Search

Objective: To observe the clinical and biological characteristics of Non-IgM-secreting lymphoplasmacytic lymphoma (LPL) and draw the differences between non-IgM LPL and Waldenström macroglobulinemia (WM)., Methods: Records of 13 patients with non-IgM LPL were retrospectively analyzed between January 2000 and December 2013. The cytogenetic aberrations were detected by fluorescence in situ hybridisation (FISH)., Results: In the cohort, 7 males and 6 females with a median age of 63 years (range 43 to 74), two patients were IgA secreting, 6 with IgG secreting and 5 patients without monoclonal globulin. The major complaint at diagnosis included anemia associated symptom (53.8%), mucocutaneous hemorrhage and superficial lymphadenopathy (15.4%). Eight patients had B symptom at diagnosis. All of the 13 patients had bone marrow involvement and anemia, and 10 patients had 2 or 3 lineage cytopenia. In 5 patients with available immunophenotypic data, all expressed CD19, CD20, CD22 and CD25, but missed the expression of CD10, CD103 and CD38. Two cases had CD5 or sIgM positive alone. Another 2 patients were CD23 or CD11c positive and 3 patients were FMC7 positive. Cytogenetic aberrations had been detected by FISH in 7 patients, but only two (28.6%) patients had aberrations with del(6q)., Conclusion: The clinical and biological characteristics had no significantly difference between non-IgM LPL and WM.

Purpose: Accumulating evidence indicates that intratumor heterogeneity is prevalent in multiple myeloma and that a collection of multiple, genetically distinct subclones are present within the myeloma cell population. It is not clear whether the size of clonal myeloma populations harboring unique cytogenetic abnormalities carry any additional prognostic value., Experimental Design: We analyzed the prognostic impact of cytogenetic aberrations by fluorescence in situ hybridization at different cutoff values in a cohort of 333 patients with newly diagnosed myeloma and 92 patients with relapsed myeloma., Results: We found that nearly all IgH-related arrangements were observed in a large majority of the purified plasma cells; however, 13q deletion, 17p deletion, and 1q21 amplification appeared in different percentages within the malignant plasma cell population. Based on the size of subclones carrying these cytogenetic aberrations, the patients were divided into four groups: 0%-10%, 10.5%-20%, 20.5%-50%, and >50%. Receiver-operating characteristics analysis was applied to determine the optimal cutoff value with the greatest differential survival and showed that the most powerful clone sizes were 10% for 13q deletion, 50% for 17p deletion, and 20% for 1q21 gains, which provided the best possible cutoffs for predicting poor outcomes., Conclusions: Our study indicated that the impact of clone size on prognostic value varies between specific genetic abnormalities. Prognostic value was observed for even a subgroup of plasma cells harboring the cytogenetic aberration of 13q deletion and 1q21 gains; however, 17p deletion displayed the most powerful cutoff for predicting survival only if the predominant clones harbored the abnormality., (©2015 American Association for Cancer Research.)

The deletion of 12p (del(12p)) has been described as a novel negative prognostic marker in multiple myeloma (MM) and has gained increasing attention in recent years. However, its impact on MM is still controversial. In this study, we comprehensively evaluated the clinical impact of 12p13 deletion using fluorescence in situ hybridization (FISH) on 275 newly diagnosed MM cases treated in a prospective, non-randomized clinical trial (BDH 2008/02). The results showed that deletion of 12p13 was detected in 10.5% of newly diagnosed cases and associated with multiple indicators for high tumor burden including ISS III, BM plasmacytosis larger than 50%, and renal lesion. Moreover, the cases with 12p13 deletion typically had higher incidence of del(17p), IGH translocation and t(4;14). Patients with del(12p) conferred significantly adverse prognosis for PFS and OS, even in patients subjected to bortezomib-based therapy. When adjusted to the established prognostic variables including del(13q), del(17p), t(4;14), amp(1q21), ISS stage and LDH, del(12p13) remained the powerful independent adverse factor for PFS (P = 0.007) and OS (P = 0.032). In addition, del(12p13) combined with high β2-MG, high LDH and bone lesion can further identify subpopulations with high-risk features. Our results strongly supported that del(12p13) can be used as a valuable prognostic marker in MM.

