycan
chemistry.chemical_compound
Mice
Mice, Inbred AKR
Genetics
Animals
Peptide sequence
biology
Base Sequence
Chromosome localization
Nucleic acid sequence
Chromosome Mapping
Molecular biology
Mice, Inbred C57BL
Proteoglycan
chemistry
Chondroitin Sulfate Proteoglycans
Keratan Sulfate
Mice, Inbred DBA
biology.protein
Primer (molecular biology)
Subjects
Details
- ISSN :
- 09388990
- Volume :
- 6
- Issue :
- 5
- Database :
- OpenAIRE
- Journal :
- Mammalian genome : official journal of the International Mammalian Genome Society
- Accession number :
- edsair.doi.dedup.....e129e1f0352eed53c09ee39b694640df