Multiple myeloma (MM) is a heterogeneous disease, and the benefit from bortezomib treatment is not uniform among all patients subgroups. Currently, little information is available to predict patients response to bortezomib treatment. In this study, we aimed to identify patients benefiting minimally from bortezomib as part of first-line therapy and to define high-risk MM in the context of bortezomib treatment. We compared the effect of a bortezomib-based treatment (arm B) with that of a treatment without bortezomib (arm A) on different genetic patient subgroups in a series of 273 cases of newly diagnosed MM. These patients were enrolled in a prospective, non-randomized clinical trial (BDH 2008/02). A subgroup of patients exhibiting little benefit from bortezomib treatment was identified. These patients had at least one of the following characteristics: del(17p13), 1q21 gain, or high lactate dehydrogenase levels. In this subgroup, survival of patients treated with bortezomib was comparable (progression-free survival: 14.0 vs. 15.0 months, p = 0.992; overall survival: 21.0 vs. 14.0 months, p = 0.472) to that of patients undergoing thalidomide-based treatment. We propose that all patients with newly diagnosed MM should be evaluated for these three markers before bortezomib treatment. Other novel drugs and alternative therapeutic strategies are needed for patients with such markers., (Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.)

Objective: To investigate pathologic and differential diagnostic features of pediatric Burkitt lymphoma (BL)., Methods: A total of 20 cases of pediatric BL were retrospectively reviewed for their clinical and pathologic profiles. Bone marrow aspiration specimens were available in all cases and bone marrow biopsies were available for immunohistochemical study in 18 cases. Flow cytometry study was available in 16 cases. MYC translocation by FISH method was performed in 11 cases., Results: Atypical lymphocytes with cytoplasmic vacuoles were found in bone marrow smears in all 20 cases and peripheral blood films in all 19 available cases. The bone marrow biopsies showed infiltration by uniform medium-sized atypical lymphocytes with multiple small nucleoli but without the starry-sky pattern in all 18 cases. Immunohistochemistry showed the following results in all 18 cases: positive for CD20, PAX-5, CD10, CD34 and TdT, but negative for bcl-2 and CD3 with Ki-67 > 95%.Flow cytometry showed CD19+CD20+CD10+FMC7+CD22+TdT-CD3- in 16 cases, including κ+ in 8 cases, λ+ in 7 cases, and κ-λ- in 1 case. MYC gene rearrangement by FISH was observed in 10 of the 11 cases., Conclusions: The histopathology of BL is distinct, including atypical lymphocytes with cytoplasmic vacuoles in bone marrow aspirate, lack of starry-sky patternin bone marrow biopsy. Generally, the diagnosis should be made with a combined immunophenotype and FISH approach. Pediatric BL must be distinguished from DLBCL and B-cell lymphoma, unclassifiable, which has intermediate features between DLBCL and Burkitt lymphoma.

The development of a bacteria-inducible expression system has several advantages compared with persistent expression of anti-bacterial proteins in milk to prevent and treat mastitis. The present study determined whether mastitis responsive promoters could regulate enhanced green fluorescent protein (EGFP) expression in goat mammary epithelial cells (GMECs) in response to challenges with Escherichia coli, Staphylococcus aureus or Streptococcus agalactiae. The level of expression of interleukin (IL)-1α was significantly increased in GMECs challenged with E. coli, S. aureus or S. agalactiae compared with untreated GMECs. IL-1β was induced by E. coli and S. aureus, while Toll-like receptor 2 (TLR2) was induced by E. coli only. GMECs were transfected with IL-1α, IL-1β and TLR2 promoter-EGFP reporter gene lentiviral expression vectors and the levels of expression of EGFP were measured by flow cytometry and Western blot analysis after bacterial challenge. EGFP expression driven by the IL-1α and IL-1β promoters was higher in GMECs challenged with E. coli, S. aureus or S. agalactiae than in untreated GMECs. There were no differences in EGFP expression driven by the TLR2 promoter between GMECs challenged with S. aureus or S. agalactiae and untreated GMECs, but EGFP expression was significantly increased in GMECs challenged with E. coli. Overall, these results indicate that the promoters of some bacteria-inducible genes can regulate EGFP expression in GMECs in response to bacterial challenges. This bacteria-inducible expression strategy could be used for production of mastitis resistant animals by regulating the expression of anti-bacterial proteins in the mammary gland., (Copyright © 2014 Elsevier Ltd. All rights reserved.)

Temple-Baraitser syndrome (TBS) is a multisystem developmental disorder characterized by intellectual disability, epilepsy, and hypoplasia or aplasia of the nails of the thumb and great toe. Here we report damaging de novo mutations in KCNH1 (encoding a protein called ether à go-go, EAG1 or KV10.1), a voltage-gated potassium channel that is predominantly expressed in the central nervous system (CNS), in six individuals with TBS. Characterization of the mutant channels in both Xenopus laevis oocytes and human HEK293T cells showed a decreased threshold of activation and delayed deactivation, demonstrating that TBS-associated KCNH1 mutations lead to deleterious gain of function. Consistent with this result, we find that two mothers of children with TBS, who have epilepsy but are otherwise healthy, are low-level (10% and 27%) mosaic carriers of pathogenic KCNH1 mutations. Consistent with recent reports, this finding demonstrates that the etiology of many unresolved CNS disorders, including epilepsies, might be explained by pathogenic mosaic mutations.

Objective: To report the diagnosis, differential diagnosis and treatment of three rare cases of primary bone marrow diffuse large B cell lymphoma (DLBCL), and to improve the recognition of this disease., Methods: The clinical characteristics, therapeutic course and the outcome of these patients were reviewed. Meanwhile, a series of examinations including morphology, flow cytometry, immunohistochemistry and molecular biology of bone marrow samples were also performed., Results: These three patients who were old at the onset age (56, 60 and 70 years old), primarily revealed as abnormal blood count and experienced an aggressive course of disease. Physical and imaging examination showed no enlargement of lymph node, liver and spleen, the patients were finally diagnosed as primary bone marrow DLBCL by bone marrow morphology, flow cytometry and immunohistochemistry analyses. They were treated with rituximab combined chemotherapy, which achieved a complete response, but still need longer follow-up to further evaluate their survival., Conclusion: Primary bone marrow DLBCL was encountered rarely in clinical practice, and this is the first report in China. Further investigation of pathogenesis and therapeutic strategies of this rare disease was warranted.

Sokal, Euro and newly developed EUTOS scoring systems were validated in 220 Chinese chronic phase chronic myeloid leukemia (CP-CML) patients treated with frontline imatinib. In the EUTOS low-risk and high-risk groups, the 5-year OS was 98.7% vs. 71.4% (P<0.0001), and the 5-year cumulative incidence of complete cytogenetic response (CCyR) was 92.4% vs. 53.8% (P<0.0001). EUTOS score also predicted progression-free survival and duration of CCyR. Low EUTOS index predicted for CCyR. However, Sokal and Euro scores mainly could not discriminate the intermediate-risk from high-risk group in either survival or CCyR. EUTOS score forecasts the prognosis of CP-CML patients treated with first-line imatinib., (Copyright © 2014 Elsevier Ltd. All rights reserved.)

The majority of acute promyelocytic leukemia (APL) cases are characterized by the PML-RARα fusion gene. Although the PML-RARα fusion gene can be detected in >98% of APL cases, RARα is also found to be fused with other partner genes, which are also related to all-trans retinoic acid (ATRA)-dependent transcriptional activity and cell differentiation. In this study, we identified a novel RARα fusion gene, TBLR1-RARα (GenBank KF589333), in a rare case of APL with a t(3;17)(q26;q21),t(7;17)(q11.2;q21) complex chromosomal rearrangement. To our knowledge, TBLR1-RARα is the 10th RARα chimeric gene that has been reported up to now. TBLR1-RARα contained the B-F domains of RARα and exhibited a distinct subcellular localization. It could form homodimers and also heterodimers with retinoid X receptor α. As a result, TBLR1-RARα exhibited diminished transcriptional activity by recruitment of more transcriptional corepressors compared with RARα. In the presence of pharmacologic doses of ATRA, TBLR1-RARα could be degraded, and its homodimerization was abrogated. Moreover, when treated with ATRA, TBLR1-RARα could mediate the dissociation and degradation of transcriptional corepressors, consequent transactivation of RARα target genes, and cell differentiation induction in a dose- and time-dependent manner., (© 2014 by The American Society of Hematology.)

Object: To study the relationship between monocyte/histiocyte activation and myelodysplastic syndrome (MDS)., Methods: Analyzing ultrastructure and myeloperoxidase reaction of nucleated cells in bone marrow from 59 cases of MDS by transmission electron microscopy. Four groups of MDS were subdivided on the basis of their content of activated inflammatory cells - morbid hematopoiesis with minimal inflammatory cell activation (MH-MICA); MDS with monocytic system activation (MSA); MDS with lymphocyte activation (LCA); and MDS with granulocyte activation (GCA)., Results: About 20, 22, 7, and 10 cases were classified as MH-MICA (34%), MSA (37%), LCA (12%), and GCA sub-types (17%), respectively. About 3, 5, 0, and 3 cases from MH-MICA, MSA, LCA, and GCA, respectively, underwent leukemic transformation within 2 years., Conclusion: The findings suggest that activation of inflammatory cells in bone marrow is an important feature of MDS, and that monocytes/histocytes are perhaps the most prominent cellular participants in the pathogenesis of MDS.

Objective: To explore the feasibility of detecting lymphoma with the application of BIOMED-2 standardized immunoglobulin/T cell receptor (IG/TCR) gene rearrangement system in formalin fixed paraffin-embedded (FFPE) tissue samples, and to discuss the relationship between the longest amplification fragment of extracted DNA and positive detection rate of different IGH V-J primers., Methods: DNA was extracted from 50 cases of FFPE tissue samples. Multiplex-PCR amplifications were performed and then the IG/TCR gene rearrangements were analyzed using BIOMED-2 standardized clonality analysis system., Results: (1)When the DNA concentration was diluted to 50-100 ng/μl from 100-500 ng/μl, the proportion of the longest amplification fragment (300-400 bp) of DNA was improved from 10.0% to 90.0% in 30 cases of diffuse large B cell lymphoma (DLBCL) wax roll samples (P<0.01). The positive rate of IGH+IGK was increased from 46.7% to 83.3%, the difference was statistically significant (P=0.006). The lengths of the longest amplification fragments of DNA were all longer than 300 bp in the paraffin section samples of DLBCL. The positive rate of IGH+IGK of these samples was 96.7%. The difference of the positive rate of IGH+IGK between the wax roll samples and the paraffin section samples had no statistical significance (P=0.195). (2)When the concentration of DNA was high, most of the longest amplification fragments of extracted DNA were 100 bp or 200 bp, and the detection rate of short fragment IGH FR3 was more stable than that of long fragment IGH FR1. (3)The clonality analysis of TCRG+TCRB in all 13 cases of peripheral T cell lymphoma samples showed positive results, while no positive IG/TCR clones were found in 7 cases of reactive lymphoid tissue hyperplasia in control group., Conclusion: Dilution of DNA is the only method to improve not only the proportion of longest fragment amplification but also the detection rate of clonality. The detection rate of IGH FR3 would not be affected by the concentration of DNA. The application of BIOMED-2 standardized IG/TCR gene rearrangement system in FFPE tissue samples plays an important role in the lymphoma diagnosis.

Objective: To evaluate the three-probe fluorescence in situ hybridization (FISH) panel in the diagnosis of pediatric B cell acute lymphoblastic leukemia (B-ALL)., Methods: Three-probe (TELAML1, BCR-ABL and MLL) FISH and conventional cytogenetic analysis were performed in 207 children with B-ALL., Results: In 207 B-ALL children, the three-probe FISH panel assay showed that 151 cases carried genetic aberrancies with a positive rate of 72.9%, including 44 cases with typical positive signal patterns and 148 cases with atypical signal patterns (among them 41 cases have multiprobe abberancy). The conventional cytogenetic analysis detected 53 cases chromosomal abnormality with a positive rate of 25.6%., Conclusion: The detection rate of genetic abnormalities in newly- diagnosed pediatric B-ALL could be significantly improved by using three-probe FISH panel upon conventional cytogenetic analysis.

Normal plasma cells (PCs) are either undetectable or outnumbered by the myelomatous PC compartment in bone marrow of multiple myeloma (MM). However, residual normal PCs have been detected in a minority of symptomatic MM patients with superior survival. The number of normal PCs is also an important factor to identify monoclonal gammopathy of undetermined significance (MGUS)-like MM. We speculate that the polyclonal serum IgM level in non-IgM myelomas may reflect the number of residual normal PCs. Here we investigated the prognostic relevance of polyclonal serum IgM level in a series of 485 newly diagnosed symptomatic MM (NDMM) patients. Our results showed that symptomatic MM patients with polyclonal IgM more than 0.5g/L displayed a favorable baseline clinical feature, together with a significantly lower frequency of high-risk cytogenetic abnormalities. This group of patients had a significantly prolonged progression-free survival (PFS) and overall survival (OS) regardless of thalidomide or bortezomib therapy. Furthermore, the superior outcome was independent of the depth of response. Our findings suggest that polyclonal IgM level is capable of identifying a group of symptomatic MM patients with distinct clinicobiological characteristics and favorable survival, similar with MGUS-like MM., (Copyright © 2014 Elsevier Ltd. All rights reserved.)

The purpose of this study was to evaluate the potential associations between HLA-A, B, DRB1 gene and leukemia. A total of 1186 leukemic patients, including 326 patients with acute lymphoblastic leukemia (ALL), 545 patients with acute myeloid leukemia (AML), 315 patients with chronic myeloid leukemia (CML), and 1234 healthy unrelated donors were typed and were compared in a single centre by using same technique, then the Bonferroni correction method was used to correct the Type I error. The results indicated that as compared with the control,the frequency of HLA-DRB1(*)09 in ALL group significantly decreased (10.87% versus 16.08%; Pc = 0.014, OR = 0.637, 95% CI = 0.487-0.834), while in comparison with control, the frequency of HLA-B(*)18 in CML group was significantly higher (1.28% vs 0.20%; Pc = 0.039, OR = 6.336, 95% CI = 2.066-19.434). The positive and negative relation may exist between certain HLA molecules and leukemia. The negative relation between HLA-DRB1(*)09 and ALL indicated that DRB1*09 might play an important role by a restricted T-cell immune response in the early leukemogenic events, whereas the positive relation between HLA-B(*)18 and CML suggests that the B(*)18 molecules may not actively present leukemia-specific antigens resulting in immune escape. It is concluded that these findings can contribute to developing more appropriate method in leukemic immunotherapy.

Extensive studies of the genetic aberrations related to human diseases conducted over the last two decades have identified recurrent genomic abnormalities as potential driving factors underlying a variety of cancers. Over the time, a series of cutting-edge high-throughput genetic tests, such as microarrays and next-generation sequencing, have been developed and incorporated into routine clinical practice. Although it is a classical low-throughput cytogenetic test, fluorescence in situ hybridization (FISH) does not show signs of fading; on the contrary, it plays an increasingly important role in detecting specific biomarkers in solid and hematologic neoplasms and has therefore become an indispensable part of the rapidly developing field of personalized medicine. In this article, we have summarized the recent advances in FISH application for both de novo discovery and routine detection of chromosomal rearrangements, amplifications, and deletions that are associated with the pathogenesis of various hematopoietic and non-hematopoietic malignancies. In addition, we have reviewed the recent developments in FISH methodology as well.

Objective: To investigate the incidence, molecular features and clinical significance of CCAAT/enhancer binding protein alpha (CEBPA) gene mutation in patients with acute myeloid leukemia (AML)., Methods: Mutation analysis of the entire coding region of CEBPA gene in 206 de novo AML patients was performed by using polymerase chain reaction (PCR) followed by sequence analysis and fragment length analysis., Results: Of 206 AML patients, 31 (15%) had CEBPA gene mutations, including 23 with double mutations (duCEBPA) and 8 with single mutation (siCEBPA). CEBPA gene mutations presented mainly in M2 subtype or intermediate risk patients. As compared with those with wild type CEBPA gene, patients with mutated CEBPA gene were of higher white blood cell counts [20.92(0.86-351.43)× 10(9)//L vs 8.17(0.47-295.2) × 10(9)/L, P=0.003], higher hemoglobin levels [97.5(51-128) g/L vs 80.5(13-153) g/L, P=0.015] and lower platelet counts [27.5(5-81)× 10(9)//L vs 44(3-548)× 10(9)/L, P=0.004]. Patients with CEBPA gene mutation had higher complete remission (CR) rate than those with wild type (P=0.009). While co-existing of NPM1 and siCEBPA mutations was observed in M5 subtype (2/8, 25%), NPM1 gene mutation was not present in any patients with duCEBPA mutation (0/23, 0%). Dynamic tracking analysis showed that CEBPA mutations disappeared at CR, and the same mutations re-appeared at relapse. When compared to sequence analysis, the coincidence rate of CEBPA mutations detected by fragment length analysis was 100% (54/54)., Conclusion: CEBPA gene mutation is a recurring genetic change in AML patients and has a certain correlation with clinical and laboratory features. It could be reliably used as a potential marker for minimal residual disease follow up. The prognostic significance of co-existing of siCEBPA with NPM1 mutations in patients with AML-M5 subtype needs further investigation.

Hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC) is a rare hereditary leukoencephalopathy that was originally identified by MRI pattern analysis, and it has thus far defied all attempts at identifying the causal mutation. Only 22 cases are published in the literature to date. We performed exome sequencing on five family trios, two family quartets, and three single probands, which revealed that all eleven H-ABC-diagnosed individuals carry the same de novo single-nucleotide TUBB4A mutation resulting in nonsynonymous change p.Asp249Asn. Detailed investigation of one of the family quartets with the singular finding of an H-ABC-affected sibling pair revealed maternal mosaicism for the mutation, suggesting that rare de novo mutations that are initially phenotypically neutral in a mosaic individual can be disease causing in the subsequent generation. Modeling of TUBB4A shows that the mutation creates a nonsynonymous change at a highly conserved asparagine that sits at the intradimer interface of α-tubulin and β-tubulin, and this change might affect tubulin dimerization, microtubule polymerization, or microtubule stability. Consistent with H-ABC's clinical presentation, TUBB4A is highly expressed in neurons, and a recent report has shown that an N-terminal alteration is associated with a heritable dystonia. Together, these data demonstrate that a single de novo mutation in TUBB4A results in H-ABC., (Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.)

Inherited white-matter disorders are a broad class of diseases for which treatment and classification are both challenging. Indeed, nearly half of the children presenting with a leukoencephalopathy remain without a specific diagnosis. Here, we report on the application of high-throughput genome and exome sequencing to a cohort of ten individuals with a leukoencephalopathy of unknown etiology and clinically characterized by hypomyelination with brain stem and spinal cord involvement and leg spasticity (HBSL), as well as the identification of compound-heterozygous and homozygous mutations in cytoplasmic aspartyl-tRNA synthetase (DARS). These mutations cause nonsynonymous changes to seven highly conserved amino acids, five of which are unchanged between yeast and man, in the DARS C-terminal lobe adjacent to, or within, the active-site pocket. Intriguingly, HBSL bears a striking resemblance to leukoencephalopathy with brain stem and spinal cord involvement and elevated lactate (LBSL), which is caused by mutations in the mitochondria-specific DARS2, suggesting that these two diseases might share a common underlying molecular pathology. These findings add to the growing body of evidence that mutations in tRNA synthetases can cause a broad range of neurologic disorders., (Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.)

Long noncoding RNAs (lncRNAs) are increasingly recognized to play major regulatory roles in development and disease. To identify novel regulators in breast biology, we identified differentially regulated lncRNAs during mouse mammary development. Among the highest and most differentially expressed was a transcript (Zfas1) antisense to the 5' end of the protein-coding gene Znfx1. In vivo, Zfas1 RNA is localized within the ducts and alveoli of the mammary gland. Zfas1 intronically hosts three previously undescribed C/D box snoRNAs (SNORDs): Snord12, Snord12b, and Snord12c. In contrast to the general assumption that noncoding SNORD-host transcripts function only as vehicles to generate snoRNAs, knockdown of Zfas1 in a mammary epithelial cell line resulted in increased cellular proliferation and differentiation, while not substantially altering the levels of the SNORDs. In support of an independent function, we also found that Zfas1 is extremely stable, with a half-life >16 h. Expression analysis of the SNORDs revealed these were expressed at different levels, likely a result of distinct structures conferring differential stability. While there is relatively low primary sequence conservation between Zfas1 and its syntenic human ortholog ZFAS1, their predicted secondary structures have similar features. Like Zfas1, ZFAS1 is highly expressed in the mammary gland and is down-regulated in breast tumors compared to normal tissue. We propose a functional role for Zfas1/ ZFAS1 in the regulation of alveolar development and epithelial cell differentiation in the mammary gland, which, together with its dysregulation in human breast cancer, suggests ZFAS1 as a putative tumor suppressor gene.

Objective: To explore the role of cortactin in endocytosis of colon cancer cells and clarify the significance of its over-expression in colon cancer tissues., Methods: Immunohistochemistry and Western blot were employed to detect the expression of cortactin in benign and malignant tissues and cells. Cell endocytosis was examined in cancer cells after siRNA treatment and DNA transfection with plasmid encoding cortactin wild type and domain deletion mutants., Results: Cortactin was over-expressed in colon cancer tissues than in adjacent normal tissues. The expression rate was 77.5% in cancer tissues and 47.5% in normal tissues (P < 0.05). The value of transferrin uptake was 0.61 ± 0.02 in siRNA treated cancer cells and 1.01 ± 0.16 in the control cells (P < 0.05). Intact molecule and sufficient level of cortactin was required for an optimal endocytosis of cancer cells. Cortactin was involved in coated-vesicle transportation in cells., Conclusion: Endocytosis in colon cancer cells is dependent on an intact expression of CTTN. An over-expression of cortactin facilitates the signaling in invasion and metastasis related to endocytosis.

The transcriptional networks that regulate embryonic stem (ES) cell pluripotency and lineage specification are the subject of considerable attention. To date such studies have focused almost exclusively on protein-coding transcripts. However, recent transcriptome analyses show that the mammalian genome contains thousands of long noncoding RNAs (ncRNAs), many of which appear to be expressed in a developmentally regulated manner. The functions of these remain untested. To identify ncRNAs involved in ES cell biology, we used a custom-designed microarray to examine the expression profiles of mouse ES cells differentiating as embryoid bodies (EBs) over a 16-d time course. We identified 945 ncRNAs expressed during EB differentiation, of which 174 were differentially expressed, many correlating with pluripotency or specific differentiation events. Candidate ncRNAs were identified for further characterization by an integrated examination of expression profiles, genomic context, chromatin state, and promoter analysis. Many ncRNAs showed coordinated expression with genomically associated developmental genes, such as Dlx1, Dlx4, Gata6, and Ecsit. We examined two novel developmentally regulated ncRNAs, Evx1as and Hoxb5/6as, which are derived from homeotic loci and share similar expression patterns and localization in mouse embryos with their associated protein-coding genes. Using chromatin immunoprecipitation, we provide evidence that both ncRNAs are associated with trimethylated H3K4 histones and histone methyltransferase MLL1, suggesting a role in epigenetic regulation of homeotic loci during ES cell differentiation. Taken together, our data indicate that long ncRNAs are likely to be important in processes directing pluripotency and alternative differentiation programs, in some cases through engagement of the epigenetic machinery.

Recent large-scale analyses of mainly full-length cDNA libraries generated from a variety of mouse tissues indicated that almost half of all representative cloned sequences did not contain an apparent protein-coding sequence, and were putatively derived from non-protein-coding RNA (ncRNA) genes. However, many of these clones were singletons and the majority were unspliced, raising the possibility that they may be derived from genomic DNA or unprocessed pre-mRNA contamination during library construction, or alternatively represent nonspecific "transcriptional noise." Here we show, using reverse transcriptase-dependent PCR, microarray, and Northern blot analyses, that many of these clones were derived from genuine transcripts of unknown function whose expression appears to be regulated. The ncRNA transcripts have larger exons and fewer introns than protein-coding transcripts. Analysis of the genomic landscape around these sequences indicates that some cDNA clones were produced not from terminal poly(A) tracts but internal priming sites within longer transcripts, only a minority of which is encompassed by known genes. A significant proportion of these transcripts exhibit tissue-specific expression patterns, as well as dynamic changes in their expression in macrophages following lipopolysaccharide stimulation. Taken together, the data provide strong support for the conclusion that ncRNAs are an important, regulated component of the mammalian transcriptome.

Three mutants with Tn5-B21 insertion in tonB3 (PA0406) of Pseudomonas aeruginosa exhibited defective twitching motility and reduced assembly of extracellular pili. These defects could be complemented with wild-type tonB3.

Background: The nucleolus is the site of rRNA synthesis and processing in eukaryotic cells, but its composition remains poorly understood., Results: We have identified a novel nucleolar RNA-associated protein (Nrap) which is highly conserved from yeast (Saccharomyces cerevisiae) to human, with homologues in mouse, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Schizosaccharomyces pombe, and other species. In the mouse, we have found that Nrap is ubiquitously expressed and is specifically localized in the nucleolus. We have also identified splice variants in human and mouse, and defined the intron-exon structure of the human Nrap gene. Nrap is inherited into daughter nuclei by associating with the condensed chromosomes during mitosis. RNase treatment of permeabilized cells indicated that the nucleolar localization of Nrap is RNA dependent. The effects of actinomycin D, cycloheximide and 5,6-dichloro-beta-d-ribofuranosyl-benzimidazole on Nrap expression and distribution in cultured cells suggest that Nrap is associated with the pre-rRNA transcript., Conclusions: Nrap is a large nucleolar protein (of more than 1000 amino acids), and is a new class of protein with new structural and functional motifs. Nrap appears to be associated with ribosome biogenesis by interacting with pre-rRNA primary transcript.

The G3BP (ras-GTPase-Activating Protein SH3-Domain-Binding Protein) family of proteins has been implicated in both signal transduction and RNA-metabolism. We have previously identified human G3BP-1, G3BP-2, and mouse G3BP-2. Here, we report the cloning of mouse G3BP-1, the discovery of two alternatively spliced isoforms of mouse, and human G3BP-2 (G3BP-2a and G3BP-2b), and the chromosomal localisation of human G3BP-1 and G3BP-2, which map to 5q14.2-5q33.3 and 4q12-4q24 respectively. We mapped the rasGAP(120) interactive region of the G3BP-2 isoforms and show that both G3BP-2a and G3BP-2b use an N-terminal NTF2-like domain for rasGAP(120) binding rather than several available proline-rich (PxxP) motifs found in members of the G3BPs. Furthermore, we have characterized the protein expression of both G3BP-1 and G3BP-2a/b in adult mouse tissues, and show them to be both tissue and isoform specific., (Copyright 2001 Wiley-Liss, Inc.)

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.

Two membrane-permeable and RNase-resistant antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNAs) have been synthesized as inhibitors of human breast cancer, with nucleotide sequences complementary to the genes of RIalpha subunit of protein kinase A (RIalpha/PKA) and erbB-2, respectively. Both compounds inhibit the proliferation of SK-Br-3 breast cancer cells in culture above the concentration of 10 microg/ml, but have no effect on nontumorigenic MCF-10A breast cells. These antisense inhibitors also block the cell colony formation in methylcellulose medium, whereas the control poly-DNP-RNA with either random or sense sequence has no effect. RT-PCR data show that the antisense inhibition decreases the concentration of the mRNA. TdT-mediated dUTP nick-end labeling (TUNEL) fluorescence assay indicates that the targeted antisense inhibition by poly-DNP-RNAs leads to apoptosis of SK-Br-3 cells but does not affect nontumorigenic MCF-10A cells. The control poly-DNP-RNAs with random or sense nucleotide sequence are completely inactive.